Wed Nov 13 02:45:18 UTC 2024 I: starting to build seqprep/trixie/i386 on jenkins on '2024-11-13 02:44' Wed Nov 13 02:45:18 UTC 2024 I: The jenkins build log is/was available at https://jenkins.debian.net/userContent/reproducible/debian/build_service/i386_6/43406/console.log Wed Nov 13 02:45:18 UTC 2024 I: Downloading source for trixie/seqprep=1.3.2-9 --2024-11-13 02:45:18-- http://deb.debian.org/debian/pool/main/s/seqprep/seqprep_1.3.2-9.dsc Connecting to 46.16.76.132:3128... connected. Proxy request sent, awaiting response... 200 OK Length: 2260 (2.2K) [text/prs.lines.tag] Saving to: ‘seqprep_1.3.2-9.dsc’ 0K .. 100% 207M=0s 2024-11-13 02:45:18 (207 MB/s) - ‘seqprep_1.3.2-9.dsc’ saved [2260/2260] Wed Nov 13 02:45:18 UTC 2024 I: seqprep_1.3.2-9.dsc -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA512 Format: 3.0 (quilt) Source: seqprep Binary: seqprep, seqprep-data Architecture: any all Version: 1.3.2-9 Maintainer: Debian Med Packaging Team Uploaders: Tim Booth , Andreas Tille , Nilesh Patra Homepage: http://seqanswers.com/wiki/SeqPrep Standards-Version: 4.6.2 Vcs-Browser: https://salsa.debian.org/med-team/seqprep Vcs-Git: https://salsa.debian.org/med-team/seqprep.git Testsuite: autopkgtest Testsuite-Triggers: python3 Build-Depends: debhelper-compat (= 13), python3 , zlib1g-dev Package-List: seqprep deb science optional arch=any seqprep-data deb science optional arch=all Checksums-Sha1: 9f533e1fd14d310ba0ccd4ef38c3abc55b8fc5fd 37177540 seqprep_1.3.2.orig.tar.gz 11f37baa93c01a1a0d426c8be5962c16456a0179 12468 seqprep_1.3.2-9.debian.tar.xz Checksums-Sha256: 2b8a462a0e0a3e51f70be7730dc77b1f2bb69e74845dd0fbd2110a921c32265a 37177540 seqprep_1.3.2.orig.tar.gz 53981b79fe38cce3023ba0ab9886195dcd2fd393c0057cd8ef43ffe06bbe32db 12468 seqprep_1.3.2-9.debian.tar.xz Files: b6a4f5491dfdb0ce38bf791454151468 37177540 seqprep_1.3.2.orig.tar.gz 597564b70492bef8006e45a6892f3b76 12468 seqprep_1.3.2-9.debian.tar.xz Dgit: 54dee1026394119b68bdc391655ecce7ce762485 debian archive/debian/1.3.2-9 https://git.dgit.debian.org/seqprep -----BEGIN PGP SIGNATURE----- iQJIBAEBCgAyFiEEj5GyJ8fW8rGUjII2eTz2fo8NEdoFAmXzUowUHGVtb2xsaWVy QGRlYmlhbi5vcmcACgkQeTz2fo8NEdrxww/8DPKZiUgRjm/L916gf0wJtQaqriYT DBNLVB4cW4VrgP2Bhe+wcINTTrnLH8zij6rbB59+AN/8JSf8JOQ6vaCaNnAdu5CQ FQriCWoDH33YcMkul2N5ygAx6idQIf0YH1ILpo9koiKsgjB+M7SN/eGw2pc2g0DS u2GEWe0jYlFN4CWdpn2Fy0ccBwbCj90hlAdAADqVRU0uBATRLP075qeWH4PaTS/Y pWGDwK5Z7Kpx8AGNpb1IvqXuZ6ngjU71blKFtu0oOTJSTqu6eTUy2OOGLlktyF2H 1TOnRp3+PVzJZHEgv2snySkdHILURfa6owQU9R+wPisotosbBcSy3lDjS0gXtRoP 00FiCu42xaLy0LC+jiSWMLZE5GUNfKjTdQgscQfke2r6c1FsQfiLagqde++QReh6 SCx9kHyUhswU0o0qdrbpZl6erAZ2yHIiiWkiNglhOJbjRqcyvlTS6+BSXsY8gdlJ 7r8ll/5717FPGiU2/syzXw8xpPmut6KneYecSxrB82/vDqRnzZif9X+0FFCicL7t 7VOnaXdVysscPBu2qEk1AHv9HM+E83B91kqPr+EaES4CBEZDl9TD+EeWOcnsJJJB 2EQR8Df8M1S1BYB9NzRb9+a2Ix/3Y+rRb5w9005O1MQ0/jU+9iGsBg7kfBVrzAJR /HQ7Z4cUVwbWMZM= =6Mqd -----END PGP SIGNATURE----- Wed Nov 13 02:45:18 UTC 2024 I: Checking whether the package is not for us Wed Nov 13 02:45:18 UTC 2024 I: Starting 1st build on remote node ionos6-i386.debian.net. Wed Nov 13 02:45:18 UTC 2024 I: Preparing to do remote build '1' on ionos6-i386.debian.net. Wed Nov 13 02:46:33 UTC 2024 I: Deleting $TMPDIR on ionos6-i386.debian.net. I: pbuilder: network access will be disabled during build I: Current time: Mon Dec 15 21:08:20 -12 2025 I: pbuilder-time-stamp: 1765876100 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/trixie-reproducible-base.tgz] I: copying local configuration W: --override-config is not set; not updating apt.conf Read the manpage for details. I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: using eatmydata during job I: Copying source file I: copying [seqprep_1.3.2-9.dsc] I: copying [./seqprep_1.3.2.orig.tar.gz] I: copying [./seqprep_1.3.2-9.debian.tar.xz] I: Extracting source gpgv: Signature made Thu Mar 14 19:39:56 2024 gpgv: using RSA key 8F91B227C7D6F2B1948C8236793CF67E8F0D11DA gpgv: issuer "emollier@debian.org" gpgv: Can't check signature: No public key dpkg-source: warning: cannot verify inline signature for ./seqprep_1.3.2-9.dsc: no acceptable signature found dpkg-source: info: extracting seqprep in seqprep-1.3.2 dpkg-source: info: unpacking seqprep_1.3.2.orig.tar.gz dpkg-source: info: unpacking seqprep_1.3.2-9.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying fix_unused_variable_errors.patch dpkg-source: info: applying hardening.patch dpkg-source: info: applying replace-float-with-double.patch dpkg-source: info: applying 2to3.patch dpkg-source: info: applying fix-declarations.patch I: Not using root during the build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/10656/tmp/hooks/D02_print_environment starting I: set BUILDDIR='/build/reproducible-path' BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' BUILDUSERNAME='pbuilder1' BUILD_ARCH='i386' DEBIAN_FRONTEND='noninteractive' DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=22 ' DISTRIBUTION='trixie' HOME='/root' HOST_ARCH='i386' IFS=' ' INVOCATION_ID='aab081d68ff84854bc079030bdb2abde' LANG='C' LANGUAGE='en_US:en' LC_ALL='C' LD_LIBRARY_PATH='/usr/lib/libeatmydata' LD_PRELOAD='libeatmydata.so' MAIL='/var/mail/root' OPTIND='1' PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' PBCURRENTCOMMANDLINEOPERATION='build' PBUILDER_OPERATION='build' PBUILDER_PKGDATADIR='/usr/share/pbuilder' PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' PBUILDER_SYSCONFDIR='/etc' PPID='10656' PS1='# ' PS2='> ' PS4='+ ' PWD='/' SHELL='/bin/bash' SHLVL='2' SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.AZSTTn1P/pbuilderrc_yKPB --distribution trixie --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.AZSTTn1P/b1 --logfile b1/build.log seqprep_1.3.2-9.dsc' SUDO_GID='112' SUDO_UID='107' SUDO_USER='jenkins' TERM='unknown' TZ='/usr/share/zoneinfo/Etc/GMT+12' USER='root' _='/usr/bin/systemd-run' http_proxy='http://213.165.73.152:3128' I: uname -a Linux ionos6-i386 6.1.0-27-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.1.115-1 (2024-11-01) x86_64 GNU/Linux I: ls -l /bin lrwxrwxrwx 1 root root 7 Aug 4 2024 /bin -> usr/bin I: user script /srv/workspace/pbuilder/10656/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: i386 Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 13), python3, zlib1g-dev dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19956 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 13); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on python3; however: Package python3 is not installed. pbuilder-satisfydepends-dummy depends on zlib1g-dev; however: Package zlib1g-dev is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} automake{a} autopoint{a} autotools-dev{a} bsdextrautils{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} gettext{a} gettext-base{a} groff-base{a} intltool-debian{a} libarchive-zip-perl{a} libcom-err2{a} libdebhelper-perl{a} libelf1t64{a} libexpat1{a} libfile-stripnondeterminism-perl{a} libgssapi-krb5-2{a} libicu72{a} libk5crypto3{a} libkeyutils1{a} libkrb5-3{a} libkrb5support0{a} libmagic-mgc{a} libmagic1t64{a} libnsl2{a} libpipeline1{a} libpython3-stdlib{a} libpython3.12-minimal{a} libpython3.12-stdlib{a} libreadline8t64{a} libtirpc-common{a} libtirpc3t64{a} libtool{a} libuchardet0{a} libxml2{a} m4{a} man-db{a} media-types{a} netbase{a} po-debconf{a} python3{a} python3-minimal{a} python3.12{a} python3.12-minimal{a} readline-common{a} sensible-utils{a} tzdata{a} zlib1g-dev{a} The following packages are RECOMMENDED but will NOT be installed: ca-certificates curl krb5-locales libarchive-cpio-perl libltdl-dev libmail-sendmail-perl lynx wget 0 packages upgraded, 52 newly installed, 0 to remove and 0 not upgraded. Need to get 28.2 MB of archives. After unpacking 105 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian trixie/main i386 libpython3.12-minimal i386 3.12.7-3 [814 kB] Get: 2 http://deb.debian.org/debian trixie/main i386 libexpat1 i386 2.6.3-2 [107 kB] Get: 3 http://deb.debian.org/debian trixie/main i386 python3.12-minimal i386 3.12.7-3 [2236 kB] Get: 4 http://deb.debian.org/debian trixie/main i386 python3-minimal i386 3.12.6-1 [26.7 kB] Get: 5 http://deb.debian.org/debian trixie/main i386 media-types all 10.1.0 [26.9 kB] Get: 6 http://deb.debian.org/debian trixie/main i386 netbase all 6.4 [12.8 kB] Get: 7 http://deb.debian.org/debian trixie/main i386 tzdata all 2024b-3 [255 kB] Get: 8 http://deb.debian.org/debian trixie/main i386 libkrb5support0 i386 1.21.3-3 [34.9 kB] Get: 9 http://deb.debian.org/debian trixie/main i386 libcom-err2 i386 1.47.1-1+b1 [23.4 kB] Get: 10 http://deb.debian.org/debian trixie/main i386 libk5crypto3 i386 1.21.3-3 [83.6 kB] Get: 11 http://deb.debian.org/debian trixie/main i386 libkeyutils1 i386 1.6.3-4 [9600 B] Get: 12 http://deb.debian.org/debian trixie/main i386 libkrb5-3 i386 1.21.3-3 [350 kB] Get: 13 http://deb.debian.org/debian trixie/main i386 libgssapi-krb5-2 i386 1.21.3-3 [146 kB] Get: 14 http://deb.debian.org/debian trixie/main i386 libtirpc-common all 1.3.4+ds-1.3 [10.9 kB] Get: 15 http://deb.debian.org/debian trixie/main i386 libtirpc3t64 i386 1.3.4+ds-1.3+b1 [90.5 kB] Get: 16 http://deb.debian.org/debian trixie/main i386 libnsl2 i386 1.3.0-3+b3 [42.7 kB] Get: 17 http://deb.debian.org/debian trixie/main i386 readline-common all 8.2-5 [69.3 kB] Get: 18 http://deb.debian.org/debian trixie/main i386 libreadline8t64 i386 8.2-5 [173 kB] Get: 19 http://deb.debian.org/debian trixie/main i386 libpython3.12-stdlib i386 3.12.7-3 [1964 kB] Get: 20 http://deb.debian.org/debian trixie/main i386 python3.12 i386 3.12.7-3 [671 kB] Get: 21 http://deb.debian.org/debian trixie/main i386 libpython3-stdlib i386 3.12.6-1 [9692 B] Get: 22 http://deb.debian.org/debian trixie/main i386 python3 i386 3.12.6-1 [27.8 kB] Get: 23 http://deb.debian.org/debian trixie/main i386 sensible-utils all 0.0.24 [24.8 kB] Get: 24 http://deb.debian.org/debian trixie/main i386 libmagic-mgc i386 1:5.45-3+b1 [314 kB] Get: 25 http://deb.debian.org/debian trixie/main i386 libmagic1t64 i386 1:5.45-3+b1 [115 kB] Get: 26 http://deb.debian.org/debian trixie/main i386 file i386 1:5.45-3+b1 [43.2 kB] Get: 27 http://deb.debian.org/debian trixie/main i386 gettext-base i386 0.22.5-2 [201 kB] Get: 28 http://deb.debian.org/debian trixie/main i386 libuchardet0 i386 0.0.8-1+b2 [69.2 kB] Get: 29 http://deb.debian.org/debian trixie/main i386 groff-base i386 1.23.0-5 [1196 kB] Get: 30 http://deb.debian.org/debian trixie/main i386 bsdextrautils i386 2.40.2-9 [102 kB] Get: 31 http://deb.debian.org/debian trixie/main i386 libpipeline1 i386 1.5.8-1 [41.2 kB] Get: 32 http://deb.debian.org/debian trixie/main i386 man-db i386 2.13.0-1 [1428 kB] Get: 33 http://deb.debian.org/debian trixie/main i386 m4 i386 1.4.19-4 [293 kB] Get: 34 http://deb.debian.org/debian trixie/main i386 autoconf all 2.72-3 [493 kB] Get: 35 http://deb.debian.org/debian trixie/main i386 autotools-dev all 20220109.1 [51.6 kB] Get: 36 http://deb.debian.org/debian trixie/main i386 automake all 1:1.16.5-1.3 [823 kB] Get: 37 http://deb.debian.org/debian trixie/main i386 autopoint all 0.22.5-2 [723 kB] Get: 38 http://deb.debian.org/debian trixie/main i386 libdebhelper-perl all 13.20 [89.7 kB] Get: 39 http://deb.debian.org/debian trixie/main i386 libtool all 2.4.7-8 [517 kB] Get: 40 http://deb.debian.org/debian trixie/main i386 dh-autoreconf all 20 [17.1 kB] Get: 41 http://deb.debian.org/debian trixie/main i386 libarchive-zip-perl all 1.68-1 [104 kB] Get: 42 http://deb.debian.org/debian trixie/main i386 libfile-stripnondeterminism-perl all 1.14.0-1 [19.5 kB] Get: 43 http://deb.debian.org/debian trixie/main i386 dh-strip-nondeterminism all 1.14.0-1 [8448 B] Get: 44 http://deb.debian.org/debian trixie/main i386 libelf1t64 i386 0.192-4 [195 kB] Get: 45 http://deb.debian.org/debian trixie/main i386 dwz i386 0.15-1+b1 [116 kB] Get: 46 http://deb.debian.org/debian trixie/main i386 libicu72 i386 72.1-5+b1 [9583 kB] Get: 47 http://deb.debian.org/debian trixie/main i386 libxml2 i386 2.12.7+dfsg+really2.9.14-0.1 [733 kB] Get: 48 http://deb.debian.org/debian trixie/main i386 gettext i386 0.22.5-2 [1631 kB] Get: 49 http://deb.debian.org/debian trixie/main i386 intltool-debian all 0.35.0+20060710.6 [22.9 kB] Get: 50 http://deb.debian.org/debian trixie/main i386 po-debconf all 1.0.21+nmu1 [248 kB] Get: 51 http://deb.debian.org/debian trixie/main i386 debhelper all 13.20 [915 kB] Get: 52 http://deb.debian.org/debian trixie/main i386 zlib1g-dev i386 1:1.3.dfsg+really1.3.1-1+b1 [916 kB] Fetched 28.2 MB in 0s (92.5 MB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package libpython3.12-minimal:i386. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19956 files and directories currently installed.) Preparing to unpack .../libpython3.12-minimal_3.12.7-3_i386.deb ... Unpacking libpython3.12-minimal:i386 (3.12.7-3) ... Selecting previously unselected package libexpat1:i386. Preparing to unpack .../libexpat1_2.6.3-2_i386.deb ... Unpacking libexpat1:i386 (2.6.3-2) ... Selecting previously unselected package python3.12-minimal. Preparing to unpack .../python3.12-minimal_3.12.7-3_i386.deb ... Unpacking python3.12-minimal (3.12.7-3) ... Setting up libpython3.12-minimal:i386 (3.12.7-3) ... Setting up libexpat1:i386 (2.6.3-2) ... Setting up python3.12-minimal (3.12.7-3) ... Selecting previously unselected package python3-minimal. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20276 files and directories currently installed.) Preparing to unpack .../00-python3-minimal_3.12.6-1_i386.deb ... Unpacking python3-minimal (3.12.6-1) ... Selecting previously unselected package media-types. Preparing to unpack .../01-media-types_10.1.0_all.deb ... Unpacking media-types (10.1.0) ... Selecting previously unselected package netbase. Preparing to unpack .../02-netbase_6.4_all.deb ... Unpacking netbase (6.4) ... Selecting previously unselected package tzdata. Preparing to unpack .../03-tzdata_2024b-3_all.deb ... Unpacking tzdata (2024b-3) ... Selecting previously unselected package libkrb5support0:i386. Preparing to unpack .../04-libkrb5support0_1.21.3-3_i386.deb ... Unpacking libkrb5support0:i386 (1.21.3-3) ... Selecting previously unselected package libcom-err2:i386. Preparing to unpack .../05-libcom-err2_1.47.1-1+b1_i386.deb ... Unpacking libcom-err2:i386 (1.47.1-1+b1) ... Selecting previously unselected package libk5crypto3:i386. Preparing to unpack .../06-libk5crypto3_1.21.3-3_i386.deb ... Unpacking libk5crypto3:i386 (1.21.3-3) ... Selecting previously unselected package libkeyutils1:i386. Preparing to unpack .../07-libkeyutils1_1.6.3-4_i386.deb ... Unpacking libkeyutils1:i386 (1.6.3-4) ... Selecting previously unselected package libkrb5-3:i386. Preparing to unpack .../08-libkrb5-3_1.21.3-3_i386.deb ... Unpacking libkrb5-3:i386 (1.21.3-3) ... Selecting previously unselected package libgssapi-krb5-2:i386. Preparing to unpack .../09-libgssapi-krb5-2_1.21.3-3_i386.deb ... Unpacking libgssapi-krb5-2:i386 (1.21.3-3) ... Selecting previously unselected package libtirpc-common. Preparing to unpack .../10-libtirpc-common_1.3.4+ds-1.3_all.deb ... Unpacking libtirpc-common (1.3.4+ds-1.3) ... Selecting previously unselected package libtirpc3t64:i386. Preparing to unpack .../11-libtirpc3t64_1.3.4+ds-1.3+b1_i386.deb ... Adding 'diversion of /lib/i386-linux-gnu/libtirpc.so.3 to /lib/i386-linux-gnu/libtirpc.so.3.usr-is-merged by libtirpc3t64' Adding 'diversion of /lib/i386-linux-gnu/libtirpc.so.3.0.0 to /lib/i386-linux-gnu/libtirpc.so.3.0.0.usr-is-merged by libtirpc3t64' Unpacking libtirpc3t64:i386 (1.3.4+ds-1.3+b1) ... Selecting previously unselected package libnsl2:i386. Preparing to unpack .../12-libnsl2_1.3.0-3+b3_i386.deb ... Unpacking libnsl2:i386 (1.3.0-3+b3) ... Selecting previously unselected package readline-common. Preparing to unpack .../13-readline-common_8.2-5_all.deb ... Unpacking readline-common (8.2-5) ... Selecting previously unselected package libreadline8t64:i386. Preparing to unpack .../14-libreadline8t64_8.2-5_i386.deb ... Adding 'diversion of /lib/i386-linux-gnu/libhistory.so.8 to /lib/i386-linux-gnu/libhistory.so.8.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/i386-linux-gnu/libhistory.so.8.2 to /lib/i386-linux-gnu/libhistory.so.8.2.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/i386-linux-gnu/libreadline.so.8 to /lib/i386-linux-gnu/libreadline.so.8.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/i386-linux-gnu/libreadline.so.8.2 to /lib/i386-linux-gnu/libreadline.so.8.2.usr-is-merged by libreadline8t64' Unpacking libreadline8t64:i386 (8.2-5) ... Selecting previously unselected package libpython3.12-stdlib:i386. Preparing to unpack .../15-libpython3.12-stdlib_3.12.7-3_i386.deb ... Unpacking libpython3.12-stdlib:i386 (3.12.7-3) ... Selecting previously unselected package python3.12. Preparing to unpack .../16-python3.12_3.12.7-3_i386.deb ... Unpacking python3.12 (3.12.7-3) ... Selecting previously unselected package libpython3-stdlib:i386. Preparing to unpack .../17-libpython3-stdlib_3.12.6-1_i386.deb ... Unpacking libpython3-stdlib:i386 (3.12.6-1) ... Setting up python3-minimal (3.12.6-1) ... Selecting previously unselected package python3. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 21338 files and directories currently installed.) Preparing to unpack .../00-python3_3.12.6-1_i386.deb ... Unpacking python3 (3.12.6-1) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../01-sensible-utils_0.0.24_all.deb ... Unpacking sensible-utils (0.0.24) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../02-libmagic-mgc_1%3a5.45-3+b1_i386.deb ... Unpacking libmagic-mgc (1:5.45-3+b1) ... Selecting previously unselected package libmagic1t64:i386. Preparing to unpack .../03-libmagic1t64_1%3a5.45-3+b1_i386.deb ... Unpacking libmagic1t64:i386 (1:5.45-3+b1) ... Selecting previously unselected package file. Preparing to unpack .../04-file_1%3a5.45-3+b1_i386.deb ... Unpacking file (1:5.45-3+b1) ... Selecting previously unselected package gettext-base. Preparing to unpack .../05-gettext-base_0.22.5-2_i386.deb ... Unpacking gettext-base (0.22.5-2) ... Selecting previously unselected package libuchardet0:i386. Preparing to unpack .../06-libuchardet0_0.0.8-1+b2_i386.deb ... Unpacking libuchardet0:i386 (0.0.8-1+b2) ... Selecting previously unselected package groff-base. Preparing to unpack .../07-groff-base_1.23.0-5_i386.deb ... Unpacking groff-base (1.23.0-5) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../08-bsdextrautils_2.40.2-9_i386.deb ... Unpacking bsdextrautils (2.40.2-9) ... Selecting previously unselected package libpipeline1:i386. Preparing to unpack .../09-libpipeline1_1.5.8-1_i386.deb ... Unpacking libpipeline1:i386 (1.5.8-1) ... Selecting previously unselected package man-db. Preparing to unpack .../10-man-db_2.13.0-1_i386.deb ... Unpacking man-db (2.13.0-1) ... Selecting previously unselected package m4. Preparing to unpack .../11-m4_1.4.19-4_i386.deb ... Unpacking m4 (1.4.19-4) ... Selecting previously unselected package autoconf. Preparing to unpack .../12-autoconf_2.72-3_all.deb ... Unpacking autoconf (2.72-3) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../13-autotools-dev_20220109.1_all.deb ... Unpacking autotools-dev (20220109.1) ... Selecting previously unselected package automake. Preparing to unpack .../14-automake_1%3a1.16.5-1.3_all.deb ... Unpacking automake (1:1.16.5-1.3) ... Selecting previously unselected package autopoint. Preparing to unpack .../15-autopoint_0.22.5-2_all.deb ... Unpacking autopoint (0.22.5-2) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../16-libdebhelper-perl_13.20_all.deb ... Unpacking libdebhelper-perl (13.20) ... Selecting previously unselected package libtool. Preparing to unpack .../17-libtool_2.4.7-8_all.deb ... Unpacking libtool (2.4.7-8) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../18-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../19-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../20-libfile-stripnondeterminism-perl_1.14.0-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.14.0-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../21-dh-strip-nondeterminism_1.14.0-1_all.deb ... Unpacking dh-strip-nondeterminism (1.14.0-1) ... Selecting previously unselected package libelf1t64:i386. Preparing to unpack .../22-libelf1t64_0.192-4_i386.deb ... Unpacking libelf1t64:i386 (0.192-4) ... Selecting previously unselected package dwz. Preparing to unpack .../23-dwz_0.15-1+b1_i386.deb ... Unpacking dwz (0.15-1+b1) ... Selecting previously unselected package libicu72:i386. Preparing to unpack .../24-libicu72_72.1-5+b1_i386.deb ... Unpacking libicu72:i386 (72.1-5+b1) ... Selecting previously unselected package libxml2:i386. Preparing to unpack .../25-libxml2_2.12.7+dfsg+really2.9.14-0.1_i386.deb ... Unpacking libxml2:i386 (2.12.7+dfsg+really2.9.14-0.1) ... Selecting previously unselected package gettext. Preparing to unpack .../26-gettext_0.22.5-2_i386.deb ... Unpacking gettext (0.22.5-2) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../27-intltool-debian_0.35.0+20060710.6_all.deb ... Unpacking intltool-debian (0.35.0+20060710.6) ... Selecting previously unselected package po-debconf. Preparing to unpack .../28-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../29-debhelper_13.20_all.deb ... Unpacking debhelper (13.20) ... Selecting previously unselected package zlib1g-dev:i386. Preparing to unpack .../30-zlib1g-dev_1%3a1.3.dfsg+really1.3.1-1+b1_i386.deb ... Unpacking zlib1g-dev:i386 (1:1.3.dfsg+really1.3.1-1+b1) ... Setting up media-types (10.1.0) ... Setting up libpipeline1:i386 (1.5.8-1) ... Setting up libkeyutils1:i386 (1.6.3-4) ... Setting up libicu72:i386 (72.1-5+b1) ... Setting up bsdextrautils (2.40.2-9) ... Setting up libmagic-mgc (1:5.45-3+b1) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libtirpc-common (1.3.4+ds-1.3) ... Setting up libdebhelper-perl (13.20) ... Setting up libmagic1t64:i386 (1:5.45-3+b1) ... Setting up gettext-base (0.22.5-2) ... Setting up m4 (1.4.19-4) ... Setting up libcom-err2:i386 (1.47.1-1+b1) ... Setting up file (1:5.45-3+b1) ... Setting up libelf1t64:i386 (0.192-4) ... Setting up libkrb5support0:i386 (1.21.3-3) ... Setting up tzdata (2024b-3) ... Current default time zone: 'Etc/UTC' Local time is now: Tue Dec 16 09:08:37 UTC 2025. Universal Time is now: Tue Dec 16 09:08:37 UTC 2025. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up autotools-dev (20220109.1) ... Setting up autopoint (0.22.5-2) ... Setting up libk5crypto3:i386 (1.21.3-3) ... Setting up autoconf (2.72-3) ... Setting up zlib1g-dev:i386 (1:1.3.dfsg+really1.3.1-1+b1) ... Setting up dwz (0.15-1+b1) ... Setting up sensible-utils (0.0.24) ... Setting up libuchardet0:i386 (0.0.8-1+b2) ... Setting up netbase (6.4) ... Setting up libkrb5-3:i386 (1.21.3-3) ... Setting up readline-common (8.2-5) ... Setting up libxml2:i386 (2.12.7+dfsg+really2.9.14-0.1) ... Setting up automake (1:1.16.5-1.3) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up libfile-stripnondeterminism-perl (1.14.0-1) ... Setting up gettext (0.22.5-2) ... Setting up libtool (2.4.7-8) ... Setting up intltool-debian (0.35.0+20060710.6) ... Setting up dh-autoreconf (20) ... Setting up libgssapi-krb5-2:i386 (1.21.3-3) ... Setting up libreadline8t64:i386 (8.2-5) ... Setting up dh-strip-nondeterminism (1.14.0-1) ... Setting up groff-base (1.23.0-5) ... Setting up libtirpc3t64:i386 (1.3.4+ds-1.3+b1) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up man-db (2.13.0-1) ... Not building database; man-db/auto-update is not 'true'. Setting up libnsl2:i386 (1.3.0-3+b3) ... Setting up libpython3.12-stdlib:i386 (3.12.7-3) ... Setting up python3.12 (3.12.7-3) ... Setting up debhelper (13.20) ... Setting up libpython3-stdlib:i386 (3.12.6-1) ... Setting up python3 (3.12.6-1) ... Processing triggers for libc-bin (2.40-3) ... Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps I: Building the package I: Running cd /build/reproducible-path/seqprep-1.3.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../seqprep_1.3.2-9_source.changes dpkg-buildpackage: info: source package seqprep dpkg-buildpackage: info: source version 1.3.2-9 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Étienne Mollier dpkg-source --before-build . dpkg-buildpackage: info: host architecture i386 debian/rules clean dh clean dh_auto_clean make -j22 clean make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' rm -f SeqPrep.o utils.o stdaln.o SeqPrep make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' debian/rules override_dh_clean make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' dh_clean rm -f seqprep rm -f README.html make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' debian/rules binary dh binary dh_update_autotools_config dh_autoreconf dh_auto_configure debian/rules override_dh_auto_build make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' dh_auto_build make -j22 "INSTALL=install --strip-program=true" make[2]: Entering directory '/build/reproducible-path/seqprep-1.3.2' cc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/seqprep-1.3.2=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 SeqPrep.c -o SeqPrep.o cc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/seqprep-1.3.2=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 utils.c -o utils.o cc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/seqprep-1.3.2=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 stdaln.c -o stdaln.o cc SeqPrep.o utils.o stdaln.o -Wl,-z,relro -Wl,-z,now -lz -lm -o SeqPrep make[2]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' cp SeqPrep seqprep mv /build/reproducible-path/seqprep-1.3.2/debian/README.html /build/reproducible-path/seqprep-1.3.2 make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' debian/rules override_dh_auto_test make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' # This checks that the tests run and produce byte-identical results. cd Test && mkdir -p out info && \ bash -xc 'gzcat(){ zcat "$@" ; } ; . RUNTEST.sh' + . RUNTEST.sh ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_merged_1.fastq.gz -2 ./out/pe_bad_contam_merged_2.fastq.gz -s ./out/pe_bad_contam_merged_s.fastq.gz -E ./info/alignments_merged.txt.gz Pairs Processed: 0 Pairs Merged: 14314 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.223850 ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_trimmed_1.fastq.gz -2 ./out/pe_bad_contam_trimmed_2.fastq.gz -E ./info/alignments_trimmed.txt.gz Pairs Processed: 0 Pairs Merged: 0 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.201776 ++ prog=gzcat ++ gzcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ zcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ zcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_1.fastq.gz ++ zcat ./out/pe_bad_contam_merged_1.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_2.fastq.gz ++ zcat ./out/pe_bad_contam_merged_2.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_s.fastq.gz ++ zcat ./out/pe_bad_contam_merged_s.fastq.gz ++ python3 seqlens.py [ `cat Test/info/pe_*.txt | md5sum | cut -b -10` = 8bc8e0787e ] # remove output dirs right after testing to make sure the files # will not be included in the data package rm -rf Test/info Test/out make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' create-stamp debian/debhelper-build-stamp dh_prep dh_auto_install make -j22 install DESTDIR=/build/reproducible-path/seqprep-1.3.2/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' cp SeqPrep /build/reproducible-path/seqprep-1.3.2/debian/.debhelper/generated/_source/home/bin make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' debian/rules override_dh_install-indep make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' dh_install sed -i 's#../SeqPrep#/usr/bin/seqprep#' /build/reproducible-path/seqprep-1.3.2/debian/seqprep-data/usr/share/doc/seqprep/examples/RUNTEST.sh make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' dh_install -Nseqprep-data dh_installdocs dh_installchangelogs dh_installman dh_perl dh_link dh_strip_nondeterminism dh_compress dh_fixperms dh_missing dh_dwz -a dh_strip -a dh_makeshlibs -a dh_shlibdeps -a dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'seqprep' in '../seqprep_1.3.2-9_i386.deb'. dpkg-deb: building package 'seqprep-dbgsym' in '../seqprep-dbgsym_1.3.2-9_i386.deb'. dpkg-deb: building package 'seqprep-data' in '../seqprep-data_1.3.2-9_all.deb'. dpkg-genbuildinfo --build=binary -O../seqprep_1.3.2-9_i386.buildinfo dpkg-genchanges --build=binary -O../seqprep_1.3.2-9_i386.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/10656 and its subdirectories I: Current time: Mon Dec 15 21:09:31 -12 2025 I: pbuilder-time-stamp: 1765876171 Wed Nov 13 02:46:33 UTC 2024 I: 1st build successful. Starting 2nd build on remote node ionos12-i386.debian.net. Wed Nov 13 02:46:33 UTC 2024 I: Preparing to do remote build '2' on ionos12-i386.debian.net. Wed Nov 13 02:48:24 UTC 2024 I: Deleting $TMPDIR on ionos12-i386.debian.net. Wed Nov 13 02:48:25 UTC 2024 I: seqprep_1.3.2-9_i386.changes: Format: 1.8 Date: Thu, 14 Mar 2024 20:32:47 +0100 Source: seqprep Binary: seqprep seqprep-data seqprep-dbgsym Architecture: all i386 Version: 1.3.2-9 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team Changed-By: Étienne Mollier Description: seqprep - stripping adaptors and/or merging paired reads of DNA sequences w seqprep-data - example data set for seqprep - only used for testing Closes: 1066363 Changes: seqprep (1.3.2-9) unstable; urgency=medium . * Team upload. * fix-declarations.patch: new: fix ftbfs. (Closes: #1066363) * Add ITP bug in seqprep version 1.1-0biolinux1. * Update standards version to 4.6.2, no changes needed. Checksums-Sha1: 1f319e8808fc74a8cfed97c4b97e56e613adfe1c 35859764 seqprep-data_1.3.2-9_all.deb 630a46406220e5b767f7d9797d76e53b64f1af50 18968 seqprep-dbgsym_1.3.2-9_i386.deb 79fba9d0b881505d10c84a0e3f4c46b9cb38e674 5889 seqprep_1.3.2-9_i386.buildinfo b4cdfbc775e3bb77fddf16e99ac0f1e0e2a7ef63 27988 seqprep_1.3.2-9_i386.deb Checksums-Sha256: c5a6aa05a249fce176d25a4440f2776a80000898228690af4411a04b42811a0f 35859764 seqprep-data_1.3.2-9_all.deb bd0c633d25934f0df5226dd39791721ad51a259bd946ead4dc52c4ca3d1a12c0 18968 seqprep-dbgsym_1.3.2-9_i386.deb 7db4d77a36d703ff155d4bc9f2b0d1c222b27ae94773b869ef3fccf9c49592bb 5889 seqprep_1.3.2-9_i386.buildinfo 7ab9c5f968eb4c0fbd9f2e5c1dbdbed952b226a3fd5c84d0d9eec1ca9fbfcc8b 27988 seqprep_1.3.2-9_i386.deb Files: 16758c6a3e66a4da223e5e7120b8b308 35859764 science optional seqprep-data_1.3.2-9_all.deb 78405f2c49dfed4488554013c37f2a94 18968 debug optional seqprep-dbgsym_1.3.2-9_i386.deb 88898218016bdffbdd85f49230f7bf42 5889 science optional seqprep_1.3.2-9_i386.buildinfo 2c701c9dc2ddb0060e593cbcea43b9f2 27988 science optional seqprep_1.3.2-9_i386.deb Wed Nov 13 02:48:26 UTC 2024 I: diffoscope 283 will be used to compare the two builds: Running as unit: rb-diffoscope-i386_6-43406.service # Profiling output for: /usr/bin/diffoscope --timeout 7200 --html /srv/reproducible-results/rbuild-debian/r-b-build.AZSTTn1P/seqprep_1.3.2-9.diffoscope.html --text /srv/reproducible-results/rbuild-debian/r-b-build.AZSTTn1P/seqprep_1.3.2-9.diffoscope.txt --json /srv/reproducible-results/rbuild-debian/r-b-build.AZSTTn1P/seqprep_1.3.2-9.diffoscope.json --profile=- /srv/reproducible-results/rbuild-debian/r-b-build.AZSTTn1P/b1/seqprep_1.3.2-9_i386.changes /srv/reproducible-results/rbuild-debian/r-b-build.AZSTTn1P/b2/seqprep_1.3.2-9_i386.changes ## command (total time: 0.000s) 0.000s 1 call cmp (internal) ## has_same_content_as (total time: 0.000s) 0.000s 1 call abc.DotChangesFile ## main (total time: 0.823s) 0.823s 2 calls outputs 0.000s 1 call cleanup ## recognizes (total time: 0.392s) 0.392s 12 calls diffoscope.comparators.binary.FilesystemFile ## specialize (total time: 0.000s) 0.000s 1 call specialize Finished with result: success Main processes terminated with: code=exited/status=0 Service runtime: 1.201s CPU time consumed: 1.197s Wed Nov 13 02:48:28 UTC 2024 I: diffoscope 283 found no differences in the changes files, and a .buildinfo file also exists. Wed Nov 13 02:48:28 UTC 2024 I: seqprep from trixie built successfully and reproducibly on i386. Wed Nov 13 02:48:29 UTC 2024 I: Submitting .buildinfo files to external archives: Wed Nov 13 02:48:29 UTC 2024 I: Submitting 8.0K b1/seqprep_1.3.2-9_i386.buildinfo.asc Wed Nov 13 02:48:31 UTC 2024 I: Submitting 8.0K b2/seqprep_1.3.2-9_i386.buildinfo.asc Wed Nov 13 02:48:33 UTC 2024 I: Done submitting .buildinfo files to http://buildinfo.debian.net/api/submit. Wed Nov 13 02:48:33 UTC 2024 I: Done submitting .buildinfo files. Wed Nov 13 02:48:33 UTC 2024 I: Removing signed seqprep_1.3.2-9_i386.buildinfo.asc files: removed './b1/seqprep_1.3.2-9_i386.buildinfo.asc' removed './b2/seqprep_1.3.2-9_i386.buildinfo.asc'