Mon Apr 5 16:37:39 UTC 2021 I: starting to build seqprep/buster/amd64 on jenkins on '2021-04-05 16:37' Mon Apr 5 16:37:39 UTC 2021 I: The jenkins build log is/was available at https://jenkins.debian.net/userContent/reproducible/debian/build_service/amd64_9/9923/console.log Mon Apr 5 16:37:39 UTC 2021 I: Downloading source for buster/seqprep=1.3.2-3 --2021-04-05 16:37:40-- http://deb.debian.org/debian/pool/main/s/seqprep/seqprep_1.3.2-3.dsc Connecting to 78.137.99.97:3128... connected. Proxy request sent, awaiting response... 200 OK Length: 2111 (2.1K) Saving to: ‘seqprep_1.3.2-3.dsc’ 0K .. 100% 39.6M=0s 2021-04-05 16:37:40 (39.6 MB/s) - ‘seqprep_1.3.2-3.dsc’ saved [2111/2111] Mon Apr 5 16:37:40 UTC 2021 I: seqprep_1.3.2-3.dsc -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA256 Format: 3.0 (quilt) Source: seqprep Binary: seqprep, seqprep-data Architecture: any all Version: 1.3.2-3 Maintainer: Debian Med Packaging Team Uploaders: Tim Booth , Andreas Tille Homepage: http://seqanswers.com/wiki/SeqPrep Standards-Version: 4.1.4 Vcs-Browser: https://salsa.debian.org/med-team/seqprep Vcs-Git: https://salsa.debian.org/med-team/seqprep.git Testsuite: autopkgtest Testsuite-Triggers: python Build-Depends: debhelper (>= 11~), python, python-markdown, ronn, zlib1g-dev Package-List: seqprep deb science optional arch=any seqprep-data deb science optional arch=all Checksums-Sha1: 9f533e1fd14d310ba0ccd4ef38c3abc55b8fc5fd 37177540 seqprep_1.3.2.orig.tar.gz 7530b9e7aa8f3313ecde46076a52452c1bbeab9a 9364 seqprep_1.3.2-3.debian.tar.xz Checksums-Sha256: 2b8a462a0e0a3e51f70be7730dc77b1f2bb69e74845dd0fbd2110a921c32265a 37177540 seqprep_1.3.2.orig.tar.gz 2c62173f1827cf3feade00779b2fefabdb8e1b10a8329933b319b520c670bb2b 9364 seqprep_1.3.2-3.debian.tar.xz Files: b6a4f5491dfdb0ce38bf791454151468 37177540 seqprep_1.3.2.orig.tar.gz 66e6faba1b9905484e321107c3c2c232 9364 seqprep_1.3.2-3.debian.tar.xz -----BEGIN PGP SIGNATURE----- iQJFBAEBCAAvFiEE8fAHMgoDVUHwpmPKV4oElNHGRtEFAltDD/QRHHRpbGxlQGRl Ymlhbi5vcmcACgkQV4oElNHGRtGT4A//VbZjts/gSR317m967ops7qltxZ03QiAy kI4zZyaNgnqqImZCtHKXJ2wSwyyi3CCfkwsNUjtaOvtQKGi7ShWELZeV9Rs5ADeV IjJu9aZopSxs09e6HeE5ZFbHoHXPFDnzE5aIHTRAAuD/ZbpNbla26eDRCjnZmBTI bwwffnEtu2/9XIbKQre9QT43COkJQB2ht5SNGB8GwCFBHH1hH2AJ9Z1paMcSDKcf JxrojqzzJ+9SM4HEF7LZ0kZo1DQStKHEFhpitHm1AtqHTtPgEDAIvNjqYN89uEoF F0+s0z6GJuDYdSArodxVpFOOl4xsy7Zcnu3qvs8jjtFgxEV9FR3lU9wh2c55Y3W+ l0ETL84KSVkQmReyhlOJORtqDQfJI/7Ohw50U4Bp3kk4zR/soGS+vmKB6mvq+DeP LtghN8oZ1M7Tj7wocyah3aKzKW/2LAPuHePWuqzuoP2E1VXAbJH1gmKstdXO1+C8 44PikAt9XUoqA6LJe4AY2ft/l+LCIXjfHxopQbD4hpSDTik33nnbvzLiHOYEMTis oZhRnx5ZqMt0vO5RQyGDPkIq3Y1hR//SpTcak3UpSSlrvVWqniIjXAULt2mD3U2N 8rBLE81ka2K5F/YgMByInTK7OQDEZ10l8zi1w4oPUyn0tl9U2dEiAy2UUnOdi1cW 5p6xCxBaRQM= =IpCl -----END PGP SIGNATURE----- Mon Apr 5 16:37:40 UTC 2021 I: Checking whether the package is not for us Mon Apr 5 16:37:40 UTC 2021 I: Starting 1st build on remote node ionos1-amd64.debian.net. Mon Apr 5 16:37:40 UTC 2021 I: Preparing to do remote build '1' on ionos1-amd64.debian.net. Mon Apr 5 16:39:36 UTC 2021 I: Deleting $TMPDIR on ionos1-amd64.debian.net. I: pbuilder: network access will be disabled during build I: Current time: Mon Apr 5 04:37:42 -12 2021 I: pbuilder-time-stamp: 1617640662 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/buster-reproducible-base.tgz] I: copying local configuration I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: Copying source file I: copying [seqprep_1.3.2-3.dsc] I: copying [./seqprep_1.3.2.orig.tar.gz] I: copying [./seqprep_1.3.2-3.debian.tar.xz] I: Extracting source gpgv: unknown type of key resource 'trustedkeys.kbx' gpgv: keyblock resource '/root/.gnupg/trustedkeys.kbx': General error gpgv: Signature made Sun Jul 8 19:34:12 2018 -12 gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 gpgv: issuer "tille@debian.org" gpgv: Can't check signature: No public key dpkg-source: warning: failed to verify signature on ./seqprep_1.3.2-3.dsc dpkg-source: info: extracting seqprep in seqprep-1.3.2 dpkg-source: info: unpacking seqprep_1.3.2.orig.tar.gz dpkg-source: info: unpacking seqprep_1.3.2-3.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying fix_unused_variable_errors.patch dpkg-source: info: applying hardening.patch dpkg-source: info: applying replace-float-with-double.patch I: using fakeroot in build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/4366/tmp/hooks/D02_print_environment starting I: set BUILDDIR='/build' BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' BUILDUSERNAME='pbuilder1' BUILD_ARCH='amd64' DEBIAN_FRONTEND='noninteractive' DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=15' DISTRIBUTION='' HOME='/root' HOST_ARCH='amd64' IFS=' ' INVOCATION_ID='2d573e3538f5459b8a589a972c9f4b6c' LANG='C' LANGUAGE='en_US:en' LC_ALL='C' MAIL='/var/mail/root' OPTIND='1' PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' PBCURRENTCOMMANDLINEOPERATION='build' PBUILDER_OPERATION='build' PBUILDER_PKGDATADIR='/usr/share/pbuilder' PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' PBUILDER_SYSCONFDIR='/etc' PPID='4366' PS1='# ' PS2='> ' PS4='+ ' PWD='/' SHELL='/bin/bash' SHLVL='2' SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/tmp.A7vSM8hgEt/pbuilderrc_F9Ae --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/buster-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/tmp.A7vSM8hgEt/b1 --logfile b1/build.log seqprep_1.3.2-3.dsc' SUDO_GID='110' SUDO_UID='105' SUDO_USER='jenkins' TERM='unknown' TZ='/usr/share/zoneinfo/Etc/GMT+12' USER='root' _='/usr/bin/systemd-run' http_proxy='http://78.137.99.97:3128' I: uname -a Linux ionos1-amd64 4.19.0-16-amd64 #1 SMP Debian 4.19.181-1 (2021-03-19) x86_64 GNU/Linux I: ls -l /bin total 5116 -rwxr-xr-x 1 root root 1168776 Apr 17 2019 bash -rwxr-xr-x 3 root root 38984 Jul 10 2019 bunzip2 -rwxr-xr-x 3 root root 38984 Jul 10 2019 bzcat lrwxrwxrwx 1 root root 6 Jul 10 2019 bzcmp -> bzdiff -rwxr-xr-x 1 root root 2227 Jul 10 2019 bzdiff lrwxrwxrwx 1 root root 6 Jul 10 2019 bzegrep -> bzgrep -rwxr-xr-x 1 root root 4877 Jun 24 2019 bzexe lrwxrwxrwx 1 root root 6 Jul 10 2019 bzfgrep -> bzgrep -rwxr-xr-x 1 root root 3641 Jul 10 2019 bzgrep -rwxr-xr-x 3 root root 38984 Jul 10 2019 bzip2 -rwxr-xr-x 1 root root 14328 Jul 10 2019 bzip2recover lrwxrwxrwx 1 root root 6 Jul 10 2019 bzless -> bzmore -rwxr-xr-x 1 root root 1297 Jul 10 2019 bzmore -rwxr-xr-x 1 root root 43744 Feb 28 2019 cat -rwxr-xr-x 1 root root 64320 Feb 28 2019 chgrp -rwxr-xr-x 1 root root 64288 Feb 28 2019 chmod -rwxr-xr-x 1 root root 72512 Feb 28 2019 chown -rwxr-xr-x 1 root root 146880 Feb 28 2019 cp -rwxr-xr-x 1 root root 121464 Jan 17 2019 dash -rwxr-xr-x 1 root root 109408 Feb 28 2019 date -rwxr-xr-x 1 root root 76712 Feb 28 2019 dd -rwxr-xr-x 1 root root 93744 Feb 28 2019 df -rwxr-xr-x 1 root root 138856 Feb 28 2019 dir -rwxr-xr-x 1 root root 84288 Jan 9 2019 dmesg lrwxrwxrwx 1 root root 8 Sep 26 2018 dnsdomainname -> hostname lrwxrwxrwx 1 root root 8 Sep 26 2018 domainname -> hostname -rwxr-xr-x 1 root root 39520 Feb 28 2019 echo -rwxr-xr-x 1 root root 28 Jan 7 2019 egrep -rwxr-xr-x 1 root root 35424 Feb 28 2019 false -rwxr-xr-x 1 root root 28 Jan 7 2019 fgrep -rwxr-xr-x 1 root root 68880 Jan 9 2019 findmnt -rwsr-xr-x 1 root root 34896 Apr 22 2020 fusermount -rwxr-xr-x 1 root root 198976 Jan 7 2019 grep -rwxr-xr-x 2 root root 2345 Jan 5 2019 gunzip -rwxr-xr-x 1 root root 6375 Jan 5 2019 gzexe -rwxr-xr-x 1 root root 98048 Jan 5 2019 gzip -rwxr-xr-x 1 root root 26696 Sep 26 2018 hostname -rwxr-xr-x 1 root root 68552 Feb 28 2019 ln -rwxr-xr-x 1 root root 56760 Jul 26 2018 login -rwxr-xr-x 1 root root 138856 Feb 28 2019 ls -rwxr-xr-x 1 root root 108624 Jan 9 2019 lsblk -rwxr-xr-x 1 root root 89088 Feb 28 2019 mkdir -rwxr-xr-x 1 root root 68544 Feb 28 2019 mknod -rwxr-xr-x 1 root root 43808 Feb 28 2019 mktemp -rwxr-xr-x 1 root root 43008 Jan 9 2019 more -rwsr-xr-x 1 root root 51280 Jan 9 2019 mount -rwxr-xr-x 1 root root 14408 Jan 9 2019 mountpoint -rwxr-xr-x 1 root root 138728 Feb 28 2019 mv lrwxrwxrwx 1 root root 8 Sep 26 2018 nisdomainname -> hostname lrwxrwxrwx 1 root root 14 Feb 14 2019 pidof -> /sbin/killall5 -rwxr-xr-x 1 root root 39616 Feb 28 2019 pwd lrwxrwxrwx 1 root root 4 Apr 17 2019 rbash -> bash -rwxr-xr-x 1 root root 47776 Feb 28 2019 readlink -rwxr-xr-x 1 root root 68416 Feb 28 2019 rm -rwxr-xr-x 1 root root 47776 Feb 28 2019 rmdir -rwxr-xr-x 1 root root 23312 Jan 21 2019 run-parts -rwxr-xr-x 1 root root 122224 Dec 22 2018 sed lrwxrwxrwx 1 root root 4 Mar 20 20:24 sh -> dash -rwxr-xr-x 1 root root 39552 Feb 28 2019 sleep -rwxr-xr-x 1 root root 80672 Feb 28 2019 stty -rwsr-xr-x 1 root root 63568 Jan 9 2019 su -rwxr-xr-x 1 root root 35488 Feb 28 2019 sync -rwxr-xr-x 1 root root 445560 Apr 23 2019 tar -rwxr-xr-x 1 root root 14440 Jan 21 2019 tempfile -rwxr-xr-x 1 root root 97152 Feb 28 2019 touch -rwxr-xr-x 1 root root 35424 Feb 28 2019 true -rwxr-xr-x 1 root root 14328 Apr 22 2020 ulockmgr_server -rwsr-xr-x 1 root root 34888 Jan 9 2019 umount -rwxr-xr-x 1 root root 39584 Feb 28 2019 uname -rwxr-xr-x 2 root root 2345 Jan 5 2019 uncompress -rwxr-xr-x 1 root root 138856 Feb 28 2019 vdir -rwxr-xr-x 1 root root 34896 Jan 9 2019 wdctl -rwxr-xr-x 1 root root 946 Jan 21 2019 which lrwxrwxrwx 1 root root 8 Sep 26 2018 ypdomainname -> hostname -rwxr-xr-x 1 root root 1983 Jan 5 2019 zcat -rwxr-xr-x 1 root root 1677 Jan 5 2019 zcmp -rwxr-xr-x 1 root root 5879 Jan 5 2019 zdiff -rwxr-xr-x 1 root root 29 Jan 5 2019 zegrep -rwxr-xr-x 1 root root 29 Jan 5 2019 zfgrep -rwxr-xr-x 1 root root 2080 Jan 5 2019 zforce -rwxr-xr-x 1 root root 7584 Jan 5 2019 zgrep -rwxr-xr-x 1 root root 2205 Jan 5 2019 zless -rwxr-xr-x 1 root root 1841 Jan 5 2019 zmore -rwxr-xr-x 1 root root 4552 Jan 5 2019 znew I: user script /srv/workspace/pbuilder/4366/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: amd64 Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper (>= 11~), python, python-markdown, ronn, zlib1g-dev dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19195 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper (>= 11~); however: Package debhelper is not installed. pbuilder-satisfydepends-dummy depends on python; however: Package python is not installed. pbuilder-satisfydepends-dummy depends on python-markdown; however: Package python-markdown is not installed. pbuilder-satisfydepends-dummy depends on ronn; however: Package ronn is not installed. pbuilder-satisfydepends-dummy depends on zlib1g-dev; however: Package zlib1g-dev is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} automake{a} autopoint{a} autotools-dev{a} bsdmainutils{a} ca-certificates{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} gettext{a} gettext-base{a} groff{a} groff-base{a} intltool-debian{a} libarchive-zip-perl{a} libbsd0{a} libcroco3{a} libelf1{a} libexpat1{a} libfile-stripnondeterminism-perl{a} libglib2.0-0{a} libice6{a} libicu63{a} libmagic-mgc{a} libmagic1{a} libmarkdown2{a} libncurses6{a} libpipeline1{a} libpython-stdlib{a} libpython2-stdlib{a} libpython2.7-minimal{a} libpython2.7-stdlib{a} libreadline7{a} libruby2.5{a} libsigsegv2{a} libsm6{a} libssl1.1{a} libtool{a} libuchardet0{a} libx11-6{a} libx11-data{a} libxau6{a} libxaw7{a} libxcb1{a} libxdmcp6{a} libxext6{a} libxml2{a} libxmu6{a} libxpm4{a} libxslt1.1{a} libxt6{a} libyaml-0-2{a} lsb-base{a} m4{a} man-db{a} mime-support{a} openssl{a} po-debconf{a} python{a} python-markdown{a} python-minimal{a} python-pkg-resources{a} python2{a} python2-minimal{a} python2.7{a} python2.7-minimal{a} rake{a} readline-common{a} ronn{a} ruby{a} ruby-did-you-mean{a} ruby-minitest{a} ruby-mustache{a} ruby-net-telnet{a} ruby-nokogiri{a} ruby-pkg-config{a} ruby-power-assert{a} ruby-rdiscount{a} ruby-ronn{a} ruby-test-unit{a} ruby-xmlrpc{a} ruby2.5{a} rubygems-integration{a} sensible-utils{a} x11-common{a} zlib1g-dev{a} The following packages are RECOMMENDED but will NOT be installed: curl fonts-lato ghostscript graphicsmagick-imagemagick-compat imagemagick imagemagick-6.q16 libarchive-cpio-perl libglib2.0-data libgpm2 libjs-jquery libltdl-dev libmail-sendmail-perl libpaper1 lynx netpbm psutils python-pygments python-yaml shared-mime-info wget xdg-user-dirs zip 0 packages upgraded, 88 newly installed, 0 to remove and 0 not upgraded. Need to get 37.3 MB of archives. After unpacking 131 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian buster/main amd64 libbsd0 amd64 0.9.1-2+deb10u1 [99.5 kB] Get: 2 http://deb.debian.org/debian buster/main amd64 bsdmainutils amd64 11.1.2+b1 [191 kB] Get: 3 http://deb.debian.org/debian buster/main amd64 libuchardet0 amd64 0.0.6-3 [64.9 kB] Get: 4 http://deb.debian.org/debian buster/main amd64 groff-base amd64 1.22.4-3+deb10u1 [916 kB] Get: 5 http://deb.debian.org/debian buster/main amd64 libpipeline1 amd64 1.5.1-2 [31.2 kB] Get: 6 http://deb.debian.org/debian buster/main amd64 man-db amd64 2.8.5-2 [1274 kB] Get: 7 http://deb.debian.org/debian buster/main amd64 libpython2.7-minimal amd64 2.7.16-2+deb10u1 [395 kB] Get: 8 http://deb.debian.org/debian buster/main amd64 python2.7-minimal amd64 2.7.16-2+deb10u1 [1369 kB] Get: 9 http://deb.debian.org/debian buster/main amd64 python2-minimal amd64 2.7.16-1 [41.4 kB] Get: 10 http://deb.debian.org/debian buster/main amd64 python-minimal amd64 2.7.16-1 [21.0 kB] Get: 11 http://deb.debian.org/debian buster/main amd64 libssl1.1 amd64 1.1.1d-0+deb10u5 [1539 kB] Get: 12 http://deb.debian.org/debian buster/main amd64 mime-support all 3.62 [37.2 kB] Get: 13 http://deb.debian.org/debian buster/main amd64 libexpat1 amd64 2.2.6-2+deb10u1 [106 kB] Get: 14 http://deb.debian.org/debian buster/main amd64 readline-common all 7.0-5 [70.6 kB] Get: 15 http://deb.debian.org/debian buster/main amd64 libreadline7 amd64 7.0-5 [151 kB] Get: 16 http://deb.debian.org/debian buster/main amd64 libpython2.7-stdlib amd64 2.7.16-2+deb10u1 [1912 kB] Get: 17 http://deb.debian.org/debian buster/main amd64 python2.7 amd64 2.7.16-2+deb10u1 [305 kB] Get: 18 http://deb.debian.org/debian buster/main amd64 libpython2-stdlib amd64 2.7.16-1 [20.8 kB] Get: 19 http://deb.debian.org/debian buster/main amd64 libpython-stdlib amd64 2.7.16-1 [20.8 kB] Get: 20 http://deb.debian.org/debian buster/main amd64 python2 amd64 2.7.16-1 [41.6 kB] Get: 21 http://deb.debian.org/debian buster/main amd64 python amd64 2.7.16-1 [22.8 kB] Get: 22 http://deb.debian.org/debian buster/main amd64 sensible-utils all 0.0.12 [15.8 kB] Get: 23 http://deb.debian.org/debian buster/main amd64 libmagic-mgc amd64 1:5.35-4+deb10u2 [242 kB] Get: 24 http://deb.debian.org/debian buster/main amd64 libmagic1 amd64 1:5.35-4+deb10u2 [118 kB] Get: 25 http://deb.debian.org/debian buster/main amd64 file amd64 1:5.35-4+deb10u2 [66.4 kB] Get: 26 http://deb.debian.org/debian buster/main amd64 gettext-base amd64 0.19.8.1-9 [123 kB] Get: 27 http://deb.debian.org/debian buster/main amd64 libsigsegv2 amd64 2.12-2 [32.8 kB] Get: 28 http://deb.debian.org/debian buster/main amd64 m4 amd64 1.4.18-2 [203 kB] Get: 29 http://deb.debian.org/debian buster/main amd64 autoconf all 2.69-11 [341 kB] Get: 30 http://deb.debian.org/debian buster/main amd64 autotools-dev all 20180224.1 [77.0 kB] Get: 31 http://deb.debian.org/debian buster/main amd64 automake all 1:1.16.1-4 [771 kB] Get: 32 http://deb.debian.org/debian buster/main amd64 autopoint all 0.19.8.1-9 [434 kB] Get: 33 http://deb.debian.org/debian buster/main amd64 openssl amd64 1.1.1d-0+deb10u5 [844 kB] Get: 34 http://deb.debian.org/debian buster/main amd64 ca-certificates all 20200601~deb10u2 [166 kB] Get: 35 http://deb.debian.org/debian buster/main amd64 libtool all 2.4.6-9 [547 kB] Get: 36 http://deb.debian.org/debian buster/main amd64 dh-autoreconf all 19 [16.9 kB] Get: 37 http://deb.debian.org/debian buster/main amd64 libarchive-zip-perl all 1.64-1 [96.8 kB] Get: 38 http://deb.debian.org/debian buster/main amd64 libfile-stripnondeterminism-perl all 1.1.2-1 [19.8 kB] Get: 39 http://deb.debian.org/debian buster/main amd64 dh-strip-nondeterminism all 1.1.2-1 [13.0 kB] Get: 40 http://deb.debian.org/debian buster/main amd64 libelf1 amd64 0.176-1.1 [161 kB] Get: 41 http://deb.debian.org/debian buster/main amd64 dwz amd64 0.12-3 [78.0 kB] Get: 42 http://deb.debian.org/debian buster/main amd64 libglib2.0-0 amd64 2.58.3-2+deb10u2 [1258 kB] Get: 43 http://deb.debian.org/debian buster/main amd64 libicu63 amd64 63.1-6+deb10u1 [8300 kB] Get: 44 http://deb.debian.org/debian buster/main amd64 libxml2 amd64 2.9.4+dfsg1-7+deb10u1 [689 kB] Get: 45 http://deb.debian.org/debian buster/main amd64 libcroco3 amd64 0.6.12-3 [145 kB] Get: 46 http://deb.debian.org/debian buster/main amd64 libncurses6 amd64 6.1+20181013-2+deb10u2 [102 kB] Get: 47 http://deb.debian.org/debian buster/main amd64 gettext amd64 0.19.8.1-9 [1303 kB] Get: 48 http://deb.debian.org/debian buster/main amd64 intltool-debian all 0.35.0+20060710.5 [26.8 kB] Get: 49 http://deb.debian.org/debian buster/main amd64 po-debconf all 1.0.21 [248 kB] Get: 50 http://deb.debian.org/debian buster/main amd64 debhelper all 12.1.1 [1016 kB] Get: 51 http://deb.debian.org/debian buster/main amd64 lsb-base all 10.2019051400 [28.4 kB] Get: 52 http://deb.debian.org/debian buster/main amd64 x11-common all 1:7.7+19 [251 kB] Get: 53 http://deb.debian.org/debian buster/main amd64 libice6 amd64 2:1.0.9-2 [58.7 kB] Get: 54 http://deb.debian.org/debian buster/main amd64 libsm6 amd64 2:1.2.3-1 [35.1 kB] Get: 55 http://deb.debian.org/debian buster/main amd64 libxau6 amd64 1:1.0.8-1+b2 [19.9 kB] Get: 56 http://deb.debian.org/debian buster/main amd64 libxdmcp6 amd64 1:1.1.2-3 [26.3 kB] Get: 57 http://deb.debian.org/debian buster/main amd64 libxcb1 amd64 1.13.1-2 [137 kB] Get: 58 http://deb.debian.org/debian buster/main amd64 libx11-data all 2:1.6.7-1+deb10u1 [294 kB] Get: 59 http://deb.debian.org/debian buster/main amd64 libx11-6 amd64 2:1.6.7-1+deb10u1 [757 kB] Get: 60 http://deb.debian.org/debian buster/main amd64 libxext6 amd64 2:1.3.3-1+b2 [52.5 kB] Get: 61 http://deb.debian.org/debian buster/main amd64 libxt6 amd64 1:1.1.5-1+b3 [190 kB] Get: 62 http://deb.debian.org/debian buster/main amd64 libxmu6 amd64 2:1.1.2-2+b3 [60.8 kB] Get: 63 http://deb.debian.org/debian buster/main amd64 libxpm4 amd64 1:3.5.12-1 [49.1 kB] Get: 64 http://deb.debian.org/debian buster/main amd64 libxaw7 amd64 2:1.0.13-1+b2 [201 kB] Get: 65 http://deb.debian.org/debian buster/main amd64 groff amd64 1.22.4-3+deb10u1 [3973 kB] Get: 66 http://deb.debian.org/debian buster/main amd64 libmarkdown2 amd64 2.2.4-1 [36.0 kB] Get: 67 http://deb.debian.org/debian buster/main amd64 rubygems-integration all 1.11+deb10u1 [5212 B] Get: 68 http://deb.debian.org/debian buster/main amd64 ruby2.5 amd64 2.5.5-3+deb10u3 [400 kB] Get: 69 http://deb.debian.org/debian buster/main amd64 ruby amd64 1:2.5.1 [11.3 kB] Get: 70 http://deb.debian.org/debian buster/main amd64 rake all 12.3.1-3+deb10u1 [67.1 kB] Get: 71 http://deb.debian.org/debian buster/main amd64 ruby-did-you-mean all 1.2.1-1 [14.4 kB] Get: 72 http://deb.debian.org/debian buster/main amd64 ruby-minitest all 5.11.3-1 [54.8 kB] Get: 73 http://deb.debian.org/debian buster/main amd64 ruby-net-telnet all 0.1.1-2 [12.5 kB] Get: 74 http://deb.debian.org/debian buster/main amd64 ruby-power-assert all 1.1.1-1 [10.9 kB] Get: 75 http://deb.debian.org/debian buster/main amd64 ruby-test-unit all 3.2.8-1 [72.4 kB] Get: 76 http://deb.debian.org/debian buster/main amd64 ruby-xmlrpc all 0.3.0-2 [23.7 kB] Get: 77 http://deb.debian.org/debian buster/main amd64 libyaml-0-2 amd64 0.2.1-1 [47.2 kB] Get: 78 http://deb.debian.org/debian buster/main amd64 libruby2.5 amd64 2.5.5-3+deb10u3 [3438 kB] Get: 79 http://deb.debian.org/debian buster/main amd64 libxslt1.1 amd64 1.1.32-2.2~deb10u1 [237 kB] Get: 80 http://deb.debian.org/debian buster/main amd64 python-pkg-resources all 40.8.0-1 [182 kB] Get: 81 http://deb.debian.org/debian buster/main amd64 python-markdown all 3.0.1-3 [60.6 kB] Get: 82 http://deb.debian.org/debian buster/main amd64 ruby-pkg-config all 1.3.4-1 [8464 B] Get: 83 http://deb.debian.org/debian buster/main amd64 ruby-nokogiri amd64 1.10.0+dfsg1-2 [113 kB] Get: 84 http://deb.debian.org/debian buster/main amd64 ruby-mustache all 1.0.2-1 [25.1 kB] Get: 85 http://deb.debian.org/debian buster/main amd64 ruby-rdiscount amd64 2.1.8-1+b5 [40.3 kB] Get: 86 http://deb.debian.org/debian buster/main amd64 ruby-ronn all 0.8.0-2+deb10u1 [27.0 kB] Get: 87 http://deb.debian.org/debian buster/main amd64 ronn all 0.8.0-2+deb10u1 [8476 B] Get: 88 http://deb.debian.org/debian buster/main amd64 zlib1g-dev amd64 1:1.2.11.dfsg-1 [214 kB] Fetched 37.3 MB in 1s (56.1 MB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package libbsd0:amd64. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19195 files and directories currently installed.) Preparing to unpack .../00-libbsd0_0.9.1-2+deb10u1_amd64.deb ... Unpacking libbsd0:amd64 (0.9.1-2+deb10u1) ... Selecting previously unselected package bsdmainutils. Preparing to unpack .../01-bsdmainutils_11.1.2+b1_amd64.deb ... Unpacking bsdmainutils (11.1.2+b1) ... Selecting previously unselected package libuchardet0:amd64. Preparing to unpack .../02-libuchardet0_0.0.6-3_amd64.deb ... Unpacking libuchardet0:amd64 (0.0.6-3) ... Selecting previously unselected package groff-base. Preparing to unpack .../03-groff-base_1.22.4-3+deb10u1_amd64.deb ... Unpacking groff-base (1.22.4-3+deb10u1) ... Selecting previously unselected package libpipeline1:amd64. Preparing to unpack .../04-libpipeline1_1.5.1-2_amd64.deb ... Unpacking libpipeline1:amd64 (1.5.1-2) ... Selecting previously unselected package man-db. Preparing to unpack .../05-man-db_2.8.5-2_amd64.deb ... Unpacking man-db (2.8.5-2) ... Selecting previously unselected package libpython2.7-minimal:amd64. Preparing to unpack .../06-libpython2.7-minimal_2.7.16-2+deb10u1_amd64.deb ... Unpacking libpython2.7-minimal:amd64 (2.7.16-2+deb10u1) ... Selecting previously unselected package python2.7-minimal. Preparing to unpack .../07-python2.7-minimal_2.7.16-2+deb10u1_amd64.deb ... Unpacking python2.7-minimal (2.7.16-2+deb10u1) ... Selecting previously unselected package python2-minimal. Preparing to unpack .../08-python2-minimal_2.7.16-1_amd64.deb ... Unpacking python2-minimal (2.7.16-1) ... Selecting previously unselected package python-minimal. Preparing to unpack .../09-python-minimal_2.7.16-1_amd64.deb ... Unpacking python-minimal (2.7.16-1) ... Selecting previously unselected package libssl1.1:amd64. Preparing to unpack .../10-libssl1.1_1.1.1d-0+deb10u5_amd64.deb ... Unpacking libssl1.1:amd64 (1.1.1d-0+deb10u5) ... Selecting previously unselected package mime-support. Preparing to unpack .../11-mime-support_3.62_all.deb ... Unpacking mime-support (3.62) ... Selecting previously unselected package libexpat1:amd64. Preparing to unpack .../12-libexpat1_2.2.6-2+deb10u1_amd64.deb ... Unpacking libexpat1:amd64 (2.2.6-2+deb10u1) ... Selecting previously unselected package readline-common. Preparing to unpack .../13-readline-common_7.0-5_all.deb ... Unpacking readline-common (7.0-5) ... Selecting previously unselected package libreadline7:amd64. Preparing to unpack .../14-libreadline7_7.0-5_amd64.deb ... Unpacking libreadline7:amd64 (7.0-5) ... Selecting previously unselected package libpython2.7-stdlib:amd64. Preparing to unpack .../15-libpython2.7-stdlib_2.7.16-2+deb10u1_amd64.deb ... Unpacking libpython2.7-stdlib:amd64 (2.7.16-2+deb10u1) ... Selecting previously unselected package python2.7. Preparing to unpack .../16-python2.7_2.7.16-2+deb10u1_amd64.deb ... Unpacking python2.7 (2.7.16-2+deb10u1) ... Selecting previously unselected package libpython2-stdlib:amd64. Preparing to unpack .../17-libpython2-stdlib_2.7.16-1_amd64.deb ... Unpacking libpython2-stdlib:amd64 (2.7.16-1) ... Selecting previously unselected package libpython-stdlib:amd64. Preparing to unpack .../18-libpython-stdlib_2.7.16-1_amd64.deb ... Unpacking libpython-stdlib:amd64 (2.7.16-1) ... Setting up libpython2.7-minimal:amd64 (2.7.16-2+deb10u1) ... Setting up python2.7-minimal (2.7.16-2+deb10u1) ... Setting up python2-minimal (2.7.16-1) ... Selecting previously unselected package python2. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20658 files and directories currently installed.) Preparing to unpack .../python2_2.7.16-1_amd64.deb ... Unpacking python2 (2.7.16-1) ... Setting up python-minimal (2.7.16-1) ... Selecting previously unselected package python. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20691 files and directories currently installed.) Preparing to unpack .../00-python_2.7.16-1_amd64.deb ... Unpacking python (2.7.16-1) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../01-sensible-utils_0.0.12_all.deb ... Unpacking sensible-utils (0.0.12) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../02-libmagic-mgc_1%3a5.35-4+deb10u2_amd64.deb ... Unpacking libmagic-mgc (1:5.35-4+deb10u2) ... Selecting previously unselected package libmagic1:amd64. Preparing to unpack .../03-libmagic1_1%3a5.35-4+deb10u2_amd64.deb ... Unpacking libmagic1:amd64 (1:5.35-4+deb10u2) ... Selecting previously unselected package file. Preparing to unpack .../04-file_1%3a5.35-4+deb10u2_amd64.deb ... Unpacking file (1:5.35-4+deb10u2) ... Selecting previously unselected package gettext-base. Preparing to unpack .../05-gettext-base_0.19.8.1-9_amd64.deb ... Unpacking gettext-base (0.19.8.1-9) ... Selecting previously unselected package libsigsegv2:amd64. Preparing to unpack .../06-libsigsegv2_2.12-2_amd64.deb ... Unpacking libsigsegv2:amd64 (2.12-2) ... Selecting previously unselected package m4. Preparing to unpack .../07-m4_1.4.18-2_amd64.deb ... Unpacking m4 (1.4.18-2) ... Selecting previously unselected package autoconf. Preparing to unpack .../08-autoconf_2.69-11_all.deb ... Unpacking autoconf (2.69-11) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../09-autotools-dev_20180224.1_all.deb ... Unpacking autotools-dev (20180224.1) ... Selecting previously unselected package automake. Preparing to unpack .../10-automake_1%3a1.16.1-4_all.deb ... Unpacking automake (1:1.16.1-4) ... Selecting previously unselected package autopoint. Preparing to unpack .../11-autopoint_0.19.8.1-9_all.deb ... Unpacking autopoint (0.19.8.1-9) ... Selecting previously unselected package openssl. Preparing to unpack .../12-openssl_1.1.1d-0+deb10u5_amd64.deb ... Unpacking openssl (1.1.1d-0+deb10u5) ... Selecting previously unselected package ca-certificates. Preparing to unpack .../13-ca-certificates_20200601~deb10u2_all.deb ... Unpacking ca-certificates (20200601~deb10u2) ... Selecting previously unselected package libtool. Preparing to unpack .../14-libtool_2.4.6-9_all.deb ... Unpacking libtool (2.4.6-9) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../15-dh-autoreconf_19_all.deb ... Unpacking dh-autoreconf (19) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../16-libarchive-zip-perl_1.64-1_all.deb ... Unpacking libarchive-zip-perl (1.64-1) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../17-libfile-stripnondeterminism-perl_1.1.2-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.1.2-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../18-dh-strip-nondeterminism_1.1.2-1_all.deb ... Unpacking dh-strip-nondeterminism (1.1.2-1) ... Selecting previously unselected package libelf1:amd64. Preparing to unpack .../19-libelf1_0.176-1.1_amd64.deb ... Unpacking libelf1:amd64 (0.176-1.1) ... Selecting previously unselected package dwz. Preparing to unpack .../20-dwz_0.12-3_amd64.deb ... Unpacking dwz (0.12-3) ... Selecting previously unselected package libglib2.0-0:amd64. Preparing to unpack .../21-libglib2.0-0_2.58.3-2+deb10u2_amd64.deb ... Unpacking libglib2.0-0:amd64 (2.58.3-2+deb10u2) ... Selecting previously unselected package libicu63:amd64. Preparing to unpack .../22-libicu63_63.1-6+deb10u1_amd64.deb ... Unpacking libicu63:amd64 (63.1-6+deb10u1) ... Selecting previously unselected package libxml2:amd64. Preparing to unpack .../23-libxml2_2.9.4+dfsg1-7+deb10u1_amd64.deb ... Unpacking libxml2:amd64 (2.9.4+dfsg1-7+deb10u1) ... Selecting previously unselected package libcroco3:amd64. Preparing to unpack .../24-libcroco3_0.6.12-3_amd64.deb ... Unpacking libcroco3:amd64 (0.6.12-3) ... Selecting previously unselected package libncurses6:amd64. Preparing to unpack .../25-libncurses6_6.1+20181013-2+deb10u2_amd64.deb ... Unpacking libncurses6:amd64 (6.1+20181013-2+deb10u2) ... Selecting previously unselected package gettext. Preparing to unpack .../26-gettext_0.19.8.1-9_amd64.deb ... Unpacking gettext (0.19.8.1-9) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../27-intltool-debian_0.35.0+20060710.5_all.deb ... Unpacking intltool-debian (0.35.0+20060710.5) ... Selecting previously unselected package po-debconf. Preparing to unpack .../28-po-debconf_1.0.21_all.deb ... Unpacking po-debconf (1.0.21) ... Selecting previously unselected package debhelper. Preparing to unpack .../29-debhelper_12.1.1_all.deb ... Unpacking debhelper (12.1.1) ... Selecting previously unselected package lsb-base. Preparing to unpack .../30-lsb-base_10.2019051400_all.deb ... Unpacking lsb-base (10.2019051400) ... Selecting previously unselected package x11-common. Preparing to unpack .../31-x11-common_1%3a7.7+19_all.deb ... Unpacking x11-common (1:7.7+19) ... Selecting previously unselected package libice6:amd64. Preparing to unpack .../32-libice6_2%3a1.0.9-2_amd64.deb ... Unpacking libice6:amd64 (2:1.0.9-2) ... Selecting previously unselected package libsm6:amd64. Preparing to unpack .../33-libsm6_2%3a1.2.3-1_amd64.deb ... Unpacking libsm6:amd64 (2:1.2.3-1) ... Selecting previously unselected package libxau6:amd64. Preparing to unpack .../34-libxau6_1%3a1.0.8-1+b2_amd64.deb ... Unpacking libxau6:amd64 (1:1.0.8-1+b2) ... Selecting previously unselected package libxdmcp6:amd64. Preparing to unpack .../35-libxdmcp6_1%3a1.1.2-3_amd64.deb ... Unpacking libxdmcp6:amd64 (1:1.1.2-3) ... Selecting previously unselected package libxcb1:amd64. Preparing to unpack .../36-libxcb1_1.13.1-2_amd64.deb ... Unpacking libxcb1:amd64 (1.13.1-2) ... Selecting previously unselected package libx11-data. Preparing to unpack .../37-libx11-data_2%3a1.6.7-1+deb10u1_all.deb ... Unpacking libx11-data (2:1.6.7-1+deb10u1) ... Selecting previously unselected package libx11-6:amd64. Preparing to unpack .../38-libx11-6_2%3a1.6.7-1+deb10u1_amd64.deb ... Unpacking libx11-6:amd64 (2:1.6.7-1+deb10u1) ... Selecting previously unselected package libxext6:amd64. Preparing to unpack .../39-libxext6_2%3a1.3.3-1+b2_amd64.deb ... Unpacking libxext6:amd64 (2:1.3.3-1+b2) ... Selecting previously unselected package libxt6:amd64. Preparing to unpack .../40-libxt6_1%3a1.1.5-1+b3_amd64.deb ... Unpacking libxt6:amd64 (1:1.1.5-1+b3) ... Selecting previously unselected package libxmu6:amd64. Preparing to unpack .../41-libxmu6_2%3a1.1.2-2+b3_amd64.deb ... Unpacking libxmu6:amd64 (2:1.1.2-2+b3) ... Selecting previously unselected package libxpm4:amd64. Preparing to unpack .../42-libxpm4_1%3a3.5.12-1_amd64.deb ... Unpacking libxpm4:amd64 (1:3.5.12-1) ... Selecting previously unselected package libxaw7:amd64. Preparing to unpack .../43-libxaw7_2%3a1.0.13-1+b2_amd64.deb ... Unpacking libxaw7:amd64 (2:1.0.13-1+b2) ... Selecting previously unselected package groff. Preparing to unpack .../44-groff_1.22.4-3+deb10u1_amd64.deb ... Unpacking groff (1.22.4-3+deb10u1) ... Selecting previously unselected package libmarkdown2:amd64. Preparing to unpack .../45-libmarkdown2_2.2.4-1_amd64.deb ... Unpacking libmarkdown2:amd64 (2.2.4-1) ... Selecting previously unselected package rubygems-integration. Preparing to unpack .../46-rubygems-integration_1.11+deb10u1_all.deb ... Unpacking rubygems-integration (1.11+deb10u1) ... Selecting previously unselected package ruby2.5. Preparing to unpack .../47-ruby2.5_2.5.5-3+deb10u3_amd64.deb ... Unpacking ruby2.5 (2.5.5-3+deb10u3) ... Selecting previously unselected package ruby. Preparing to unpack .../48-ruby_1%3a2.5.1_amd64.deb ... Unpacking ruby (1:2.5.1) ... Selecting previously unselected package rake. Preparing to unpack .../49-rake_12.3.1-3+deb10u1_all.deb ... Unpacking rake (12.3.1-3+deb10u1) ... Selecting previously unselected package ruby-did-you-mean. Preparing to unpack .../50-ruby-did-you-mean_1.2.1-1_all.deb ... Unpacking ruby-did-you-mean (1.2.1-1) ... Selecting previously unselected package ruby-minitest. Preparing to unpack .../51-ruby-minitest_5.11.3-1_all.deb ... Unpacking ruby-minitest (5.11.3-1) ... Selecting previously unselected package ruby-net-telnet. Preparing to unpack .../52-ruby-net-telnet_0.1.1-2_all.deb ... Unpacking ruby-net-telnet (0.1.1-2) ... Selecting previously unselected package ruby-power-assert. Preparing to unpack .../53-ruby-power-assert_1.1.1-1_all.deb ... Unpacking ruby-power-assert (1.1.1-1) ... Selecting previously unselected package ruby-test-unit. Preparing to unpack .../54-ruby-test-unit_3.2.8-1_all.deb ... Unpacking ruby-test-unit (3.2.8-1) ... Selecting previously unselected package ruby-xmlrpc. Preparing to unpack .../55-ruby-xmlrpc_0.3.0-2_all.deb ... Unpacking ruby-xmlrpc (0.3.0-2) ... Selecting previously unselected package libyaml-0-2:amd64. Preparing to unpack .../56-libyaml-0-2_0.2.1-1_amd64.deb ... Unpacking libyaml-0-2:amd64 (0.2.1-1) ... Selecting previously unselected package libruby2.5:amd64. Preparing to unpack .../57-libruby2.5_2.5.5-3+deb10u3_amd64.deb ... Unpacking libruby2.5:amd64 (2.5.5-3+deb10u3) ... Selecting previously unselected package libxslt1.1:amd64. Preparing to unpack .../58-libxslt1.1_1.1.32-2.2~deb10u1_amd64.deb ... Unpacking libxslt1.1:amd64 (1.1.32-2.2~deb10u1) ... Selecting previously unselected package python-pkg-resources. Preparing to unpack .../59-python-pkg-resources_40.8.0-1_all.deb ... Unpacking python-pkg-resources (40.8.0-1) ... Selecting previously unselected package python-markdown. Preparing to unpack .../60-python-markdown_3.0.1-3_all.deb ... Unpacking python-markdown (3.0.1-3) ... Selecting previously unselected package ruby-pkg-config. Preparing to unpack .../61-ruby-pkg-config_1.3.4-1_all.deb ... Unpacking ruby-pkg-config (1.3.4-1) ... Selecting previously unselected package ruby-nokogiri. Preparing to unpack .../62-ruby-nokogiri_1.10.0+dfsg1-2_amd64.deb ... Unpacking ruby-nokogiri (1.10.0+dfsg1-2) ... Selecting previously unselected package ruby-mustache. Preparing to unpack .../63-ruby-mustache_1.0.2-1_all.deb ... Unpacking ruby-mustache (1.0.2-1) ... Selecting previously unselected package ruby-rdiscount. Preparing to unpack .../64-ruby-rdiscount_2.1.8-1+b5_amd64.deb ... Unpacking ruby-rdiscount (2.1.8-1+b5) ... Selecting previously unselected package ruby-ronn. Preparing to unpack .../65-ruby-ronn_0.8.0-2+deb10u1_all.deb ... Unpacking ruby-ronn (0.8.0-2+deb10u1) ... Selecting previously unselected package ronn. Preparing to unpack .../66-ronn_0.8.0-2+deb10u1_all.deb ... Unpacking ronn (0.8.0-2+deb10u1) ... Selecting previously unselected package zlib1g-dev:amd64. Preparing to unpack .../67-zlib1g-dev_1%3a1.2.11.dfsg-1_amd64.deb ... Unpacking zlib1g-dev:amd64 (1:1.2.11.dfsg-1) ... Setting up libexpat1:amd64 (2.2.6-2+deb10u1) ... Setting up libpipeline1:amd64 (1.5.1-2) ... Setting up lsb-base (10.2019051400) ... Setting up libxau6:amd64 (1:1.0.8-1+b2) ... Setting up mime-support (3.62) ... Setting up ruby-power-assert (1.1.1-1) ... Setting up libmagic-mgc (1:5.35-4+deb10u2) ... Setting up libarchive-zip-perl (1.64-1) ... Setting up libyaml-0-2:amd64 (0.2.1-1) ... Setting up libglib2.0-0:amd64 (2.58.3-2+deb10u2) ... No schema files found: doing nothing. Setting up libssl1.1:amd64 (1.1.1d-0+deb10u5) ... Setting up x11-common (1:7.7+19) ... update-rc.d: warning: start and stop actions are no longer supported; falling back to defaults invoke-rc.d: could not determine current runlevel Setting up X socket directories... /tmp/.X11-unix /tmp/.ICE-unix. Setting up libmagic1:amd64 (1:5.35-4+deb10u2) ... Setting up gettext-base (0.19.8.1-9) ... Setting up file (1:5.35-4+deb10u2) ... Setting up libicu63:amd64 (63.1-6+deb10u1) ... Setting up ruby-minitest (5.11.3-1) ... Setting up autotools-dev (20180224.1) ... Setting up ruby-test-unit (3.2.8-1) ... Setting up libx11-data (2:1.6.7-1+deb10u1) ... Setting up libncurses6:amd64 (6.1+20181013-2+deb10u2) ... Setting up ruby-net-telnet (0.1.1-2) ... Setting up libsigsegv2:amd64 (2.12-2) ... Setting up autopoint (0.19.8.1-9) ... Setting up zlib1g-dev:amd64 (1:1.2.11.dfsg-1) ... Setting up sensible-utils (0.0.12) ... Setting up libuchardet0:amd64 (0.0.6-3) ... Setting up ruby-did-you-mean (1.2.1-1) ... Setting up openssl (1.1.1d-0+deb10u5) ... Setting up libbsd0:amd64 (0.9.1-2+deb10u1) ... Setting up libelf1:amd64 (0.176-1.1) ... Setting up readline-common (7.0-5) ... Setting up ruby-xmlrpc (0.3.0-2) ... Setting up libxml2:amd64 (2.9.4+dfsg1-7+deb10u1) ... Setting up libmarkdown2:amd64 (2.2.4-1) ... Setting up libreadline7:amd64 (7.0-5) ... Setting up libfile-stripnondeterminism-perl (1.1.2-1) ... Setting up libice6:amd64 (2:1.0.9-2) ... Setting up libxdmcp6:amd64 (1:1.1.2-3) ... Setting up libxcb1:amd64 (1.13.1-2) ... Setting up libtool (2.4.6-9) ... Setting up m4 (1.4.18-2) ... Setting up libpython2.7-stdlib:amd64 (2.7.16-2+deb10u1) ... Setting up ca-certificates (20200601~deb10u2) ... Updating certificates in /etc/ssl/certs... 137 added, 0 removed; done. Setting up bsdmainutils (11.1.2+b1) ... update-alternatives: using /usr/bin/bsd-write to provide /usr/bin/write (write) in auto mode update-alternatives: using /usr/bin/bsd-from to provide /usr/bin/from (from) in auto mode Setting up libcroco3:amd64 (0.6.12-3) ... Setting up autoconf (2.69-11) ... Setting up dwz (0.12-3) ... Setting up groff-base (1.22.4-3+deb10u1) ... Setting up libxslt1.1:amd64 (1.1.32-2.2~deb10u1) ... Setting up libx11-6:amd64 (2:1.6.7-1+deb10u1) ... Setting up libsm6:amd64 (2:1.2.3-1) ... Setting up automake (1:1.16.1-4) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up gettext (0.19.8.1-9) ... Setting up libxpm4:amd64 (1:3.5.12-1) ... Setting up python2.7 (2.7.16-2+deb10u1) ... Setting up libpython2-stdlib:amd64 (2.7.16-1) ... Setting up libxext6:amd64 (2:1.3.3-1+b2) ... Setting up rubygems-integration (1.11+deb10u1) ... Setting up man-db (2.8.5-2) ... Not building database; man-db/auto-update is not 'true'. Setting up python2 (2.7.16-1) ... Setting up intltool-debian (0.35.0+20060710.5) ... Setting up libpython-stdlib:amd64 (2.7.16-1) ... Setting up libxt6:amd64 (1:1.1.5-1+b3) ... Setting up python (2.7.16-1) ... Setting up libxmu6:amd64 (2:1.1.2-2+b3) ... Setting up python-pkg-resources (40.8.0-1) ... Setting up po-debconf (1.0.21) ... Setting up python-markdown (3.0.1-3) ... Setting up libxaw7:amd64 (2:1.0.13-1+b2) ... Setting up groff (1.22.4-3+deb10u1) ... Setting up rake (12.3.1-3+deb10u1) ... Setting up libruby2.5:amd64 (2.5.5-3+deb10u3) ... Setting up dh-autoreconf (19) ... Setting up dh-strip-nondeterminism (1.1.2-1) ... Setting up ruby2.5 (2.5.5-3+deb10u3) ... Setting up debhelper (12.1.1) ... Setting up ruby (1:2.5.1) ... Setting up ruby-pkg-config (1.3.4-1) ... Setting up ruby-mustache (1.0.2-1) ... Setting up ruby-nokogiri (1.10.0+dfsg1-2) ... Setting up ruby-rdiscount (2.1.8-1+b5) ... Setting up ruby-ronn (0.8.0-2+deb10u1) ... Setting up ronn (0.8.0-2+deb10u1) ... Processing triggers for libc-bin (2.28-10) ... Processing triggers for ca-certificates (20200601~deb10u2) ... Updating certificates in /etc/ssl/certs... 0 added, 0 removed; done. Running hooks in /etc/ca-certificates/update.d... done. Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps Reading package lists... Building dependency tree... Reading state information... fakeroot is already the newest version (1.23-1). 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. I: Building the package I: Running cd /build/seqprep-1.3.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b dpkg-buildpackage: info: source package seqprep dpkg-buildpackage: info: source version 1.3.2-3 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Andreas Tille dpkg-source --before-build . dpkg-buildpackage: info: host architecture amd64 fakeroot debian/rules clean dh clean dh_auto_clean make -j15 clean make[1]: Entering directory '/build/seqprep-1.3.2' rm -f SeqPrep.o utils.o stdaln.o SeqPrep make[1]: Leaving directory '/build/seqprep-1.3.2' debian/rules override_dh_clean make[1]: Entering directory '/build/seqprep-1.3.2' dh_clean rm -f seqprep rm -f debian/*.1 rm -f README.html make[1]: Leaving directory '/build/seqprep-1.3.2' debian/rules build dh build dh_update_autotools_config dh_autoreconf dh_auto_configure debian/rules override_dh_auto_build make[1]: Entering directory '/build/seqprep-1.3.2' dh_auto_build make -j15 "INSTALL=install --strip-program=true" make[2]: Entering directory '/build/seqprep-1.3.2' cc -g -O2 -ffile-prefix-map=/build/seqprep-1.3.2=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 SeqPrep.c -o SeqPrep.o cc -g -O2 -ffile-prefix-map=/build/seqprep-1.3.2=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 utils.c -o utils.o cc -g -O2 -ffile-prefix-map=/build/seqprep-1.3.2=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 stdaln.c -o stdaln.o SeqPrep.c: In function 'main': SeqPrep.c:166:15: warning: implicit declaration of function 'getopt'; did you mean 'getgid'? [-Wimplicit-function-declaration] while( (ich=getopt( argc, argv, "f:r:1:2:3:4:q:A:s:y:B:O:E:x:M:N:L:o:m:b:w:W:p:P:X:Q:t:e:Z:n:S6ghz" )) != -1 ) { ^~~~~~ getgid cc SeqPrep.o utils.o stdaln.o -Wl,-z,relro -Wl,-z,now -lz -lm -o SeqPrep make[2]: Leaving directory '/build/seqprep-1.3.2' cp SeqPrep seqprep TZ=UTC ronn -r --manual=seqprep --organization='Cancer Therapeutics Innovation Group' debian/seqprep.1.ronn roff: debian/seqprep.1 markdown_py -f README.html README.md make[1]: Leaving directory '/build/seqprep-1.3.2' debian/rules override_dh_auto_test make[1]: Entering directory '/build/seqprep-1.3.2' # This checks that the tests run and produce byte-identical results. cd Test && mkdir -p out info && \ bash -xc 'gzcat(){ zcat "$@" ; } ; . RUNTEST.sh' + . RUNTEST.sh ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_merged_1.fastq.gz -2 ./out/pe_bad_contam_merged_2.fastq.gz -s ./out/pe_bad_contam_merged_s.fastq.gz -E ./info/alignments_merged.txt.gz Pairs Processed: 0 Pairs Merged: 14314 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.352215 ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_trimmed_1.fastq.gz -2 ./out/pe_bad_contam_trimmed_2.fastq.gz -E ./info/alignments_trimmed.txt.gz Pairs Processed: 0 Pairs Merged: 0 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.339484 ++ prog=gzcat ++ gzcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ zcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ python seqlens.py ++ gzcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ zcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ python seqlens.py ++ gzcat ./out/pe_bad_contam_merged_1.fastq.gz ++ zcat ./out/pe_bad_contam_merged_1.fastq.gz ++ python seqlens.py ++ gzcat ./out/pe_bad_contam_merged_2.fastq.gz ++ zcat ./out/pe_bad_contam_merged_2.fastq.gz ++ python seqlens.py ++ python seqlens.py ++ gzcat ./out/pe_bad_contam_merged_s.fastq.gz ++ zcat ./out/pe_bad_contam_merged_s.fastq.gz [ `cat Test/info/pe_*.txt | md5sum | cut -b -10` = 8bc8e0787e ] # remove output dirs right after testing to make sure the files # will not be included in the data package rm -rf Test/info Test/out make[1]: Leaving directory '/build/seqprep-1.3.2' create-stamp debian/debhelper-build-stamp fakeroot debian/rules binary dh binary dh_testroot dh_prep dh_auto_install make -j15 install DESTDIR=/build/seqprep-1.3.2/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[1]: Entering directory '/build/seqprep-1.3.2' cp SeqPrep /nonexistent/first-build/bin cp: cannot create regular file '/nonexistent/first-build/bin': No such file or directory make[1]: [Makefile:15: install] Error 1 (ignored) make[1]: Leaving directory '/build/seqprep-1.3.2' debian/rules override_dh_install-indep make[1]: Entering directory '/build/seqprep-1.3.2' dh_install sed -i 's#../SeqPrep#/usr/bin/seqprep#' /build/seqprep-1.3.2/debian/seqprep-data/usr/share/doc/seqprep/examples/RUNTEST.sh make[1]: Leaving directory '/build/seqprep-1.3.2' dh_install -Nseqprep-data dh_installdocs dh_installchangelogs dh_installman dh_perl dh_link dh_strip_nondeterminism dh_compress dh_fixperms dh_missing dh_strip dh_makeshlibs dh_shlibdeps dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'seqprep-data' in '../seqprep-data_1.3.2-3_all.deb'. dpkg-deb: building package 'seqprep-dbgsym' in '../seqprep-dbgsym_1.3.2-3_amd64.deb'. dpkg-deb: building package 'seqprep' in '../seqprep_1.3.2-3_amd64.deb'. dpkg-genbuildinfo --build=binary dpkg-genchanges --build=binary >../seqprep_1.3.2-3_amd64.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) I: copying local configuration I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/4366 and its subdirectories I: Current time: Mon Apr 5 04:39:35 -12 2021 I: pbuilder-time-stamp: 1617640775 Mon Apr 5 16:39:36 UTC 2021 I: 1st build successful. Starting 2nd build on remote node ionos5-amd64.debian.net. Mon Apr 5 16:39:36 UTC 2021 I: Preparing to do remote build '2' on ionos5-amd64.debian.net. Mon Apr 5 16:41:20 UTC 2021 I: Deleting $TMPDIR on ionos5-amd64.debian.net. Mon Apr 5 16:41:21 UTC 2021 I: seqprep_1.3.2-3_amd64.changes: Format: 1.8 Date: Fri, 06 Jul 2018 15:26:19 +0200 Source: seqprep Binary: seqprep seqprep-data seqprep-dbgsym Architecture: all amd64 Version: 1.3.2-3 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team Changed-By: Andreas Tille Description: seqprep - stripping adaptors and/or merging paired reads of DNA sequences w seqprep-data - example data set for seqprep - only used for testing Closes: 903071 Changes: seqprep (1.3.2-3) unstable; urgency=medium . * Build-Depends: ruby-ronn -> ronn Closes: #903071 * debhelper 11 * Point Vcs fields to salsa.debian.org * Standards-Version: 4.1.4 Checksums-Sha1: d1a95a5da82c541d985cafefd4fa8fb99433816d 35859816 seqprep-data_1.3.2-3_all.deb 46bfaaa6fb7e59f06d8ede3179bc8d7b9f032ebd 19788 seqprep-dbgsym_1.3.2-3_amd64.deb 60da3443f10b5d09c7ab4ec7f34c6a1e8dea41c1 6595 seqprep_1.3.2-3_amd64.buildinfo 0f9fc6a6129d8f8af9be5c1a07a07b9050926c73 28212 seqprep_1.3.2-3_amd64.deb Checksums-Sha256: de58e7daacafc4a75b2811eec50ef202921f48ae5612643ef8de08fa6f9a86b5 35859816 seqprep-data_1.3.2-3_all.deb 7068cc289f228731ed1232029c7801940a3623634cee34ed2e85e0c86fb5e502 19788 seqprep-dbgsym_1.3.2-3_amd64.deb 3f3639c3ff3222e7c959bf5c542833f4b6d7b294de5438f3d485c83103380904 6595 seqprep_1.3.2-3_amd64.buildinfo ab1ef1cd93a9376fb6eac49ee7a6f1725c3ca80ce56a32efa8d43db409fe41e5 28212 seqprep_1.3.2-3_amd64.deb Files: c427e178b5140ad50eaeefb73f19ce81 35859816 science optional seqprep-data_1.3.2-3_all.deb 1a163327a56d90fdf26883c8e3ef1bf1 19788 debug optional seqprep-dbgsym_1.3.2-3_amd64.deb 554e6602392caf3bc90cf58fce832ba7 6595 science optional seqprep_1.3.2-3_amd64.buildinfo c9eb8b968a26f64368585ad2ec05f003 28212 science optional seqprep_1.3.2-3_amd64.deb Mon Apr 5 16:41:22 UTC 2021 I: diffoscope 170 will be used to compare the two builds: # Profiling output for: /usr/bin/diffoscope --html /srv/reproducible-results/rbuild-debian/tmp.A7vSM8hgEt/seqprep_1.3.2-3.diffoscope.html --text /srv/reproducible-results/rbuild-debian/tmp.A7vSM8hgEt/seqprep_1.3.2-3.diffoscope.txt --json /srv/reproducible-results/rbuild-debian/tmp.A7vSM8hgEt/seqprep_1.3.2-3.diffoscope.json --profile=- /srv/reproducible-results/rbuild-debian/tmp.A7vSM8hgEt/b1/seqprep_1.3.2-3_amd64.changes /srv/reproducible-results/rbuild-debian/tmp.A7vSM8hgEt/b2/seqprep_1.3.2-3_amd64.changes ## command (total time: 0.000s) 0.000s 1 call cmp (internal) ## has_same_content_as (total time: 0.000s) 0.000s 1 call abc.DotChangesFile ## main (total time: 0.662s) 0.662s 2 calls outputs 0.000s 1 call cleanup ## recognizes (total time: 0.422s) 0.422s 10 calls diffoscope.comparators.binary.FilesystemFile 0.000s 8 calls abc.DotChangesFile Mon Apr 5 16:41:24 UTC 2021 I: diffoscope 170 found no differences in the changes files, and a .buildinfo file also exists. Mon Apr 5 16:41:24 UTC 2021 I: seqprep from buster built successfully and reproducibly on amd64. Mon Apr 5 16:41:25 UTC 2021 I: Submitting .buildinfo files to external archives: Mon Apr 5 16:41:25 UTC 2021 I: Submitting 8.0K b1/seqprep_1.3.2-3_amd64.buildinfo.asc Mon Apr 5 16:41:26 UTC 2021 I: Submitting 8.0K b2/seqprep_1.3.2-3_amd64.buildinfo.asc Mon Apr 5 16:41:27 UTC 2021 I: Done submitting .buildinfo files to http://buildinfo.debian.net/api/submit. Mon Apr 5 16:41:27 UTC 2021 I: Done submitting .buildinfo files. Mon Apr 5 16:41:27 UTC 2021 I: Removing signed seqprep_1.3.2-3_amd64.buildinfo.asc files: removed './b1/seqprep_1.3.2-3_amd64.buildinfo.asc' removed './b2/seqprep_1.3.2-3_amd64.buildinfo.asc'