Thu Jun 24 17:35:34 UTC 2021 I: starting to build seqprep/bullseye/i386 on jenkins on '2021-06-24 17:35' Thu Jun 24 17:35:34 UTC 2021 I: The jenkins build log is/was available at https://jenkins.debian.net/userContent/reproducible/debian/build_service/i386_3/11070/console.log Thu Jun 24 17:35:34 UTC 2021 I: Downloading source for bullseye/seqprep=1.3.2-5 --2021-06-24 17:35:34-- http://cdn-fastly.deb.debian.org/debian/pool/main/s/seqprep/seqprep_1.3.2-5.dsc Connecting to 78.137.99.97:3128... connected. Proxy request sent, awaiting response... 200 OK Length: 2108 (2.1K) Saving to: ‘seqprep_1.3.2-5.dsc’ 0K .. 100% 181M=0s 2021-06-24 17:35:34 (181 MB/s) - ‘seqprep_1.3.2-5.dsc’ saved [2108/2108] Thu Jun 24 17:35:34 UTC 2021 I: seqprep_1.3.2-5.dsc -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA256 Format: 3.0 (quilt) Source: seqprep Binary: seqprep, seqprep-data Architecture: any all Version: 1.3.2-5 Maintainer: Debian Med Packaging Team Uploaders: Tim Booth , Andreas Tille Homepage: http://seqanswers.com/wiki/SeqPrep Standards-Version: 4.4.1 Vcs-Browser: https://salsa.debian.org/med-team/seqprep Vcs-Git: https://salsa.debian.org/med-team/seqprep.git Testsuite: autopkgtest Testsuite-Triggers: python3 Build-Depends: debhelper-compat (= 12), python3, markdown, zlib1g-dev Package-List: seqprep deb science optional arch=any seqprep-data deb science optional arch=all Checksums-Sha1: 9f533e1fd14d310ba0ccd4ef38c3abc55b8fc5fd 37177540 seqprep_1.3.2.orig.tar.gz 7a2452878a6ba5bc671f65b4449db8efa4ea8f08 10876 seqprep_1.3.2-5.debian.tar.xz Checksums-Sha256: 2b8a462a0e0a3e51f70be7730dc77b1f2bb69e74845dd0fbd2110a921c32265a 37177540 seqprep_1.3.2.orig.tar.gz 2d647e7e61cb314254e0cc00fc568e6f03120760d0b3cada27c946bb7f1d6dfb 10876 seqprep_1.3.2-5.debian.tar.xz Files: b6a4f5491dfdb0ce38bf791454151468 37177540 seqprep_1.3.2.orig.tar.gz f75fda0d0aebd9ba722baeca487ec6b4 10876 seqprep_1.3.2-5.debian.tar.xz -----BEGIN PGP SIGNATURE----- iQJFBAEBCAAvFiEE8fAHMgoDVUHwpmPKV4oElNHGRtEFAl4lhOMRHHRpbGxlQGRl Ymlhbi5vcmcACgkQV4oElNHGRtE5Cw/+IiBu2hW8AoIFTk3bAeoibOShlx/gmid0 cAlhquWkGlTEycHM0FV5H5vhdHAiBcHsnxqgehcHVGT/YIUIrGBukzHRie0cNr4o dEKMaZo4xB4fr44Vncm5xrsYje/r+2zI+77EuhWtV6drjgnUZWzLcmP6ATpiy3FD zzEofxFDeHlEM2oReAbaNDTqTAuUkXOIhx05Ls12AigcQjpOCWWQiKlk6YxUlec8 Ek7YlQQKaa0iYO+3OCG976wluFoqWS6TerTJfwdj+5QaGjNpp2tT5qEdeEM86S+r 4KMY1bGXuoOQlFh9K++wLyXnZXRA10ho0HNV2hv8AxF2huJnBZduL8m/ihFty+kU AhuHGie6uJ0EAv0p6uD3nqPLD8s474B+PolOLtVAOTlUYP8o54ACQF7IaDQv1DoB z/gWxygPgW7Qf1+TU/WJQTTwLYb0VCClffOrzf7N46jCiuc/iOni4sdNXECF4c+z RC9iYSsYGUlhpXVIXFVDXtJnd9YFdrCCjY0cqk4jn4Cw59Y/vL3weTKDkevWjLYi M5ga4DnRW6EsBV2uqxDyX3esfv/XyE1T+lnIPZkvaN5YYubif2bYlyrBUm/R3jnG yMRH/xXSFftJGanb+SFXsNw3L1WQKlWefOp0VPfjKxJCBzOs5qlX0ayo5AZPaMFX VFHk2GNvx3s= =XQep -----END PGP SIGNATURE----- Thu Jun 24 17:35:34 UTC 2021 I: Checking whether the package is not for us Thu Jun 24 17:35:35 UTC 2021 I: Starting 1st build on remote node ionos2-i386.debian.net. Thu Jun 24 17:35:35 UTC 2021 I: Preparing to do remote build '1' on ionos2-i386.debian.net. Thu Jun 24 17:42:28 UTC 2021 I: Deleting $TMPDIR on ionos2-i386.debian.net. I: pbuilder: network access will be disabled during build I: Current time: Thu Jun 24 05:35:55 -12 2021 I: pbuilder-time-stamp: 1624556155 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/bullseye-reproducible-base.tgz] I: copying local configuration I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: using eatmydata during job I: Copying source file I: copying [seqprep_1.3.2-5.dsc] I: copying [./seqprep_1.3.2.orig.tar.gz] I: copying [./seqprep_1.3.2-5.debian.tar.xz] I: Extracting source gpgv: unknown type of key resource 'trustedkeys.kbx' gpgv: keyblock resource '/tmp/dpkg-verify-sig.X2I35T8I/trustedkeys.kbx': General error gpgv: Signature made Sun Jan 19 22:45:55 2020 -12 gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 gpgv: issuer "tille@debian.org" gpgv: Can't check signature: No public key dpkg-source: warning: failed to verify signature on ./seqprep_1.3.2-5.dsc dpkg-source: info: extracting seqprep in seqprep-1.3.2 dpkg-source: info: unpacking seqprep_1.3.2.orig.tar.gz dpkg-source: info: unpacking seqprep_1.3.2-5.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying fix_unused_variable_errors.patch dpkg-source: info: applying hardening.patch dpkg-source: info: applying replace-float-with-double.patch dpkg-source: info: applying 2to3.patch I: using fakeroot in build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/4293/tmp/hooks/D02_print_environment starting I: set BUILDDIR='/build' BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' BUILDUSERNAME='pbuilder1' BUILD_ARCH='i386' DEBIAN_FRONTEND='noninteractive' DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all,-fixfilepath parallel=10' DISTRIBUTION='' HOME='/root' HOST_ARCH='i386' IFS=' ' INVOCATION_ID='d135559e09824cc587d3e62ab591c8ee' LANG='C' LANGUAGE='en_US:en' LC_ALL='C' LD_LIBRARY_PATH='/usr/lib/libeatmydata' LD_PRELOAD='libeatmydata.so' MAIL='/var/mail/root' OPTIND='1' PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' PBCURRENTCOMMANDLINEOPERATION='build' PBUILDER_OPERATION='build' PBUILDER_PKGDATADIR='/usr/share/pbuilder' PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' PBUILDER_SYSCONFDIR='/etc' PPID='4293' PS1='# ' PS2='> ' PS4='+ ' PWD='/' SHELL='/bin/bash' SHLVL='2' SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/tmp.ZPOHa0PMA8/pbuilderrc_HEjm --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/bullseye-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/tmp.ZPOHa0PMA8/b1 --logfile b1/build.log seqprep_1.3.2-5.dsc' SUDO_GID='112' SUDO_UID='107' SUDO_USER='jenkins' TERM='unknown' TZ='/usr/share/zoneinfo/Etc/GMT+12' USER='root' _='/usr/bin/systemd-run' http_proxy='http://78.137.99.97:3128' I: uname -a Linux ionos2-i386 4.19.0-17-686-pae #1 SMP Debian 4.19.194-1 (2021-06-10) i686 GNU/Linux I: ls -l /bin total 5776 -rwxr-xr-x 1 root root 1367848 Jun 21 14:25 bash -rwxr-xr-x 3 root root 38280 Jul 20 2020 bunzip2 -rwxr-xr-x 3 root root 38280 Jul 20 2020 bzcat lrwxrwxrwx 1 root root 6 Jul 20 2020 bzcmp -> bzdiff -rwxr-xr-x 1 root root 2225 Jul 20 2020 bzdiff lrwxrwxrwx 1 root root 6 Jul 20 2020 bzegrep -> bzgrep -rwxr-xr-x 1 root root 4877 Sep 4 2019 bzexe lrwxrwxrwx 1 root root 6 Jul 20 2020 bzfgrep -> bzgrep -rwxr-xr-x 1 root root 3775 Jul 20 2020 bzgrep -rwxr-xr-x 3 root root 38280 Jul 20 2020 bzip2 -rwxr-xr-x 1 root root 17768 Jul 20 2020 bzip2recover lrwxrwxrwx 1 root root 6 Jul 20 2020 bzless -> bzmore -rwxr-xr-x 1 root root 1297 Jul 20 2020 bzmore -rwxr-xr-x 1 root root 38824 Sep 22 2020 cat -rwxr-xr-x 1 root root 71624 Sep 22 2020 chgrp -rwxr-xr-x 1 root root 67528 Sep 22 2020 chmod -rwxr-xr-x 1 root root 75752 Sep 22 2020 chown -rwxr-xr-x 1 root root 157960 Sep 22 2020 cp -rwxr-xr-x 1 root root 128724 Dec 10 2020 dash -rwxr-xr-x 1 root root 124904 Sep 22 2020 date -rwxr-xr-x 1 root root 92172 Sep 22 2020 dd -rwxr-xr-x 1 root root 100752 Sep 22 2020 df -rwxr-xr-x 1 root root 153964 Sep 22 2020 dir -rwxr-xr-x 1 root root 83644 Feb 7 02:38 dmesg lrwxrwxrwx 1 root root 8 Nov 6 2019 dnsdomainname -> hostname lrwxrwxrwx 1 root root 8 Nov 6 2019 domainname -> hostname -rwxr-xr-x 1 root root 34664 Sep 22 2020 echo -rwxr-xr-x 1 root root 28 Nov 9 2020 egrep -rwxr-xr-x 1 root root 34664 Sep 22 2020 false -rwxr-xr-x 1 root root 28 Nov 9 2020 fgrep -rwxr-xr-x 1 root root 71928 Feb 7 02:38 findmnt -rwsr-xr-x 1 root root 30112 Feb 26 04:12 fusermount -rwxr-xr-x 1 root root 210488 Nov 9 2020 grep -rwxr-xr-x 2 root root 2346 Mar 2 11:30 gunzip -rwxr-xr-x 1 root root 6376 Mar 2 11:30 gzexe -rwxr-xr-x 1 root root 100952 Mar 2 11:30 gzip -rwxr-xr-x 1 root root 21916 Nov 6 2019 hostname -rwxr-xr-x 1 root root 83980 Sep 22 2020 ln -rwxr-xr-x 1 root root 55572 Feb 7 2020 login -rwxr-xr-x 1 root root 153964 Sep 22 2020 ls -rwxr-xr-x 1 root root 153124 Feb 7 02:38 lsblk -rwxr-xr-x 1 root root 96328 Sep 22 2020 mkdir -rwxr-xr-x 1 root root 79912 Sep 22 2020 mknod -rwxr-xr-x 1 root root 47048 Sep 22 2020 mktemp -rwxr-xr-x 1 root root 58920 Feb 7 02:38 more -rwsr-xr-x 1 root root 50720 Feb 7 02:38 mount -rwxr-xr-x 1 root root 13856 Feb 7 02:38 mountpoint -rwxr-xr-x 1 root root 157996 Sep 22 2020 mv lrwxrwxrwx 1 root root 8 Nov 6 2019 nisdomainname -> hostname lrwxrwxrwx 1 root root 14 Apr 18 03:38 pidof -> /sbin/killall5 -rwxr-xr-x 1 root root 38824 Sep 22 2020 pwd lrwxrwxrwx 1 root root 4 Jun 21 14:25 rbash -> bash -rwxr-xr-x 1 root root 46984 Sep 22 2020 readlink -rwxr-xr-x 1 root root 75720 Sep 22 2020 rm -rwxr-xr-x 1 root root 46984 Sep 22 2020 rmdir -rwxr-xr-x 1 root root 22292 Sep 27 2020 run-parts -rwxr-xr-x 1 root root 125036 Dec 22 2018 sed lrwxrwxrwx 1 root root 4 Jun 23 21:25 sh -> dash -rwxr-xr-x 1 root root 34696 Sep 22 2020 sleep -rwxr-xr-x 1 root root 83880 Sep 22 2020 stty -rwsr-xr-x 1 root root 79396 Feb 7 02:38 su -rwxr-xr-x 1 root root 34696 Sep 22 2020 sync -rwxr-xr-x 1 root root 602584 Feb 16 21:55 tar -rwxr-xr-x 1 root root 13860 Sep 27 2020 tempfile -rwxr-xr-x 1 root root 108520 Sep 22 2020 touch -rwxr-xr-x 1 root root 34664 Sep 22 2020 true -rwxr-xr-x 1 root root 17768 Feb 26 04:12 ulockmgr_server -rwsr-xr-x 1 root root 30236 Feb 7 02:38 umount -rwxr-xr-x 1 root root 34664 Sep 22 2020 uname -rwxr-xr-x 2 root root 2346 Mar 2 11:30 uncompress -rwxr-xr-x 1 root root 153964 Sep 22 2020 vdir -rwxr-xr-x 1 root root 63024 Feb 7 02:38 wdctl lrwxrwxrwx 1 root root 8 Nov 6 2019 ypdomainname -> hostname -rwxr-xr-x 1 root root 1984 Mar 2 11:30 zcat -rwxr-xr-x 1 root root 1678 Mar 2 11:30 zcmp -rwxr-xr-x 1 root root 5880 Mar 2 11:30 zdiff -rwxr-xr-x 1 root root 29 Mar 2 11:30 zegrep -rwxr-xr-x 1 root root 29 Mar 2 11:30 zfgrep -rwxr-xr-x 1 root root 2081 Mar 2 11:30 zforce -rwxr-xr-x 1 root root 7585 Mar 2 11:30 zgrep -rwxr-xr-x 1 root root 2206 Mar 2 11:30 zless -rwxr-xr-x 1 root root 1842 Mar 2 11:30 zmore -rwxr-xr-x 1 root root 4553 Mar 2 11:30 znew I: user script /srv/workspace/pbuilder/4293/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: i386 Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 12), python3, markdown, zlib1g-dev dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19675 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 12); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on python3; however: Package python3 is not installed. pbuilder-satisfydepends-dummy depends on markdown; however: Package markdown is not installed. pbuilder-satisfydepends-dummy depends on zlib1g-dev; however: Package zlib1g-dev is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} automake{a} autopoint{a} autotools-dev{a} bsdextrautils{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} gettext{a} gettext-base{a} groff-base{a} intltool-debian{a} libarchive-zip-perl{a} libdebhelper-perl{a} libelf1{a} libexpat1{a} libfile-stripnondeterminism-perl{a} libicu67{a} libmagic-mgc{a} libmagic1{a} libmpdec3{a} libpipeline1{a} libpython3-stdlib{a} libpython3.9-minimal{a} libpython3.9-stdlib{a} libreadline8{a} libsigsegv2{a} libsub-override-perl{a} libtool{a} libuchardet0{a} libxml2{a} m4{a} man-db{a} markdown{a} media-types{a} po-debconf{a} python3{a} python3-minimal{a} python3.9{a} python3.9-minimal{a} readline-common{a} sensible-utils{a} zlib1g-dev{a} The following packages are RECOMMENDED but will NOT be installed: ca-certificates curl libarchive-cpio-perl libltdl-dev libmail-sendmail-perl lynx wget 0 packages upgraded, 45 newly installed, 0 to remove and 0 not upgraded. Need to get 24.3 MB of archives. After unpacking 89.4 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian bullseye/main i386 bsdextrautils i386 2.36.1-7 [148 kB] Get: 2 http://deb.debian.org/debian bullseye/main i386 libuchardet0 i386 0.0.7-1 [67.9 kB] Get: 3 http://deb.debian.org/debian bullseye/main i386 groff-base i386 1.22.4-6 [952 kB] Get: 4 http://deb.debian.org/debian bullseye/main i386 libpipeline1 i386 1.5.3-1 [36.8 kB] Get: 5 http://deb.debian.org/debian bullseye/main i386 man-db i386 2.9.4-2 [1367 kB] Get: 6 http://deb.debian.org/debian bullseye/main i386 libpython3.9-minimal i386 3.9.2-1 [801 kB] Get: 7 http://deb.debian.org/debian bullseye/main i386 libexpat1 i386 2.2.10-2 [98.8 kB] Get: 8 http://deb.debian.org/debian bullseye/main i386 python3.9-minimal i386 3.9.2-1 [1956 kB] Get: 9 http://deb.debian.org/debian bullseye/main i386 python3-minimal i386 3.9.2-3 [38.2 kB] Get: 10 http://deb.debian.org/debian bullseye/main i386 media-types all 4.0.0 [30.3 kB] Get: 11 http://deb.debian.org/debian bullseye/main i386 libmpdec3 i386 2.5.1-1 [91.9 kB] Get: 12 http://deb.debian.org/debian bullseye/main i386 readline-common all 8.1-1 [73.7 kB] Get: 13 http://deb.debian.org/debian bullseye/main i386 libreadline8 i386 8.1-1 [173 kB] Get: 14 http://deb.debian.org/debian bullseye/main i386 libpython3.9-stdlib i386 3.9.2-1 [1703 kB] Get: 15 http://deb.debian.org/debian bullseye/main i386 python3.9 i386 3.9.2-1 [466 kB] Get: 16 http://deb.debian.org/debian bullseye/main i386 libpython3-stdlib i386 3.9.2-3 [21.4 kB] Get: 17 http://deb.debian.org/debian bullseye/main i386 python3 i386 3.9.2-3 [37.9 kB] Get: 18 http://deb.debian.org/debian bullseye/main i386 sensible-utils all 0.0.14 [14.8 kB] Get: 19 http://deb.debian.org/debian bullseye/main i386 libmagic-mgc i386 1:5.39-3 [273 kB] Get: 20 http://deb.debian.org/debian bullseye/main i386 libmagic1 i386 1:5.39-3 [133 kB] Get: 21 http://deb.debian.org/debian bullseye/main i386 file i386 1:5.39-3 [69.0 kB] Get: 22 http://deb.debian.org/debian bullseye/main i386 gettext-base i386 0.21-4 [176 kB] Get: 23 http://deb.debian.org/debian bullseye/main i386 libsigsegv2 i386 2.13-1 [35.1 kB] Get: 24 http://deb.debian.org/debian bullseye/main i386 m4 i386 1.4.18-5 [206 kB] Get: 25 http://deb.debian.org/debian bullseye/main i386 autoconf all 2.69-14 [313 kB] Get: 26 http://deb.debian.org/debian bullseye/main i386 autotools-dev all 20180224.1+nmu1 [77.1 kB] Get: 27 http://deb.debian.org/debian bullseye/main i386 automake all 1:1.16.3-2 [814 kB] Get: 28 http://deb.debian.org/debian bullseye/main i386 autopoint all 0.21-4 [510 kB] Get: 29 http://deb.debian.org/debian bullseye/main i386 libdebhelper-perl all 13.3.4 [189 kB] Get: 30 http://deb.debian.org/debian bullseye/main i386 libtool all 2.4.6-15 [513 kB] Get: 31 http://deb.debian.org/debian bullseye/main i386 dh-autoreconf all 20 [17.1 kB] Get: 32 http://deb.debian.org/debian bullseye/main i386 libarchive-zip-perl all 1.68-1 [104 kB] Get: 33 http://deb.debian.org/debian bullseye/main i386 libsub-override-perl all 0.09-2 [10.2 kB] Get: 34 http://deb.debian.org/debian bullseye/main i386 libfile-stripnondeterminism-perl all 1.11.0-1 [25.6 kB] Get: 35 http://deb.debian.org/debian bullseye/main i386 dh-strip-nondeterminism all 1.11.0-1 [15.3 kB] Get: 36 http://deb.debian.org/debian bullseye/main i386 libelf1 i386 0.183-1 [171 kB] Get: 37 http://deb.debian.org/debian bullseye/main i386 dwz i386 0.13+20210201-1 [179 kB] Get: 38 http://deb.debian.org/debian bullseye/main i386 libicu67 i386 67.1-6 [8776 kB] Get: 39 http://deb.debian.org/debian bullseye/main i386 libxml2 i386 2.9.10+dfsg-6.7 [728 kB] Get: 40 http://deb.debian.org/debian bullseye/main i386 gettext i386 0.21-4 [1322 kB] Get: 41 http://deb.debian.org/debian bullseye/main i386 intltool-debian all 0.35.0+20060710.5 [26.8 kB] Get: 42 http://deb.debian.org/debian bullseye/main i386 po-debconf all 1.0.21+nmu1 [248 kB] Get: 43 http://deb.debian.org/debian bullseye/main i386 debhelper all 13.3.4 [1049 kB] Get: 44 http://deb.debian.org/debian bullseye/main i386 markdown all 1.0.1-10.1 [17.5 kB] Get: 45 http://deb.debian.org/debian bullseye/main i386 zlib1g-dev i386 1:1.2.11.dfsg-2 [194 kB] Fetched 24.3 MB in 8s (3081 kB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package bsdextrautils. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19675 files and directories currently installed.) Preparing to unpack .../0-bsdextrautils_2.36.1-7_i386.deb ... Unpacking bsdextrautils (2.36.1-7) ... Selecting previously unselected package libuchardet0:i386. Preparing to unpack .../1-libuchardet0_0.0.7-1_i386.deb ... Unpacking libuchardet0:i386 (0.0.7-1) ... Selecting previously unselected package groff-base. Preparing to unpack .../2-groff-base_1.22.4-6_i386.deb ... Unpacking groff-base (1.22.4-6) ... Selecting previously unselected package libpipeline1:i386. Preparing to unpack .../3-libpipeline1_1.5.3-1_i386.deb ... Unpacking libpipeline1:i386 (1.5.3-1) ... Selecting previously unselected package man-db. Preparing to unpack .../4-man-db_2.9.4-2_i386.deb ... Unpacking man-db (2.9.4-2) ... Selecting previously unselected package libpython3.9-minimal:i386. Preparing to unpack .../5-libpython3.9-minimal_3.9.2-1_i386.deb ... Unpacking libpython3.9-minimal:i386 (3.9.2-1) ... Selecting previously unselected package libexpat1:i386. Preparing to unpack .../6-libexpat1_2.2.10-2_i386.deb ... Unpacking libexpat1:i386 (2.2.10-2) ... Selecting previously unselected package python3.9-minimal. Preparing to unpack .../7-python3.9-minimal_3.9.2-1_i386.deb ... Unpacking python3.9-minimal (3.9.2-1) ... Setting up libpython3.9-minimal:i386 (3.9.2-1) ... Setting up libexpat1:i386 (2.2.10-2) ... Setting up python3.9-minimal (3.9.2-1) ... Selecting previously unselected package python3-minimal. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20542 files and directories currently installed.) Preparing to unpack .../0-python3-minimal_3.9.2-3_i386.deb ... Unpacking python3-minimal (3.9.2-3) ... Selecting previously unselected package media-types. Preparing to unpack .../1-media-types_4.0.0_all.deb ... Unpacking media-types (4.0.0) ... Selecting previously unselected package libmpdec3:i386. Preparing to unpack .../2-libmpdec3_2.5.1-1_i386.deb ... Unpacking libmpdec3:i386 (2.5.1-1) ... Selecting previously unselected package readline-common. Preparing to unpack .../3-readline-common_8.1-1_all.deb ... Unpacking readline-common (8.1-1) ... Selecting previously unselected package libreadline8:i386. Preparing to unpack .../4-libreadline8_8.1-1_i386.deb ... Unpacking libreadline8:i386 (8.1-1) ... Selecting previously unselected package libpython3.9-stdlib:i386. Preparing to unpack .../5-libpython3.9-stdlib_3.9.2-1_i386.deb ... Unpacking libpython3.9-stdlib:i386 (3.9.2-1) ... Selecting previously unselected package python3.9. Preparing to unpack .../6-python3.9_3.9.2-1_i386.deb ... Unpacking python3.9 (3.9.2-1) ... Selecting previously unselected package libpython3-stdlib:i386. Preparing to unpack .../7-libpython3-stdlib_3.9.2-3_i386.deb ... Unpacking libpython3-stdlib:i386 (3.9.2-3) ... Setting up python3-minimal (3.9.2-3) ... Selecting previously unselected package python3. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20963 files and directories currently installed.) Preparing to unpack .../00-python3_3.9.2-3_i386.deb ... Unpacking python3 (3.9.2-3) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../01-sensible-utils_0.0.14_all.deb ... Unpacking sensible-utils (0.0.14) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../02-libmagic-mgc_1%3a5.39-3_i386.deb ... Unpacking libmagic-mgc (1:5.39-3) ... Selecting previously unselected package libmagic1:i386. Preparing to unpack .../03-libmagic1_1%3a5.39-3_i386.deb ... Unpacking libmagic1:i386 (1:5.39-3) ... Selecting previously unselected package file. Preparing to unpack .../04-file_1%3a5.39-3_i386.deb ... Unpacking file (1:5.39-3) ... Selecting previously unselected package gettext-base. Preparing to unpack .../05-gettext-base_0.21-4_i386.deb ... Unpacking gettext-base (0.21-4) ... Selecting previously unselected package libsigsegv2:i386. Preparing to unpack .../06-libsigsegv2_2.13-1_i386.deb ... Unpacking libsigsegv2:i386 (2.13-1) ... Selecting previously unselected package m4. Preparing to unpack .../07-m4_1.4.18-5_i386.deb ... Unpacking m4 (1.4.18-5) ... Selecting previously unselected package autoconf. Preparing to unpack .../08-autoconf_2.69-14_all.deb ... Unpacking autoconf (2.69-14) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../09-autotools-dev_20180224.1+nmu1_all.deb ... Unpacking autotools-dev (20180224.1+nmu1) ... Selecting previously unselected package automake. Preparing to unpack .../10-automake_1%3a1.16.3-2_all.deb ... Unpacking automake (1:1.16.3-2) ... Selecting previously unselected package autopoint. Preparing to unpack .../11-autopoint_0.21-4_all.deb ... Unpacking autopoint (0.21-4) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../12-libdebhelper-perl_13.3.4_all.deb ... Unpacking libdebhelper-perl (13.3.4) ... Selecting previously unselected package libtool. Preparing to unpack .../13-libtool_2.4.6-15_all.deb ... Unpacking libtool (2.4.6-15) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../14-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../15-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libsub-override-perl. Preparing to unpack .../16-libsub-override-perl_0.09-2_all.deb ... Unpacking libsub-override-perl (0.09-2) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../17-libfile-stripnondeterminism-perl_1.11.0-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.11.0-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../18-dh-strip-nondeterminism_1.11.0-1_all.deb ... Unpacking dh-strip-nondeterminism (1.11.0-1) ... Selecting previously unselected package libelf1:i386. Preparing to unpack .../19-libelf1_0.183-1_i386.deb ... Unpacking libelf1:i386 (0.183-1) ... Selecting previously unselected package dwz. Preparing to unpack .../20-dwz_0.13+20210201-1_i386.deb ... Unpacking dwz (0.13+20210201-1) ... Selecting previously unselected package libicu67:i386. Preparing to unpack .../21-libicu67_67.1-6_i386.deb ... Unpacking libicu67:i386 (67.1-6) ... Selecting previously unselected package libxml2:i386. Preparing to unpack .../22-libxml2_2.9.10+dfsg-6.7_i386.deb ... Unpacking libxml2:i386 (2.9.10+dfsg-6.7) ... Selecting previously unselected package gettext. Preparing to unpack .../23-gettext_0.21-4_i386.deb ... Unpacking gettext (0.21-4) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../24-intltool-debian_0.35.0+20060710.5_all.deb ... Unpacking intltool-debian (0.35.0+20060710.5) ... Selecting previously unselected package po-debconf. Preparing to unpack .../25-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../26-debhelper_13.3.4_all.deb ... Unpacking debhelper (13.3.4) ... Selecting previously unselected package markdown. Preparing to unpack .../27-markdown_1.0.1-10.1_all.deb ... Unpacking markdown (1.0.1-10.1) ... Selecting previously unselected package zlib1g-dev:i386. Preparing to unpack .../28-zlib1g-dev_1%3a1.2.11.dfsg-2_i386.deb ... Unpacking zlib1g-dev:i386 (1:1.2.11.dfsg-2) ... Setting up media-types (4.0.0) ... Setting up libpipeline1:i386 (1.5.3-1) ... Setting up bsdextrautils (2.36.1-7) ... update-alternatives: using /usr/bin/write.ul to provide /usr/bin/write (write) in auto mode Setting up libicu67:i386 (67.1-6) ... Setting up libmagic-mgc (1:5.39-3) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libdebhelper-perl (13.3.4) ... Setting up libmagic1:i386 (1:5.39-3) ... Setting up gettext-base (0.21-4) ... Setting up file (1:5.39-3) ... Setting up autotools-dev (20180224.1+nmu1) ... Setting up libsigsegv2:i386 (2.13-1) ... Setting up autopoint (0.21-4) ... Setting up zlib1g-dev:i386 (1:1.2.11.dfsg-2) ... Setting up sensible-utils (0.0.14) ... Setting up libuchardet0:i386 (0.0.7-1) ... Setting up libmpdec3:i386 (2.5.1-1) ... Setting up libsub-override-perl (0.09-2) ... Setting up libelf1:i386 (0.183-1) ... Setting up readline-common (8.1-1) ... Setting up libxml2:i386 (2.9.10+dfsg-6.7) ... Setting up markdown (1.0.1-10.1) ... Setting up libfile-stripnondeterminism-perl (1.11.0-1) ... Setting up gettext (0.21-4) ... Setting up libtool (2.4.6-15) ... Setting up libreadline8:i386 (8.1-1) ... Setting up m4 (1.4.18-5) ... Setting up intltool-debian (0.35.0+20060710.5) ... Setting up autoconf (2.69-14) ... Setting up dh-strip-nondeterminism (1.11.0-1) ... Setting up dwz (0.13+20210201-1) ... Setting up groff-base (1.22.4-6) ... Setting up libpython3.9-stdlib:i386 (3.9.2-1) ... Setting up libpython3-stdlib:i386 (3.9.2-3) ... Setting up automake (1:1.16.3-2) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up po-debconf (1.0.21+nmu1) ... Setting up man-db (2.9.4-2) ... Not building database; man-db/auto-update is not 'true'. Setting up dh-autoreconf (20) ... Setting up python3.9 (3.9.2-1) ... Setting up debhelper (13.3.4) ... Setting up python3 (3.9.2-3) ... Processing triggers for libc-bin (2.31-12) ... Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps Reading package lists... Building dependency tree... Reading state information... fakeroot is already the newest version (1.25.3-1.1). 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. I: Building the package I: Running cd /build/seqprep-1.3.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b dpkg-buildpackage: info: source package seqprep dpkg-buildpackage: info: source version 1.3.2-5 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Andreas Tille dpkg-source --before-build . dpkg-buildpackage: info: host architecture i386 fakeroot debian/rules clean dh clean dh_auto_clean make -j10 clean make[1]: Entering directory '/build/seqprep-1.3.2' rm -f SeqPrep.o utils.o stdaln.o SeqPrep make[1]: Leaving directory '/build/seqprep-1.3.2' debian/rules override_dh_clean make[1]: Entering directory '/build/seqprep-1.3.2' dh_clean rm -f seqprep rm -f README.html make[1]: Leaving directory '/build/seqprep-1.3.2' debian/rules build dh build dh_update_autotools_config dh_autoreconf dh_auto_configure debian/rules override_dh_auto_build make[1]: Entering directory '/build/seqprep-1.3.2' dh_auto_build make -j10 "INSTALL=install --strip-program=true" make[2]: Entering directory '/build/seqprep-1.3.2' cc -g -O2 -fdebug-prefix-map=/build/seqprep-1.3.2=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 SeqPrep.c -o SeqPrep.o cc -g -O2 -fdebug-prefix-map=/build/seqprep-1.3.2=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 utils.c -o utils.o cc -g -O2 -fdebug-prefix-map=/build/seqprep-1.3.2=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 stdaln.c -o stdaln.o SeqPrep.c: In function 'main': SeqPrep.c:166:15: warning: implicit declaration of function 'getopt' [-Wimplicit-function-declaration] 166 | while( (ich=getopt( argc, argv, "f:r:1:2:3:4:q:A:s:y:B:O:E:x:M:N:L:o:m:b:w:W:p:P:X:Q:t:e:Z:n:S6ghz" )) != -1 ) { | ^~~~~~ cc SeqPrep.o utils.o stdaln.o -Wl,-z,relro -Wl,-z,now -lz -lm -o SeqPrep make[2]: Leaving directory '/build/seqprep-1.3.2' cp SeqPrep seqprep markdown README.md > README.html make[1]: Leaving directory '/build/seqprep-1.3.2' debian/rules override_dh_auto_test make[1]: Entering directory '/build/seqprep-1.3.2' # This checks that the tests run and produce byte-identical results. cd Test && mkdir -p out info && \ bash -xc 'gzcat(){ zcat "$@" ; } ; . RUNTEST.sh' + . RUNTEST.sh ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_merged_1.fastq.gz -2 ./out/pe_bad_contam_merged_2.fastq.gz -s ./out/pe_bad_contam_merged_s.fastq.gz -E ./info/alignments_merged.txt.gz Pairs Processed: 0 Pairs Merged: 14314 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.368656 ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_trimmed_1.fastq.gz -2 ./out/pe_bad_contam_trimmed_2.fastq.gz -E ./info/alignments_trimmed.txt.gz Pairs Processed: 0 Pairs Merged: 0 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.355490 ++ prog=gzcat ++ gzcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ zcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ zcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_1.fastq.gz ++ zcat ./out/pe_bad_contam_merged_1.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_2.fastq.gz ++ zcat ./out/pe_bad_contam_merged_2.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_s.fastq.gz ++ zcat ./out/pe_bad_contam_merged_s.fastq.gz ++ python3 seqlens.py [ `cat Test/info/pe_*.txt | md5sum | cut -b -10` = 8bc8e0787e ] # remove output dirs right after testing to make sure the files # will not be included in the data package rm -rf Test/info Test/out make[1]: Leaving directory '/build/seqprep-1.3.2' create-stamp debian/debhelper-build-stamp fakeroot debian/rules binary dh binary dh_testroot dh_prep dh_auto_install make -j10 install DESTDIR=/build/seqprep-1.3.2/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[1]: Entering directory '/build/seqprep-1.3.2' cp SeqPrep /nonexistent/first-build/bin cp: cannot create regular file '/nonexistent/first-build/bin': No such file or directory make[1]: [Makefile:15: install] Error 1 (ignored) make[1]: Leaving directory '/build/seqprep-1.3.2' debian/rules override_dh_install-indep make[1]: Entering directory '/build/seqprep-1.3.2' dh_install sed -i 's#../SeqPrep#/usr/bin/seqprep#' /build/seqprep-1.3.2/debian/seqprep-data/usr/share/doc/seqprep/examples/RUNTEST.sh make[1]: Leaving directory '/build/seqprep-1.3.2' dh_install -Nseqprep-data dh_installdocs dh_installchangelogs dh_installman dh_perl dh_link dh_strip_nondeterminism dh_compress dh_fixperms dh_missing dh_dwz dh_strip dh_makeshlibs dh_shlibdeps dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'seqprep-data' in '../seqprep-data_1.3.2-5_all.deb'. dpkg-deb: building package 'seqprep' in '../seqprep_1.3.2-5_i386.deb'. dpkg-deb: building package 'seqprep-dbgsym' in '../seqprep-dbgsym_1.3.2-5_i386.deb'. dpkg-genbuildinfo --build=binary dpkg-genchanges --build=binary >../seqprep_1.3.2-5_i386.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) I: copying local configuration I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/4293 and its subdirectories I: Current time: Thu Jun 24 05:42:26 -12 2021 I: pbuilder-time-stamp: 1624556546 Thu Jun 24 17:42:28 UTC 2021 I: 1st build successful. Starting 2nd build on remote node ionos16-i386.debian.net. Thu Jun 24 17:42:28 UTC 2021 I: Preparing to do remote build '2' on ionos16-i386.debian.net. Thu Jun 24 17:43:35 UTC 2021 I: Deleting $TMPDIR on ionos16-i386.debian.net. Thu Jun 24 17:43:36 UTC 2021 I: seqprep_1.3.2-5_i386.changes: Format: 1.8 Date: Mon, 20 Jan 2020 11:31:59 +0100 Source: seqprep Binary: seqprep seqprep-data seqprep-dbgsym Architecture: all i386 Version: 1.3.2-5 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team Changed-By: Andreas Tille Description: seqprep - stripping adaptors and/or merging paired reads of DNA sequences w seqprep-data - example data set for seqprep - only used for testing Closes: 938467 Changes: seqprep (1.3.2-5) unstable; urgency=medium . * Test-Depends: s/python/python3/ Closes: #938467 * Set upstream metadata fields: Bug-Submit. Checksums-Sha1: f9958eb47ae2e29340f30fd9a4b3cce969e94f8b 35860104 seqprep-data_1.3.2-5_all.deb 8fc2227ada016e46f96497662531892304dd48cf 18400 seqprep-dbgsym_1.3.2-5_i386.deb e81bf692dc5576041c24b6c58bb923500f5e9795 5591 seqprep_1.3.2-5_i386.buildinfo fdda0f8f50cdc86434364839459b5e96afd2878e 28408 seqprep_1.3.2-5_i386.deb Checksums-Sha256: 8fd3a1795235bf1230a762f6fbdb28f0d5778b8a96cb9e613235714ad035a5eb 35860104 seqprep-data_1.3.2-5_all.deb ab1ba594c7306863fa278834cca4ae8ddedddd0a5b18a4956bea753100de6553 18400 seqprep-dbgsym_1.3.2-5_i386.deb 803530eed4a19bbedc4b845b39111d18bcd9f7c06464a7de5c29031f02f619ab 5591 seqprep_1.3.2-5_i386.buildinfo 9694f37557745e79fbe65a605c3c9a37cc006de2dee5fe0e7f76f5a7c5768dd1 28408 seqprep_1.3.2-5_i386.deb Files: e1d40e2e4b9a193e4a338d46c8b4e8ee 35860104 science optional seqprep-data_1.3.2-5_all.deb 4e78e9a8a4259d27f04b830c860be9b7 18400 debug optional seqprep-dbgsym_1.3.2-5_i386.deb c771adc092e0049f7e7053cae4281b19 5591 science optional seqprep_1.3.2-5_i386.buildinfo 7cf8ce99d146e69cd74acd3a053f1170 28408 science optional seqprep_1.3.2-5_i386.deb Thu Jun 24 17:43:38 UTC 2021 I: diffoscope 172 will be used to compare the two builds: # Profiling output for: /usr/bin/diffoscope --html /srv/reproducible-results/rbuild-debian/tmp.ZPOHa0PMA8/seqprep_1.3.2-5.diffoscope.html --text /srv/reproducible-results/rbuild-debian/tmp.ZPOHa0PMA8/seqprep_1.3.2-5.diffoscope.txt --json /srv/reproducible-results/rbuild-debian/tmp.ZPOHa0PMA8/seqprep_1.3.2-5.diffoscope.json --profile=- /srv/reproducible-results/rbuild-debian/tmp.ZPOHa0PMA8/b1/seqprep_1.3.2-5_i386.changes /srv/reproducible-results/rbuild-debian/tmp.ZPOHa0PMA8/b2/seqprep_1.3.2-5_i386.changes ## command (total time: 0.000s) 0.000s 1 call cmp (internal) ## has_same_content_as (total time: 0.000s) 0.000s 1 call abc.DotChangesFile ## main (total time: 1.286s) 1.286s 2 calls outputs 0.000s 1 call cleanup ## recognizes (total time: 0.411s) 0.411s 10 calls diffoscope.comparators.binary.FilesystemFile 0.000s 8 calls abc.DotChangesFile Thu Jun 24 17:43:44 UTC 2021 I: diffoscope 172 found no differences in the changes files, and a .buildinfo file also exists. Thu Jun 24 17:43:44 UTC 2021 I: seqprep from bullseye built successfully and reproducibly on i386. Thu Jun 24 17:43:46 UTC 2021 I: Submitting .buildinfo files to external archives: Thu Jun 24 17:43:46 UTC 2021 I: Submitting 8.0K b1/seqprep_1.3.2-5_i386.buildinfo.asc Thu Jun 24 17:43:48 UTC 2021 I: Submitting 8.0K b2/seqprep_1.3.2-5_i386.buildinfo.asc Thu Jun 24 17:43:51 UTC 2021 I: Done submitting .buildinfo files to http://buildinfo.debian.net/api/submit. Thu Jun 24 17:43:51 UTC 2021 I: Done submitting .buildinfo files. Thu Jun 24 17:43:51 UTC 2021 I: Removing signed seqprep_1.3.2-5_i386.buildinfo.asc files: removed './b1/seqprep_1.3.2-5_i386.buildinfo.asc' removed './b2/seqprep_1.3.2-5_i386.buildinfo.asc'