Sun Aug 15 10:54:00 UTC 2021 I: starting to build seqprep/bullseye/arm64 on jenkins on '2021-08-15 10:53' Sun Aug 15 10:54:00 UTC 2021 I: The jenkins build log is/was available at https://jenkins.debian.net/userContent/reproducible/debian/build_service/arm64_18/25375/console.log Sun Aug 15 10:54:00 UTC 2021 I: Downloading source for bullseye/seqprep=1.3.2-5 --2021-08-15 10:54:01-- http://cdn-fastly.deb.debian.org/debian/pool/main/s/seqprep/seqprep_1.3.2-5.dsc Connecting to 78.137.99.97:3128... connected. Proxy request sent, awaiting response... 200 OK Length: 2108 (2.1K) Saving to: ‘seqprep_1.3.2-5.dsc’ 0K .. 100% 216M=0s 2021-08-15 10:54:01 (216 MB/s) - ‘seqprep_1.3.2-5.dsc’ saved [2108/2108] Sun Aug 15 10:54:01 UTC 2021 I: seqprep_1.3.2-5.dsc -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA256 Format: 3.0 (quilt) Source: seqprep Binary: seqprep, seqprep-data Architecture: any all Version: 1.3.2-5 Maintainer: Debian Med Packaging Team Uploaders: Tim Booth , Andreas Tille Homepage: http://seqanswers.com/wiki/SeqPrep Standards-Version: 4.4.1 Vcs-Browser: https://salsa.debian.org/med-team/seqprep Vcs-Git: https://salsa.debian.org/med-team/seqprep.git Testsuite: autopkgtest Testsuite-Triggers: python3 Build-Depends: debhelper-compat (= 12), python3, markdown, zlib1g-dev Package-List: seqprep deb science optional arch=any seqprep-data deb science optional arch=all Checksums-Sha1: 9f533e1fd14d310ba0ccd4ef38c3abc55b8fc5fd 37177540 seqprep_1.3.2.orig.tar.gz 7a2452878a6ba5bc671f65b4449db8efa4ea8f08 10876 seqprep_1.3.2-5.debian.tar.xz Checksums-Sha256: 2b8a462a0e0a3e51f70be7730dc77b1f2bb69e74845dd0fbd2110a921c32265a 37177540 seqprep_1.3.2.orig.tar.gz 2d647e7e61cb314254e0cc00fc568e6f03120760d0b3cada27c946bb7f1d6dfb 10876 seqprep_1.3.2-5.debian.tar.xz Files: b6a4f5491dfdb0ce38bf791454151468 37177540 seqprep_1.3.2.orig.tar.gz f75fda0d0aebd9ba722baeca487ec6b4 10876 seqprep_1.3.2-5.debian.tar.xz -----BEGIN PGP SIGNATURE----- iQJFBAEBCAAvFiEE8fAHMgoDVUHwpmPKV4oElNHGRtEFAl4lhOMRHHRpbGxlQGRl Ymlhbi5vcmcACgkQV4oElNHGRtE5Cw/+IiBu2hW8AoIFTk3bAeoibOShlx/gmid0 cAlhquWkGlTEycHM0FV5H5vhdHAiBcHsnxqgehcHVGT/YIUIrGBukzHRie0cNr4o dEKMaZo4xB4fr44Vncm5xrsYje/r+2zI+77EuhWtV6drjgnUZWzLcmP6ATpiy3FD zzEofxFDeHlEM2oReAbaNDTqTAuUkXOIhx05Ls12AigcQjpOCWWQiKlk6YxUlec8 Ek7YlQQKaa0iYO+3OCG976wluFoqWS6TerTJfwdj+5QaGjNpp2tT5qEdeEM86S+r 4KMY1bGXuoOQlFh9K++wLyXnZXRA10ho0HNV2hv8AxF2huJnBZduL8m/ihFty+kU AhuHGie6uJ0EAv0p6uD3nqPLD8s474B+PolOLtVAOTlUYP8o54ACQF7IaDQv1DoB z/gWxygPgW7Qf1+TU/WJQTTwLYb0VCClffOrzf7N46jCiuc/iOni4sdNXECF4c+z RC9iYSsYGUlhpXVIXFVDXtJnd9YFdrCCjY0cqk4jn4Cw59Y/vL3weTKDkevWjLYi M5ga4DnRW6EsBV2uqxDyX3esfv/XyE1T+lnIPZkvaN5YYubif2bYlyrBUm/R3jnG yMRH/xXSFftJGanb+SFXsNw3L1WQKlWefOp0VPfjKxJCBzOs5qlX0ayo5AZPaMFX VFHk2GNvx3s= =XQep -----END PGP SIGNATURE----- Sun Aug 15 10:54:01 UTC 2021 I: Checking whether the package is not for us Sun Aug 15 10:54:01 UTC 2021 I: Starting 1st build on remote node codethink13-arm64.debian.net. Sun Aug 15 10:54:01 UTC 2021 I: Preparing to do remote build '1' on codethink13-arm64.debian.net. Sun Aug 15 10:57:09 UTC 2021 I: Deleting $TMPDIR on codethink13-arm64.debian.net. I: pbuilder: network access will be disabled during build I: Current time: Sat Sep 17 05:17:13 -12 2022 I: pbuilder-time-stamp: 1663435033 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/bullseye-reproducible-base.tgz] I: copying local configuration I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: Copying source file I: copying [seqprep_1.3.2-5.dsc] I: copying [./seqprep_1.3.2.orig.tar.gz] I: copying [./seqprep_1.3.2-5.debian.tar.xz] I: Extracting source gpgv: unknown type of key resource 'trustedkeys.kbx' gpgv: keyblock resource '/tmp/dpkg-verify-sig.JBsmAhwM/trustedkeys.kbx': General error gpgv: Signature made Sun Jan 19 22:45:55 2020 -12 gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 gpgv: issuer "tille@debian.org" gpgv: Can't check signature: No public key dpkg-source: warning: failed to verify signature on ./seqprep_1.3.2-5.dsc dpkg-source: info: extracting seqprep in seqprep-1.3.2 dpkg-source: info: unpacking seqprep_1.3.2.orig.tar.gz dpkg-source: info: unpacking seqprep_1.3.2-5.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying fix_unused_variable_errors.patch dpkg-source: info: applying hardening.patch dpkg-source: info: applying replace-float-with-double.patch dpkg-source: info: applying 2to3.patch I: using fakeroot in build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/6788/tmp/hooks/D02_print_environment starting I: set BUILDDIR='/build' BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' BUILDUSERNAME='pbuilder1' BUILD_ARCH='arm64' DEBIAN_FRONTEND='noninteractive' DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all,-fixfilepath parallel=8' DISTRIBUTION='' HOME='/var/lib/jenkins' HOST_ARCH='arm64' IFS=' ' LANG='C' LANGUAGE='en_US:en' LC_ALL='C' MAIL='/var/mail/root' OPTIND='1' PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' PBCURRENTCOMMANDLINEOPERATION='build' PBUILDER_OPERATION='build' PBUILDER_PKGDATADIR='/usr/share/pbuilder' PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' PBUILDER_SYSCONFDIR='/etc' PPID='6788' PS1='# ' PS2='> ' PS4='+ ' PWD='/' SHELL='/bin/bash' SHLVL='2' SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/tmp.8CegjswzkH/pbuilderrc_68sB --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/bullseye-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/tmp.8CegjswzkH/b1 --logfile b1/build.log seqprep_1.3.2-5.dsc' SUDO_GID='117' SUDO_UID='110' SUDO_USER='jenkins' TERM='unknown' TZ='/usr/share/zoneinfo/Etc/GMT+12' USER='root' USERNAME='root' _='/usr/bin/systemd-run' http_proxy='http://192.168.101.16:3128' I: uname -a Linux codethink13-arm64 4.15.0-153-generic #160-Ubuntu SMP Thu Jul 29 07:06:07 UTC 2021 aarch64 GNU/Linux I: ls -l /bin total 5252 -rwxr-xr-x 1 root root 1282512 Aug 4 2021 bash -rwxr-xr-x 3 root root 34808 Jul 20 2020 bunzip2 -rwxr-xr-x 3 root root 34808 Jul 20 2020 bzcat lrwxrwxrwx 1 root root 6 Jul 20 2020 bzcmp -> bzdiff -rwxr-xr-x 1 root root 2225 Jul 20 2020 bzdiff lrwxrwxrwx 1 root root 6 Jul 20 2020 bzegrep -> bzgrep -rwxr-xr-x 1 root root 4877 Sep 4 2019 bzexe lrwxrwxrwx 1 root root 6 Jul 20 2020 bzfgrep -> bzgrep -rwxr-xr-x 1 root root 3775 Jul 20 2020 bzgrep -rwxr-xr-x 3 root root 34808 Jul 20 2020 bzip2 -rwxr-xr-x 1 root root 14264 Jul 20 2020 bzip2recover lrwxrwxrwx 1 root root 6 Jul 20 2020 bzless -> bzmore -rwxr-xr-x 1 root root 1297 Jul 20 2020 bzmore -rwxr-xr-x 1 root root 39832 Sep 22 2020 cat -rwxr-xr-x 1 root root 64512 Sep 22 2020 chgrp -rwxr-xr-x 1 root root 60368 Sep 22 2020 chmod -rwxr-xr-x 1 root root 64528 Sep 22 2020 chown -rwxr-xr-x 1 root root 138896 Sep 22 2020 cp -rwxr-xr-x 1 root root 129544 Dec 10 2020 dash -rwxr-xr-x 1 root root 101384 Sep 22 2020 date -rwxr-xr-x 1 root root 80984 Sep 22 2020 dd -rwxr-xr-x 1 root root 89824 Sep 22 2020 df -rwxr-xr-x 1 root root 143088 Sep 22 2020 dir -rwxr-xr-x 1 root root 76152 Jul 28 2021 dmesg lrwxrwxrwx 1 root root 8 Nov 6 2019 dnsdomainname -> hostname lrwxrwxrwx 1 root root 8 Nov 6 2019 domainname -> hostname -rwxr-xr-x 1 root root 35632 Sep 22 2020 echo -rwxr-xr-x 1 root root 28 Nov 9 2020 egrep -rwxr-xr-x 1 root root 31512 Sep 22 2020 false -rwxr-xr-x 1 root root 28 Nov 9 2020 fgrep -rwxr-xr-x 1 root root 64856 Jul 28 2021 findmnt -rwsr-xr-x 1 root root 34824 Feb 26 2021 fusermount -rwxr-xr-x 1 root root 178400 Nov 9 2020 grep -rwxr-xr-x 2 root root 2346 Mar 2 2021 gunzip -rwxr-xr-x 1 root root 6376 Mar 2 2021 gzexe -rwxr-xr-x 1 root root 93744 Mar 2 2021 gzip -rwxr-xr-x 1 root root 18440 Nov 6 2019 hostname -rwxr-xr-x 1 root root 68720 Sep 22 2020 ln -rwxr-xr-x 1 root root 52720 Feb 7 2020 login -rwxr-xr-x 1 root root 143088 Sep 22 2020 ls -rwxr-xr-x 1 root root 161960 Jul 28 2021 lsblk -rwxr-xr-x 1 root root 85200 Sep 22 2020 mkdir -rwxr-xr-x 1 root root 68744 Sep 22 2020 mknod -rwxr-xr-x 1 root root 43976 Sep 22 2020 mktemp -rwxr-xr-x 1 root root 51368 Jul 28 2021 more -rwsr-xr-x 1 root root 51360 Jul 28 2021 mount -rwxr-xr-x 1 root root 14496 Jul 28 2021 mountpoint -rwxr-xr-x 1 root root 134808 Sep 22 2020 mv lrwxrwxrwx 1 root root 8 Nov 6 2019 nisdomainname -> hostname lrwxrwxrwx 1 root root 14 Apr 18 2021 pidof -> /sbin/killall5 -rwxr-xr-x 1 root root 35720 Sep 22 2020 pwd lrwxrwxrwx 1 root root 4 Aug 4 2021 rbash -> bash -rwxr-xr-x 1 root root 43872 Sep 22 2020 readlink -rwxr-xr-x 1 root root 68592 Sep 22 2020 rm -rwxr-xr-x 1 root root 43880 Sep 22 2020 rmdir -rwxr-xr-x 1 root root 19208 Sep 27 2020 run-parts -rwxr-xr-x 1 root root 114016 Dec 22 2018 sed lrwxrwxrwx 1 root root 4 Sep 17 03:48 sh -> dash -rwxr-xr-x 1 root root 35656 Sep 22 2020 sleep -rwxr-xr-x 1 root root 72640 Sep 22 2020 stty -rwsr-xr-x 1 root root 67776 Jul 28 2021 su -rwxr-xr-x 1 root root 35672 Sep 22 2020 sync -rwxr-xr-x 1 root root 535768 Feb 16 2021 tar -rwxr-xr-x 1 root root 10568 Sep 27 2020 tempfile -rwxr-xr-x 1 root root 89120 Sep 22 2020 touch -rwxr-xr-x 1 root root 31512 Sep 22 2020 true -rwxr-xr-x 1 root root 14264 Feb 26 2021 ulockmgr_server -rwsr-xr-x 1 root root 30880 Jul 28 2021 umount -rwxr-xr-x 1 root root 35640 Sep 22 2020 uname -rwxr-xr-x 2 root root 2346 Mar 2 2021 uncompress -rwxr-xr-x 1 root root 143088 Sep 22 2020 vdir -rwxr-xr-x 1 root root 59584 Jul 28 2021 wdctl lrwxrwxrwx 1 root root 8 Nov 6 2019 ypdomainname -> hostname -rwxr-xr-x 1 root root 1984 Mar 2 2021 zcat -rwxr-xr-x 1 root root 1678 Mar 2 2021 zcmp -rwxr-xr-x 1 root root 5880 Mar 2 2021 zdiff -rwxr-xr-x 1 root root 29 Mar 2 2021 zegrep -rwxr-xr-x 1 root root 29 Mar 2 2021 zfgrep -rwxr-xr-x 1 root root 2081 Mar 2 2021 zforce -rwxr-xr-x 1 root root 7585 Mar 2 2021 zgrep -rwxr-xr-x 1 root root 2206 Mar 2 2021 zless -rwxr-xr-x 1 root root 1842 Mar 2 2021 zmore -rwxr-xr-x 1 root root 4553 Mar 2 2021 znew I: user script /srv/workspace/pbuilder/6788/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: arm64 Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 12), python3, markdown, zlib1g-dev dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19646 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 12); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on python3; however: Package python3 is not installed. pbuilder-satisfydepends-dummy depends on markdown; however: Package markdown is not installed. pbuilder-satisfydepends-dummy depends on zlib1g-dev; however: Package zlib1g-dev is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} automake{a} autopoint{a} autotools-dev{a} bsdextrautils{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} gettext{a} gettext-base{a} groff-base{a} intltool-debian{a} libarchive-zip-perl{a} libdebhelper-perl{a} libelf1{a} libexpat1{a} libfile-stripnondeterminism-perl{a} libicu67{a} libmagic-mgc{a} libmagic1{a} libmpdec3{a} libpipeline1{a} libpython3-stdlib{a} libpython3.9-minimal{a} libpython3.9-stdlib{a} libreadline8{a} libsigsegv2{a} libsub-override-perl{a} libtool{a} libuchardet0{a} libxml2{a} m4{a} man-db{a} markdown{a} media-types{a} po-debconf{a} python3{a} python3-minimal{a} python3.9{a} python3.9-minimal{a} readline-common{a} sensible-utils{a} zlib1g-dev{a} The following packages are RECOMMENDED but will NOT be installed: ca-certificates curl libarchive-cpio-perl libltdl-dev libmail-sendmail-perl lynx wget 0 packages upgraded, 45 newly installed, 0 to remove and 0 not upgraded. Need to get 23.5 MB of archives. After unpacking 88.5 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian bullseye/main arm64 bsdextrautils arm64 2.36.1-8 [142 kB] Get: 2 http://deb.debian.org/debian bullseye/main arm64 libuchardet0 arm64 0.0.7-1 [67.9 kB] Get: 3 http://deb.debian.org/debian bullseye/main arm64 groff-base arm64 1.22.4-6 [883 kB] Get: 4 http://deb.debian.org/debian bullseye/main arm64 libpipeline1 arm64 1.5.3-1 [33.0 kB] Get: 5 http://deb.debian.org/debian bullseye/main arm64 man-db arm64 2.9.4-2 [1336 kB] Get: 6 http://deb.debian.org/debian bullseye/main arm64 libpython3.9-minimal arm64 3.9.2-1 [797 kB] Get: 7 http://deb.debian.org/debian bullseye/main arm64 libexpat1 arm64 2.2.10-2 [83.1 kB] Get: 8 http://deb.debian.org/debian bullseye/main arm64 python3.9-minimal arm64 3.9.2-1 [1884 kB] Get: 9 http://deb.debian.org/debian bullseye/main arm64 python3-minimal arm64 3.9.2-3 [38.2 kB] Get: 10 http://deb.debian.org/debian bullseye/main arm64 media-types all 4.0.0 [30.3 kB] Get: 11 http://deb.debian.org/debian bullseye/main arm64 libmpdec3 arm64 2.5.1-1 [84.4 kB] Get: 12 http://deb.debian.org/debian bullseye/main arm64 readline-common all 8.1-1 [73.7 kB] Get: 13 http://deb.debian.org/debian bullseye/main arm64 libreadline8 arm64 8.1-1 [160 kB] Get: 14 http://deb.debian.org/debian bullseye/main arm64 libpython3.9-stdlib arm64 3.9.2-1 [1658 kB] Get: 15 http://deb.debian.org/debian bullseye/main arm64 python3.9 arm64 3.9.2-1 [466 kB] Get: 16 http://deb.debian.org/debian bullseye/main arm64 libpython3-stdlib arm64 3.9.2-3 [21.4 kB] Get: 17 http://deb.debian.org/debian bullseye/main arm64 python3 arm64 3.9.2-3 [37.9 kB] Get: 18 http://deb.debian.org/debian bullseye/main arm64 sensible-utils all 0.0.14 [14.8 kB] Get: 19 http://deb.debian.org/debian bullseye/main arm64 libmagic-mgc arm64 1:5.39-3 [273 kB] Get: 20 http://deb.debian.org/debian bullseye/main arm64 libmagic1 arm64 1:5.39-3 [121 kB] Get: 21 http://deb.debian.org/debian bullseye/main arm64 file arm64 1:5.39-3 [69.1 kB] Get: 22 http://deb.debian.org/debian bullseye/main arm64 gettext-base arm64 0.21-4 [173 kB] Get: 23 http://deb.debian.org/debian bullseye/main arm64 libsigsegv2 arm64 2.13-1 [34.7 kB] Get: 24 http://deb.debian.org/debian bullseye/main arm64 m4 arm64 1.4.18-5 [199 kB] Get: 25 http://deb.debian.org/debian bullseye/main arm64 autoconf all 2.69-14 [313 kB] Get: 26 http://deb.debian.org/debian bullseye/main arm64 autotools-dev all 20180224.1+nmu1 [77.1 kB] Get: 27 http://deb.debian.org/debian bullseye/main arm64 automake all 1:1.16.3-2 [814 kB] Get: 28 http://deb.debian.org/debian bullseye/main arm64 autopoint all 0.21-4 [510 kB] Get: 29 http://deb.debian.org/debian bullseye/main arm64 libdebhelper-perl all 13.3.4 [189 kB] Get: 30 http://deb.debian.org/debian bullseye/main arm64 libtool all 2.4.6-15 [513 kB] Get: 31 http://deb.debian.org/debian bullseye/main arm64 dh-autoreconf all 20 [17.1 kB] Get: 32 http://deb.debian.org/debian bullseye/main arm64 libarchive-zip-perl all 1.68-1 [104 kB] Get: 33 http://deb.debian.org/debian bullseye/main arm64 libsub-override-perl all 0.09-2 [10.2 kB] Get: 34 http://deb.debian.org/debian bullseye/main arm64 libfile-stripnondeterminism-perl all 1.12.0-1 [26.3 kB] Get: 35 http://deb.debian.org/debian bullseye/main arm64 dh-strip-nondeterminism all 1.12.0-1 [15.4 kB] Get: 36 http://deb.debian.org/debian bullseye/main arm64 libelf1 arm64 0.183-1 [164 kB] Get: 37 http://deb.debian.org/debian bullseye/main arm64 dwz arm64 0.13+20210201-1 [155 kB] Get: 38 http://deb.debian.org/debian bullseye/main arm64 libicu67 arm64 67.1-7 [8467 kB] Get: 39 http://deb.debian.org/debian bullseye/main arm64 libxml2 arm64 2.9.10+dfsg-6.7 [629 kB] Get: 40 http://deb.debian.org/debian bullseye/main arm64 gettext arm64 0.21-4 [1261 kB] Get: 41 http://deb.debian.org/debian bullseye/main arm64 intltool-debian all 0.35.0+20060710.5 [26.8 kB] Get: 42 http://deb.debian.org/debian bullseye/main arm64 po-debconf all 1.0.21+nmu1 [248 kB] Get: 43 http://deb.debian.org/debian bullseye/main arm64 debhelper all 13.3.4 [1049 kB] Get: 44 http://deb.debian.org/debian bullseye/main arm64 markdown all 1.0.1-10.1 [17.5 kB] Get: 45 http://deb.debian.org/debian bullseye/main arm64 zlib1g-dev arm64 1:1.2.11.dfsg-2 [189 kB] Fetched 23.5 MB in 1s (41.6 MB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package bsdextrautils. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19646 files and directories currently installed.) Preparing to unpack .../0-bsdextrautils_2.36.1-8_arm64.deb ... Unpacking bsdextrautils (2.36.1-8) ... Selecting previously unselected package libuchardet0:arm64. Preparing to unpack .../1-libuchardet0_0.0.7-1_arm64.deb ... Unpacking libuchardet0:arm64 (0.0.7-1) ... Selecting previously unselected package groff-base. Preparing to unpack .../2-groff-base_1.22.4-6_arm64.deb ... Unpacking groff-base (1.22.4-6) ... Selecting previously unselected package libpipeline1:arm64. Preparing to unpack .../3-libpipeline1_1.5.3-1_arm64.deb ... Unpacking libpipeline1:arm64 (1.5.3-1) ... Selecting previously unselected package man-db. Preparing to unpack .../4-man-db_2.9.4-2_arm64.deb ... Unpacking man-db (2.9.4-2) ... Selecting previously unselected package libpython3.9-minimal:arm64. Preparing to unpack .../5-libpython3.9-minimal_3.9.2-1_arm64.deb ... Unpacking libpython3.9-minimal:arm64 (3.9.2-1) ... Selecting previously unselected package libexpat1:arm64. Preparing to unpack .../6-libexpat1_2.2.10-2_arm64.deb ... Unpacking libexpat1:arm64 (2.2.10-2) ... Selecting previously unselected package python3.9-minimal. Preparing to unpack .../7-python3.9-minimal_3.9.2-1_arm64.deb ... Unpacking python3.9-minimal (3.9.2-1) ... Setting up libpython3.9-minimal:arm64 (3.9.2-1) ... Setting up libexpat1:arm64 (2.2.10-2) ... Setting up python3.9-minimal (3.9.2-1) ... Selecting previously unselected package python3-minimal. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20513 files and directories currently installed.) Preparing to unpack .../0-python3-minimal_3.9.2-3_arm64.deb ... Unpacking python3-minimal (3.9.2-3) ... Selecting previously unselected package media-types. Preparing to unpack .../1-media-types_4.0.0_all.deb ... Unpacking media-types (4.0.0) ... Selecting previously unselected package libmpdec3:arm64. Preparing to unpack .../2-libmpdec3_2.5.1-1_arm64.deb ... Unpacking libmpdec3:arm64 (2.5.1-1) ... Selecting previously unselected package readline-common. Preparing to unpack .../3-readline-common_8.1-1_all.deb ... Unpacking readline-common (8.1-1) ... Selecting previously unselected package libreadline8:arm64. Preparing to unpack .../4-libreadline8_8.1-1_arm64.deb ... Unpacking libreadline8:arm64 (8.1-1) ... Selecting previously unselected package libpython3.9-stdlib:arm64. Preparing to unpack .../5-libpython3.9-stdlib_3.9.2-1_arm64.deb ... Unpacking libpython3.9-stdlib:arm64 (3.9.2-1) ... Selecting previously unselected package python3.9. Preparing to unpack .../6-python3.9_3.9.2-1_arm64.deb ... Unpacking python3.9 (3.9.2-1) ... Selecting previously unselected package libpython3-stdlib:arm64. Preparing to unpack .../7-libpython3-stdlib_3.9.2-3_arm64.deb ... Unpacking libpython3-stdlib:arm64 (3.9.2-3) ... Setting up python3-minimal (3.9.2-3) ... Selecting previously unselected package python3. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20934 files and directories currently installed.) Preparing to unpack .../00-python3_3.9.2-3_arm64.deb ... Unpacking python3 (3.9.2-3) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../01-sensible-utils_0.0.14_all.deb ... Unpacking sensible-utils (0.0.14) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../02-libmagic-mgc_1%3a5.39-3_arm64.deb ... Unpacking libmagic-mgc (1:5.39-3) ... Selecting previously unselected package libmagic1:arm64. Preparing to unpack .../03-libmagic1_1%3a5.39-3_arm64.deb ... Unpacking libmagic1:arm64 (1:5.39-3) ... Selecting previously unselected package file. Preparing to unpack .../04-file_1%3a5.39-3_arm64.deb ... Unpacking file (1:5.39-3) ... Selecting previously unselected package gettext-base. Preparing to unpack .../05-gettext-base_0.21-4_arm64.deb ... Unpacking gettext-base (0.21-4) ... Selecting previously unselected package libsigsegv2:arm64. Preparing to unpack .../06-libsigsegv2_2.13-1_arm64.deb ... Unpacking libsigsegv2:arm64 (2.13-1) ... Selecting previously unselected package m4. Preparing to unpack .../07-m4_1.4.18-5_arm64.deb ... Unpacking m4 (1.4.18-5) ... Selecting previously unselected package autoconf. Preparing to unpack .../08-autoconf_2.69-14_all.deb ... Unpacking autoconf (2.69-14) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../09-autotools-dev_20180224.1+nmu1_all.deb ... Unpacking autotools-dev (20180224.1+nmu1) ... Selecting previously unselected package automake. Preparing to unpack .../10-automake_1%3a1.16.3-2_all.deb ... Unpacking automake (1:1.16.3-2) ... Selecting previously unselected package autopoint. Preparing to unpack .../11-autopoint_0.21-4_all.deb ... Unpacking autopoint (0.21-4) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../12-libdebhelper-perl_13.3.4_all.deb ... Unpacking libdebhelper-perl (13.3.4) ... Selecting previously unselected package libtool. Preparing to unpack .../13-libtool_2.4.6-15_all.deb ... Unpacking libtool (2.4.6-15) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../14-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../15-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libsub-override-perl. Preparing to unpack .../16-libsub-override-perl_0.09-2_all.deb ... Unpacking libsub-override-perl (0.09-2) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../17-libfile-stripnondeterminism-perl_1.12.0-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.12.0-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../18-dh-strip-nondeterminism_1.12.0-1_all.deb ... Unpacking dh-strip-nondeterminism (1.12.0-1) ... Selecting previously unselected package libelf1:arm64. Preparing to unpack .../19-libelf1_0.183-1_arm64.deb ... Unpacking libelf1:arm64 (0.183-1) ... Selecting previously unselected package dwz. Preparing to unpack .../20-dwz_0.13+20210201-1_arm64.deb ... Unpacking dwz (0.13+20210201-1) ... Selecting previously unselected package libicu67:arm64. Preparing to unpack .../21-libicu67_67.1-7_arm64.deb ... Unpacking libicu67:arm64 (67.1-7) ... Selecting previously unselected package libxml2:arm64. Preparing to unpack .../22-libxml2_2.9.10+dfsg-6.7_arm64.deb ... Unpacking libxml2:arm64 (2.9.10+dfsg-6.7) ... Selecting previously unselected package gettext. Preparing to unpack .../23-gettext_0.21-4_arm64.deb ... Unpacking gettext (0.21-4) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../24-intltool-debian_0.35.0+20060710.5_all.deb ... Unpacking intltool-debian (0.35.0+20060710.5) ... Selecting previously unselected package po-debconf. Preparing to unpack .../25-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../26-debhelper_13.3.4_all.deb ... Unpacking debhelper (13.3.4) ... Selecting previously unselected package markdown. Preparing to unpack .../27-markdown_1.0.1-10.1_all.deb ... Unpacking markdown (1.0.1-10.1) ... Selecting previously unselected package zlib1g-dev:arm64. Preparing to unpack .../28-zlib1g-dev_1%3a1.2.11.dfsg-2_arm64.deb ... Unpacking zlib1g-dev:arm64 (1:1.2.11.dfsg-2) ... Setting up media-types (4.0.0) ... Setting up libpipeline1:arm64 (1.5.3-1) ... Setting up bsdextrautils (2.36.1-8) ... update-alternatives: using /usr/bin/write.ul to provide /usr/bin/write (write) in auto mode Setting up libicu67:arm64 (67.1-7) ... Setting up libmagic-mgc (1:5.39-3) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libdebhelper-perl (13.3.4) ... Setting up libmagic1:arm64 (1:5.39-3) ... Setting up gettext-base (0.21-4) ... Setting up file (1:5.39-3) ... Setting up autotools-dev (20180224.1+nmu1) ... Setting up libsigsegv2:arm64 (2.13-1) ... Setting up autopoint (0.21-4) ... Setting up zlib1g-dev:arm64 (1:1.2.11.dfsg-2) ... Setting up sensible-utils (0.0.14) ... Setting up libuchardet0:arm64 (0.0.7-1) ... Setting up libmpdec3:arm64 (2.5.1-1) ... Setting up libsub-override-perl (0.09-2) ... Setting up libelf1:arm64 (0.183-1) ... Setting up readline-common (8.1-1) ... Setting up libxml2:arm64 (2.9.10+dfsg-6.7) ... Setting up markdown (1.0.1-10.1) ... Setting up libfile-stripnondeterminism-perl (1.12.0-1) ... Setting up gettext (0.21-4) ... Setting up libtool (2.4.6-15) ... Setting up libreadline8:arm64 (8.1-1) ... Setting up m4 (1.4.18-5) ... Setting up intltool-debian (0.35.0+20060710.5) ... Setting up autoconf (2.69-14) ... Setting up dh-strip-nondeterminism (1.12.0-1) ... Setting up dwz (0.13+20210201-1) ... Setting up groff-base (1.22.4-6) ... Setting up libpython3.9-stdlib:arm64 (3.9.2-1) ... Setting up libpython3-stdlib:arm64 (3.9.2-3) ... Setting up automake (1:1.16.3-2) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up po-debconf (1.0.21+nmu1) ... Setting up man-db (2.9.4-2) ... Not building database; man-db/auto-update is not 'true'. Setting up dh-autoreconf (20) ... Setting up python3.9 (3.9.2-1) ... Setting up debhelper (13.3.4) ... Setting up python3 (3.9.2-3) ... Processing triggers for libc-bin (2.31-13) ... Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps Reading package lists... Building dependency tree... Reading state information... fakeroot is already the newest version (1.25.3-1.1). 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. I: Building the package I: Running cd /build/seqprep-1.3.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../seqprep_1.3.2-5_source.changes dpkg-buildpackage: info: source package seqprep dpkg-buildpackage: info: source version 1.3.2-5 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Andreas Tille dpkg-source --before-build . dpkg-buildpackage: info: host architecture arm64 fakeroot debian/rules clean dh clean dh_auto_clean make -j8 clean make[1]: Entering directory '/build/seqprep-1.3.2' rm -f SeqPrep.o utils.o stdaln.o SeqPrep make[1]: Leaving directory '/build/seqprep-1.3.2' debian/rules override_dh_clean make[1]: Entering directory '/build/seqprep-1.3.2' dh_clean rm -f seqprep rm -f README.html make[1]: Leaving directory '/build/seqprep-1.3.2' debian/rules build dh build dh_update_autotools_config dh_autoreconf dh_auto_configure debian/rules override_dh_auto_build make[1]: Entering directory '/build/seqprep-1.3.2' dh_auto_build make -j8 "INSTALL=install --strip-program=true" make[2]: Entering directory '/build/seqprep-1.3.2' cc -g -O2 -fdebug-prefix-map=/build/seqprep-1.3.2=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 SeqPrep.c -o SeqPrep.o cc -g -O2 -fdebug-prefix-map=/build/seqprep-1.3.2=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 utils.c -o utils.o cc -g -O2 -fdebug-prefix-map=/build/seqprep-1.3.2=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 stdaln.c -o stdaln.o SeqPrep.c: In function 'main': SeqPrep.c:166:15: warning: implicit declaration of function 'getopt' [-Wimplicit-function-declaration] 166 | while( (ich=getopt( argc, argv, "f:r:1:2:3:4:q:A:s:y:B:O:E:x:M:N:L:o:m:b:w:W:p:P:X:Q:t:e:Z:n:S6ghz" )) != -1 ) { | ^~~~~~ cc SeqPrep.o utils.o stdaln.o -Wl,-z,relro -Wl,-z,now -lz -lm -o SeqPrep make[2]: Leaving directory '/build/seqprep-1.3.2' cp SeqPrep seqprep markdown README.md > README.html make[1]: Leaving directory '/build/seqprep-1.3.2' debian/rules override_dh_auto_test make[1]: Entering directory '/build/seqprep-1.3.2' # This checks that the tests run and produce byte-identical results. cd Test && mkdir -p out info && \ bash -xc 'gzcat(){ zcat "$@" ; } ; . RUNTEST.sh' + . RUNTEST.sh ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_merged_1.fastq.gz -2 ./out/pe_bad_contam_merged_2.fastq.gz -s ./out/pe_bad_contam_merged_s.fastq.gz -E ./info/alignments_merged.txt.gz fastq record not beginning with @ fastq record not beginning with @ Pairs Processed: 0 Pairs Merged: 14314 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.550620 ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_trimmed_1.fastq.gz -2 ./out/pe_bad_contam_trimmed_2.fastq.gz -E ./info/alignments_trimmed.txt.gz fastq record not beginning with @ fastq record not beginning with @ Pairs Processed: 0 Pairs Merged: 0 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.520567 ++ prog=gzcat ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ zcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ gzcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ zcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_1.fastq.gz ++ python3 seqlens.py ++ zcat ./out/pe_bad_contam_merged_1.fastq.gz ++ gzcat ./out/pe_bad_contam_merged_2.fastq.gz ++ zcat ./out/pe_bad_contam_merged_2.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_s.fastq.gz ++ python3 seqlens.py ++ zcat ./out/pe_bad_contam_merged_s.fastq.gz [ `cat Test/info/pe_*.txt | md5sum | cut -b -10` = 8bc8e0787e ] # remove output dirs right after testing to make sure the files # will not be included in the data package rm -rf Test/info Test/out make[1]: Leaving directory '/build/seqprep-1.3.2' create-stamp debian/debhelper-build-stamp fakeroot debian/rules binary dh binary dh_testroot dh_prep dh_auto_install make -j8 install DESTDIR=/build/seqprep-1.3.2/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[1]: Entering directory '/build/seqprep-1.3.2' cp SeqPrep /nonexistent/first-build/bin cp: cannot create regular file '/nonexistent/first-build/bin': No such file or directory make[1]: [Makefile:15: install] Error 1 (ignored) make[1]: Leaving directory '/build/seqprep-1.3.2' debian/rules override_dh_install-indep make[1]: Entering directory '/build/seqprep-1.3.2' dh_install sed -i 's#../SeqPrep#/usr/bin/seqprep#' /build/seqprep-1.3.2/debian/seqprep-data/usr/share/doc/seqprep/examples/RUNTEST.sh make[1]: Leaving directory '/build/seqprep-1.3.2' dh_install -Nseqprep-data dh_installdocs dh_installchangelogs dh_installman dh_perl dh_link dh_strip_nondeterminism dh_compress dh_fixperms dh_missing dh_dwz dh_strip dh_makeshlibs dh_shlibdeps dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'seqprep' in '../seqprep_1.3.2-5_arm64.deb'. dpkg-deb: building package 'seqprep-data' in '../seqprep-data_1.3.2-5_all.deb'. dpkg-deb: building package 'seqprep-dbgsym' in '../seqprep-dbgsym_1.3.2-5_arm64.deb'. dpkg-genbuildinfo --build=binary dpkg-genchanges --build=binary >../seqprep_1.3.2-5_arm64.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/6788 and its subdirectories I: Current time: Sat Sep 17 05:20:05 -12 2022 I: pbuilder-time-stamp: 1663435205 Sun Aug 15 10:57:10 UTC 2021 I: 1st build successful. Starting 2nd build on remote node codethink12-arm64.debian.net. Sun Aug 15 10:57:10 UTC 2021 I: Preparing to do remote build '2' on codethink12-arm64.debian.net. Sun Aug 15 11:00:15 UTC 2021 I: Deleting $TMPDIR on codethink12-arm64.debian.net. Sun Aug 15 11:00:15 UTC 2021 I: seqprep_1.3.2-5_arm64.changes: Format: 1.8 Date: Mon, 20 Jan 2020 11:31:59 +0100 Source: seqprep Binary: seqprep seqprep-data seqprep-dbgsym Architecture: all arm64 Version: 1.3.2-5 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team Changed-By: Andreas Tille Description: seqprep - stripping adaptors and/or merging paired reads of DNA sequences w seqprep-data - example data set for seqprep - only used for testing Closes: 938467 Changes: seqprep (1.3.2-5) unstable; urgency=medium . * Test-Depends: s/python/python3/ Closes: #938467 * Set upstream metadata fields: Bug-Submit. Checksums-Sha1: f9958eb47ae2e29340f30fd9a4b3cce969e94f8b 35860104 seqprep-data_1.3.2-5_all.deb 2effc91cb7c4e987a3b0594e88a83e5159a03ac4 17564 seqprep-dbgsym_1.3.2-5_arm64.deb 1e6bb6bc1ff0fa4269976f2d76df9269891e234e 5588 seqprep_1.3.2-5_arm64.buildinfo e6a767b360258a985408a7765e8dc481e07ebddf 27072 seqprep_1.3.2-5_arm64.deb Checksums-Sha256: 8fd3a1795235bf1230a762f6fbdb28f0d5778b8a96cb9e613235714ad035a5eb 35860104 seqprep-data_1.3.2-5_all.deb f075d55ae0ee173c22dfaab9cfc3e99b90180b52da539fad6339a275cda79aee 17564 seqprep-dbgsym_1.3.2-5_arm64.deb e10e519b7861ff125f6cdf4e111687db67b31a92c696530b08009533c42e8123 5588 seqprep_1.3.2-5_arm64.buildinfo 724bedd3626d6aff802883ca25c2da6514028d2e4ab848f108ba2333e6f1daf0 27072 seqprep_1.3.2-5_arm64.deb Files: e1d40e2e4b9a193e4a338d46c8b4e8ee 35860104 science optional seqprep-data_1.3.2-5_all.deb 142efc2a336a9d99cef304e64a9bc763 17564 debug optional seqprep-dbgsym_1.3.2-5_arm64.deb 9deaedb3d6d05e3be5aae104e969e072 5588 science optional seqprep_1.3.2-5_arm64.buildinfo b4a3bcfea0ed87dfb2c0b46766e5d23e 27072 science optional seqprep_1.3.2-5_arm64.deb Sun Aug 15 11:00:16 UTC 2021 I: diffoscope 177 will be used to compare the two builds: # Profiling output for: /usr/bin/diffoscope --html /srv/reproducible-results/rbuild-debian/tmp.8CegjswzkH/seqprep_1.3.2-5.diffoscope.html --text /srv/reproducible-results/rbuild-debian/tmp.8CegjswzkH/seqprep_1.3.2-5.diffoscope.txt --json /srv/reproducible-results/rbuild-debian/tmp.8CegjswzkH/seqprep_1.3.2-5.diffoscope.json --profile=- /srv/reproducible-results/rbuild-debian/tmp.8CegjswzkH/b1/seqprep_1.3.2-5_arm64.changes /srv/reproducible-results/rbuild-debian/tmp.8CegjswzkH/b2/seqprep_1.3.2-5_arm64.changes ## command (total time: 0.000s) 0.000s 1 call cmp (internal) ## has_same_content_as (total time: 0.000s) 0.000s 1 call abc.DotChangesFile ## main (total time: 0.563s) 0.563s 2 calls outputs 0.000s 1 call cleanup ## recognizes (total time: 0.323s) 0.323s 10 calls diffoscope.comparators.binary.FilesystemFile 0.000s 8 calls abc.DotChangesFile Sun Aug 15 11:00:19 UTC 2021 I: diffoscope 177 found no differences in the changes files, and a .buildinfo file also exists. Sun Aug 15 11:00:19 UTC 2021 I: seqprep from bullseye built successfully and reproducibly on arm64. Sun Aug 15 11:00:20 UTC 2021 I: Submitting .buildinfo files to external archives: Sun Aug 15 11:00:20 UTC 2021 I: Submitting 8.0K b1/seqprep_1.3.2-5_arm64.buildinfo.asc Sun Aug 15 11:00:21 UTC 2021 I: Submitting 8.0K b2/seqprep_1.3.2-5_arm64.buildinfo.asc Sun Aug 15 11:00:22 UTC 2021 I: Done submitting .buildinfo files to http://buildinfo.debian.net/api/submit. Sun Aug 15 11:00:22 UTC 2021 I: Done submitting .buildinfo files. Sun Aug 15 11:00:22 UTC 2021 I: Removing signed seqprep_1.3.2-5_arm64.buildinfo.asc files: removed './b1/seqprep_1.3.2-5_arm64.buildinfo.asc' removed './b2/seqprep_1.3.2-5_arm64.buildinfo.asc'