Sat Dec 25 22:22:16 UTC 2021 I: starting to build dawg/bullseye/amd64 on jenkins on '2021-12-25 22:22' Sat Dec 25 22:22:16 UTC 2021 I: The jenkins build log is/was available at https://jenkins.debian.net/userContent/reproducible/debian/build_service/amd64_16/94347/console.log Sat Dec 25 22:22:16 UTC 2021 I: Downloading source for bullseye/dawg=1.2-3 --2021-12-25 22:22:16-- http://cdn-fastly.deb.debian.org/debian/pool/main/d/dawg/dawg_1.2-3.dsc Connecting to 78.137.99.97:3128... connected. Proxy request sent, awaiting response... 200 OK Length: 1928 (1.9K) Saving to: ‘dawg_1.2-3.dsc’ 0K . 100% 105M=0s 2021-12-25 22:22:16 (105 MB/s) - ‘dawg_1.2-3.dsc’ saved [1928/1928] Sat Dec 25 22:22:16 UTC 2021 I: dawg_1.2-3.dsc -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA512 Format: 3.0 (quilt) Source: dawg Binary: dawg Architecture: any Version: 1.2-3 Maintainer: Debian Med Packaging Team Uploaders: Kevin Murray Homepage: https://github.com/reedacartwright/dawg Standards-Version: 4.5.0 Vcs-Browser: https://salsa.debian.org/med-team/dawg Vcs-Git: https://salsa.debian.org/med-team/dawg.git Testsuite: autopkgtest Build-Depends: debhelper-compat (= 13), cmake, bison, flex Package-List: dawg deb science optional arch=any Checksums-Sha1: f2a15e75bc7ccaa180f92e8ec14bf3b5f936b678 180312 dawg_1.2.orig.tar.gz f87be7d2f1277746e639cb9883c223761f229f8c 7748 dawg_1.2-3.debian.tar.xz Checksums-Sha256: 0034d77309e538b34a395916326818a1a0d37cad789819178a905daabb41c9fe 180312 dawg_1.2.orig.tar.gz 3a0b5b47abf65c566f517669096cd05eaa461fcb6b5a6d3b9a2042508876db51 7748 dawg_1.2-3.debian.tar.xz Files: 369a26a5c7a905acefb566cfcb4270b9 180312 dawg_1.2.orig.tar.gz cd2ffb0f66ecdf75366f242fc9db9546 7748 dawg_1.2-3.debian.tar.xz -----BEGIN PGP SIGNATURE----- iQJFBAEBCgAvFiEE8fAHMgoDVUHwpmPKV4oElNHGRtEFAl+yRsoRHHRpbGxlQGRl Ymlhbi5vcmcACgkQV4oElNHGRtELrA//a5IF33zdbZv8QWsctaM2oAjoTOy+mW/3 ols3eaIg2mRe1QciCumOmLOAlsJAfbhxyluzRxgU0tdPGtv1I+pNgxCuQ7i4BZlE flMKIJ/qKXYf8lCh27WF2edubwtaX8XbHSP7fm2GnP1jgJhJijtQBoE0BR8GoSk7 E5iAPlaZ5LmiW0/EA5qFKvx7j3+t5cvpSQrEPvHj7KDWCjNXRNjwWIL9IzkG0ofN V76wrnf2vSZFWR1ZJc1/Qxb/J6tG+dRbHBHtzffiwbfPuSkuOyfovYdyLF66+ADv /4HdcQXHQVnhNYyPvyhNInFlFVn5ZNMts3802utYXCANraS7TDjHzq94Oa+WS6B0 EMRyOVDfijDASFxfjWv4Rch7yULiIMqNbBmcea+to8X3sb2+rXFHhNXcfMNev50y Q4GD4F1Wkxu0X237bJrYiIV1AtNtnS/lsQNi11+8dkoJvmUf+WM1aev7JfQXsFe7 mmDRDox3gE7rusgmRguNkuD/XnhHDlyuzpx/CKurDibICKcd0iPYLZQxFEFixMZ9 MwrhJqavdBQ1Sw/bBetjBkMLSsQqpNQmi6qpgxJl1P98vM9Q/rQo8ee+ZzkdBH8F 28w7FtIaFQWNoeDxbZyxARTtH+APcyoINNF8/NcRfanH18T1a+8kEWJb1g8EON5V TxPn3yOUaJc= =28Nt -----END PGP SIGNATURE----- Sat Dec 25 22:22:16 UTC 2021 I: Checking whether the package is not for us Sat Dec 25 22:22:16 UTC 2021 I: Starting 1st build on remote node ionos15-amd64.debian.net. Sat Dec 25 22:22:16 UTC 2021 I: Preparing to do remote build '1' on ionos15-amd64.debian.net. Sat Dec 25 22:23:05 UTC 2021 I: Deleting $TMPDIR on ionos15-amd64.debian.net. I: pbuilder: network access will be disabled during build I: Current time: Fri Jan 27 16:45:23 -12 2023 I: pbuilder-time-stamp: 1674881123 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/bullseye-reproducible-base.tgz] I: copying local configuration I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: Copying source file I: copying [dawg_1.2-3.dsc] I: copying [./dawg_1.2.orig.tar.gz] I: copying [./dawg_1.2-3.debian.tar.xz] I: Extracting source gpgv: unknown type of key resource 'trustedkeys.kbx' gpgv: keyblock resource '/tmp/dpkg-verify-sig.1ptGTWY3/trustedkeys.kbx': General error gpgv: Signature made Sun Nov 15 21:30:50 2020 -12 gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 gpgv: issuer "tille@debian.org" gpgv: Can't check signature: No public key dpkg-source: warning: failed to verify signature on ./dawg_1.2-3.dsc dpkg-source: info: extracting dawg in dawg-1.2 dpkg-source: info: unpacking dawg_1.2.orig.tar.gz dpkg-source: info: unpacking dawg_1.2-3.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying 0001-Add-missing-include-of-cstring.patch dpkg-source: info: applying 0003-Don-t-override-install-directories.patch dpkg-source: info: applying 0004-Fix-typo-in-help-text.patch dpkg-source: info: applying 0005-Remove-Encoding-add-Keywords-to-dawg.desktop.patch dpkg-source: info: applying 0006-relative-path-in-test-script.patch I: Not using root during the build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/861422/tmp/hooks/D02_print_environment starting I: set BUILDDIR='/build' BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' BUILDUSERNAME='pbuilder1' BUILD_ARCH='amd64' DEBIAN_FRONTEND='noninteractive' DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all,-fixfilepath parallel=16' DISTRIBUTION='' HOME='/root' HOST_ARCH='amd64' IFS=' ' INVOCATION_ID='0bf5648ef9444743a37093b04213a8a9' LANG='C' LANGUAGE='en_US:en' LC_ALL='C' MAIL='/var/mail/root' OPTIND='1' PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' PBCURRENTCOMMANDLINEOPERATION='build' PBUILDER_OPERATION='build' PBUILDER_PKGDATADIR='/usr/share/pbuilder' PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' PBUILDER_SYSCONFDIR='/etc' PPID='861422' PS1='# ' PS2='> ' PS4='+ ' PWD='/' SHELL='/bin/bash' SHLVL='2' SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/tmp.gDIa6cZ0NS/pbuilderrc_BAgO --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/bullseye-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/tmp.gDIa6cZ0NS/b1 --logfile b1/build.log dawg_1.2-3.dsc' SUDO_GID='111' SUDO_UID='106' SUDO_USER='jenkins' TERM='unknown' TZ='/usr/share/zoneinfo/Etc/GMT+12' USER='root' _='/usr/bin/systemd-run' http_proxy='http://85.184.249.68:3128' I: uname -a Linux ionos15-amd64 5.14.0-0.bpo.2-amd64 #1 SMP Debian 5.14.9-2~bpo11+1 (2021-10-10) x86_64 GNU/Linux I: ls -l /bin total 5476 -rwxr-xr-x 1 root root 1234376 Aug 4 2021 bash -rwxr-xr-x 3 root root 38984 Jul 20 2020 bunzip2 -rwxr-xr-x 3 root root 38984 Jul 20 2020 bzcat lrwxrwxrwx 1 root root 6 Jul 20 2020 bzcmp -> bzdiff -rwxr-xr-x 1 root root 2225 Jul 20 2020 bzdiff lrwxrwxrwx 1 root root 6 Jul 20 2020 bzegrep -> bzgrep -rwxr-xr-x 1 root root 4877 Sep 4 2019 bzexe lrwxrwxrwx 1 root root 6 Jul 20 2020 bzfgrep -> bzgrep -rwxr-xr-x 1 root root 3775 Jul 20 2020 bzgrep -rwxr-xr-x 3 root root 38984 Jul 20 2020 bzip2 -rwxr-xr-x 1 root root 18424 Jul 20 2020 bzip2recover lrwxrwxrwx 1 root root 6 Jul 20 2020 bzless -> bzmore -rwxr-xr-x 1 root root 1297 Jul 20 2020 bzmore -rwxr-xr-x 1 root root 43936 Sep 23 2020 cat -rwxr-xr-x 1 root root 72672 Sep 23 2020 chgrp -rwxr-xr-x 1 root root 64448 Sep 23 2020 chmod -rwxr-xr-x 1 root root 72672 Sep 23 2020 chown -rwxr-xr-x 1 root root 151168 Sep 23 2020 cp -rwxr-xr-x 1 root root 125560 Dec 10 2020 dash -rwxr-xr-x 1 root root 113664 Sep 23 2020 date -rwxr-xr-x 1 root root 80968 Sep 23 2020 dd -rwxr-xr-x 1 root root 93936 Sep 23 2020 df -rwxr-xr-x 1 root root 147176 Sep 23 2020 dir -rwxr-xr-x 1 root root 84440 Jul 28 2021 dmesg lrwxrwxrwx 1 root root 8 Nov 6 2019 dnsdomainname -> hostname lrwxrwxrwx 1 root root 8 Nov 6 2019 domainname -> hostname -rwxr-xr-x 1 root root 39712 Sep 23 2020 echo -rwxr-xr-x 1 root root 28 Nov 9 2020 egrep -rwxr-xr-x 1 root root 39680 Sep 23 2020 false -rwxr-xr-x 1 root root 28 Nov 9 2020 fgrep -rwxr-xr-x 1 root root 69032 Jul 28 2021 findmnt -rwsr-xr-x 1 root root 34896 Feb 26 2021 fusermount -rwxr-xr-x 1 root root 203072 Nov 9 2020 grep -rwxr-xr-x 2 root root 2346 Mar 2 2021 gunzip -rwxr-xr-x 1 root root 6376 Mar 2 2021 gzexe -rwxr-xr-x 1 root root 98048 Mar 2 2021 gzip -rwxr-xr-x 1 root root 22600 Nov 6 2019 hostname -rwxr-xr-x 1 root root 72840 Sep 23 2020 ln -rwxr-xr-x 1 root root 56952 Feb 7 2020 login -rwxr-xr-x 1 root root 147176 Sep 23 2020 ls -rwxr-xr-x 1 root root 149736 Jul 28 2021 lsblk -rwxr-xr-x 1 root root 85184 Sep 23 2020 mkdir -rwxr-xr-x 1 root root 76896 Sep 23 2020 mknod -rwxr-xr-x 1 root root 48064 Sep 23 2020 mktemp -rwxr-xr-x 1 root root 59632 Jul 28 2021 more -rwsr-xr-x 1 root root 55528 Jul 28 2021 mount -rwxr-xr-x 1 root root 18664 Jul 28 2021 mountpoint -rwxr-xr-x 1 root root 147080 Sep 23 2020 mv lrwxrwxrwx 1 root root 8 Nov 6 2019 nisdomainname -> hostname lrwxrwxrwx 1 root root 14 Apr 18 2021 pidof -> /sbin/killall5 -rwxr-xr-x 1 root root 43872 Sep 23 2020 pwd lrwxrwxrwx 1 root root 4 Aug 4 2021 rbash -> bash -rwxr-xr-x 1 root root 52032 Sep 23 2020 readlink -rwxr-xr-x 1 root root 72704 Sep 23 2020 rm -rwxr-xr-x 1 root root 52032 Sep 23 2020 rmdir -rwxr-xr-x 1 root root 27472 Sep 27 2020 run-parts -rwxr-xr-x 1 root root 122224 Dec 22 2018 sed lrwxrwxrwx 1 root root 4 Jan 23 03:47 sh -> dash -rwxr-xr-x 1 root root 43808 Sep 23 2020 sleep -rwxr-xr-x 1 root root 84928 Sep 23 2020 stty -rwsr-xr-x 1 root root 71912 Jul 28 2021 su -rwxr-xr-x 1 root root 39744 Sep 23 2020 sync -rwxr-xr-x 1 root root 531928 Feb 16 2021 tar -rwxr-xr-x 1 root root 14456 Sep 27 2020 tempfile -rwxr-xr-x 1 root root 101408 Sep 23 2020 touch -rwxr-xr-x 1 root root 39680 Sep 23 2020 true -rwxr-xr-x 1 root root 14328 Feb 26 2021 ulockmgr_server -rwsr-xr-x 1 root root 35040 Jul 28 2021 umount -rwxr-xr-x 1 root root 39744 Sep 23 2020 uname -rwxr-xr-x 2 root root 2346 Mar 2 2021 uncompress -rwxr-xr-x 1 root root 147176 Sep 23 2020 vdir -rwxr-xr-x 1 root root 63744 Jul 28 2021 wdctl lrwxrwxrwx 1 root root 8 Nov 6 2019 ypdomainname -> hostname -rwxr-xr-x 1 root root 1984 Mar 2 2021 zcat -rwxr-xr-x 1 root root 1678 Mar 2 2021 zcmp -rwxr-xr-x 1 root root 5880 Mar 2 2021 zdiff -rwxr-xr-x 1 root root 29 Mar 2 2021 zegrep -rwxr-xr-x 1 root root 29 Mar 2 2021 zfgrep -rwxr-xr-x 1 root root 2081 Mar 2 2021 zforce -rwxr-xr-x 1 root root 7585 Mar 2 2021 zgrep -rwxr-xr-x 1 root root 2206 Mar 2 2021 zless -rwxr-xr-x 1 root root 1842 Mar 2 2021 zmore -rwxr-xr-x 1 root root 4553 Mar 2 2021 znew I: user script /srv/workspace/pbuilder/861422/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: amd64 Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 13), cmake, bison, flex dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19655 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 13); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on cmake; however: Package cmake is not installed. pbuilder-satisfydepends-dummy depends on bison; however: Package bison is not installed. pbuilder-satisfydepends-dummy depends on flex; however: Package flex is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} automake{a} autopoint{a} autotools-dev{a} bison{a} bsdextrautils{a} cmake{a} cmake-data{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} flex{a} gettext{a} gettext-base{a} groff-base{a} intltool-debian{a} libarchive-zip-perl{a} libarchive13{a} libbrotli1{a} libcurl4{a} libdebhelper-perl{a} libelf1{a} libexpat1{a} libfile-stripnondeterminism-perl{a} libicu67{a} libjsoncpp24{a} libldap-2.4-2{a} libmagic-mgc{a} libmagic1{a} libncurses6{a} libnghttp2-14{a} libpipeline1{a} libprocps8{a} libpsl5{a} librhash0{a} librtmp1{a} libsasl2-2{a} libsasl2-modules-db{a} libsigsegv2{a} libssh2-1{a} libsub-override-perl{a} libtool{a} libuchardet0{a} libuv1{a} libxml2{a} m4{a} man-db{a} po-debconf{a} procps{a} sensible-utils{a} The following packages are RECOMMENDED but will NOT be installed: ca-certificates curl libarchive-cpio-perl libfl-dev libgpm2 libldap-common libltdl-dev libmail-sendmail-perl libsasl2-modules lynx psmisc publicsuffix wget 0 packages upgraded, 52 newly installed, 0 to remove and 0 not upgraded. Need to get 30.0 MB of archives. After unpacking 112 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian bullseye/main amd64 bsdextrautils amd64 2.36.1-8 [145 kB] Get: 2 http://deb.debian.org/debian bullseye/main amd64 libuchardet0 amd64 0.0.7-1 [67.8 kB] Get: 3 http://deb.debian.org/debian bullseye/main amd64 groff-base amd64 1.22.4-6 [936 kB] Get: 4 http://deb.debian.org/debian bullseye/main amd64 libpipeline1 amd64 1.5.3-1 [34.3 kB] Get: 5 http://deb.debian.org/debian bullseye/main amd64 man-db amd64 2.9.4-2 [1354 kB] Get: 6 http://deb.debian.org/debian bullseye/main amd64 libsigsegv2 amd64 2.13-1 [34.8 kB] Get: 7 http://deb.debian.org/debian bullseye/main amd64 m4 amd64 1.4.18-5 [204 kB] Get: 8 http://deb.debian.org/debian bullseye/main amd64 flex amd64 2.6.4-8 [440 kB] Get: 9 http://deb.debian.org/debian bullseye/main amd64 libncurses6 amd64 6.2+20201114-2 [102 kB] Get: 10 http://deb.debian.org/debian bullseye/main amd64 libprocps8 amd64 2:3.3.17-5 [63.9 kB] Get: 11 http://deb.debian.org/debian bullseye/main amd64 procps amd64 2:3.3.17-5 [502 kB] Get: 12 http://deb.debian.org/debian bullseye/main amd64 sensible-utils all 0.0.14 [14.8 kB] Get: 13 http://deb.debian.org/debian bullseye/main amd64 libmagic-mgc amd64 1:5.39-3 [273 kB] Get: 14 http://deb.debian.org/debian bullseye/main amd64 libmagic1 amd64 1:5.39-3 [126 kB] Get: 15 http://deb.debian.org/debian bullseye/main amd64 file amd64 1:5.39-3 [69.1 kB] Get: 16 http://deb.debian.org/debian bullseye/main amd64 gettext-base amd64 0.21-4 [175 kB] Get: 17 http://deb.debian.org/debian bullseye/main amd64 autoconf all 2.69-14 [313 kB] Get: 18 http://deb.debian.org/debian bullseye/main amd64 autotools-dev all 20180224.1+nmu1 [77.1 kB] Get: 19 http://deb.debian.org/debian bullseye/main amd64 automake all 1:1.16.3-2 [814 kB] Get: 20 http://deb.debian.org/debian bullseye/main amd64 autopoint all 0.21-4 [510 kB] Get: 21 http://deb.debian.org/debian bullseye/main amd64 bison amd64 2:3.7.5+dfsg-1 [1104 kB] Get: 22 http://deb.debian.org/debian bullseye/main amd64 cmake-data all 3.18.4-2+deb11u1 [1725 kB] Get: 23 http://deb.debian.org/debian bullseye/main amd64 libicu67 amd64 67.1-7 [8622 kB] Get: 24 http://deb.debian.org/debian bullseye/main amd64 libxml2 amd64 2.9.10+dfsg-6.7 [693 kB] Get: 25 http://deb.debian.org/debian bullseye/main amd64 libarchive13 amd64 3.4.3-2+b1 [343 kB] Get: 26 http://deb.debian.org/debian bullseye/main amd64 libbrotli1 amd64 1.0.9-2+b2 [279 kB] Get: 27 http://deb.debian.org/debian bullseye/main amd64 libsasl2-modules-db amd64 2.1.27+dfsg-2.1 [69.1 kB] Get: 28 http://deb.debian.org/debian bullseye/main amd64 libsasl2-2 amd64 2.1.27+dfsg-2.1 [106 kB] Get: 29 http://deb.debian.org/debian bullseye/main amd64 libldap-2.4-2 amd64 2.4.57+dfsg-3 [232 kB] Get: 30 http://deb.debian.org/debian bullseye/main amd64 libnghttp2-14 amd64 1.43.0-1 [77.1 kB] Get: 31 http://deb.debian.org/debian bullseye/main amd64 libpsl5 amd64 0.21.0-1.2 [57.3 kB] Get: 32 http://deb.debian.org/debian bullseye/main amd64 librtmp1 amd64 2.4+20151223.gitfa8646d.1-2+b2 [60.8 kB] Get: 33 http://deb.debian.org/debian bullseye/main amd64 libssh2-1 amd64 1.9.0-2 [156 kB] Get: 34 http://deb.debian.org/debian bullseye/main amd64 libcurl4 amd64 7.74.0-1.3+deb11u1 [341 kB] Get: 35 http://deb.debian.org/debian bullseye/main amd64 libexpat1 amd64 2.2.10-2 [96.9 kB] Get: 36 http://deb.debian.org/debian bullseye/main amd64 libjsoncpp24 amd64 1.9.4-4 [78.9 kB] Get: 37 http://deb.debian.org/debian bullseye/main amd64 librhash0 amd64 1.4.1-2 [129 kB] Get: 38 http://deb.debian.org/debian bullseye/main amd64 libuv1 amd64 1.40.0-2 [132 kB] Get: 39 http://deb.debian.org/debian bullseye/main amd64 cmake amd64 3.18.4-2+deb11u1 [5593 kB] Get: 40 http://deb.debian.org/debian bullseye/main amd64 libdebhelper-perl all 13.3.4 [189 kB] Get: 41 http://deb.debian.org/debian bullseye/main amd64 libtool all 2.4.6-15 [513 kB] Get: 42 http://deb.debian.org/debian bullseye/main amd64 dh-autoreconf all 20 [17.1 kB] Get: 43 http://deb.debian.org/debian bullseye/main amd64 libarchive-zip-perl all 1.68-1 [104 kB] Get: 44 http://deb.debian.org/debian bullseye/main amd64 libsub-override-perl all 0.09-2 [10.2 kB] Get: 45 http://deb.debian.org/debian bullseye/main amd64 libfile-stripnondeterminism-perl all 1.12.0-1 [26.3 kB] Get: 46 http://deb.debian.org/debian bullseye/main amd64 dh-strip-nondeterminism all 1.12.0-1 [15.4 kB] Get: 47 http://deb.debian.org/debian bullseye/main amd64 libelf1 amd64 0.183-1 [165 kB] Get: 48 http://deb.debian.org/debian bullseye/main amd64 dwz amd64 0.13+20210201-1 [175 kB] Get: 49 http://deb.debian.org/debian bullseye/main amd64 gettext amd64 0.21-4 [1311 kB] Get: 50 http://deb.debian.org/debian bullseye/main amd64 intltool-debian all 0.35.0+20060710.5 [26.8 kB] Get: 51 http://deb.debian.org/debian bullseye/main amd64 po-debconf all 1.0.21+nmu1 [248 kB] Get: 52 http://deb.debian.org/debian bullseye/main amd64 debhelper all 13.3.4 [1049 kB] Fetched 30.0 MB in 0s (93.1 MB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package bsdextrautils. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19655 files and directories currently installed.) Preparing to unpack .../00-bsdextrautils_2.36.1-8_amd64.deb ... Unpacking bsdextrautils (2.36.1-8) ... Selecting previously unselected package libuchardet0:amd64. Preparing to unpack .../01-libuchardet0_0.0.7-1_amd64.deb ... Unpacking libuchardet0:amd64 (0.0.7-1) ... Selecting previously unselected package groff-base. Preparing to unpack .../02-groff-base_1.22.4-6_amd64.deb ... Unpacking groff-base (1.22.4-6) ... Selecting previously unselected package libpipeline1:amd64. Preparing to unpack .../03-libpipeline1_1.5.3-1_amd64.deb ... Unpacking libpipeline1:amd64 (1.5.3-1) ... Selecting previously unselected package man-db. Preparing to unpack .../04-man-db_2.9.4-2_amd64.deb ... Unpacking man-db (2.9.4-2) ... Selecting previously unselected package libsigsegv2:amd64. Preparing to unpack .../05-libsigsegv2_2.13-1_amd64.deb ... Unpacking libsigsegv2:amd64 (2.13-1) ... Selecting previously unselected package m4. Preparing to unpack .../06-m4_1.4.18-5_amd64.deb ... Unpacking m4 (1.4.18-5) ... Selecting previously unselected package flex. Preparing to unpack .../07-flex_2.6.4-8_amd64.deb ... Unpacking flex (2.6.4-8) ... Selecting previously unselected package libncurses6:amd64. Preparing to unpack .../08-libncurses6_6.2+20201114-2_amd64.deb ... Unpacking libncurses6:amd64 (6.2+20201114-2) ... Selecting previously unselected package libprocps8:amd64. Preparing to unpack .../09-libprocps8_2%3a3.3.17-5_amd64.deb ... Unpacking libprocps8:amd64 (2:3.3.17-5) ... Selecting previously unselected package procps. Preparing to unpack .../10-procps_2%3a3.3.17-5_amd64.deb ... Unpacking procps (2:3.3.17-5) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../11-sensible-utils_0.0.14_all.deb ... Unpacking sensible-utils (0.0.14) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../12-libmagic-mgc_1%3a5.39-3_amd64.deb ... Unpacking libmagic-mgc (1:5.39-3) ... Selecting previously unselected package libmagic1:amd64. Preparing to unpack .../13-libmagic1_1%3a5.39-3_amd64.deb ... Unpacking libmagic1:amd64 (1:5.39-3) ... Selecting previously unselected package file. Preparing to unpack .../14-file_1%3a5.39-3_amd64.deb ... Unpacking file (1:5.39-3) ... Selecting previously unselected package gettext-base. Preparing to unpack .../15-gettext-base_0.21-4_amd64.deb ... Unpacking gettext-base (0.21-4) ... Selecting previously unselected package autoconf. Preparing to unpack .../16-autoconf_2.69-14_all.deb ... Unpacking autoconf (2.69-14) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../17-autotools-dev_20180224.1+nmu1_all.deb ... Unpacking autotools-dev (20180224.1+nmu1) ... Selecting previously unselected package automake. Preparing to unpack .../18-automake_1%3a1.16.3-2_all.deb ... Unpacking automake (1:1.16.3-2) ... Selecting previously unselected package autopoint. Preparing to unpack .../19-autopoint_0.21-4_all.deb ... Unpacking autopoint (0.21-4) ... Selecting previously unselected package bison. Preparing to unpack .../20-bison_2%3a3.7.5+dfsg-1_amd64.deb ... Unpacking bison (2:3.7.5+dfsg-1) ... Selecting previously unselected package cmake-data. Preparing to unpack .../21-cmake-data_3.18.4-2+deb11u1_all.deb ... Unpacking cmake-data (3.18.4-2+deb11u1) ... Selecting previously unselected package libicu67:amd64. Preparing to unpack .../22-libicu67_67.1-7_amd64.deb ... Unpacking libicu67:amd64 (67.1-7) ... Selecting previously unselected package libxml2:amd64. Preparing to unpack .../23-libxml2_2.9.10+dfsg-6.7_amd64.deb ... Unpacking libxml2:amd64 (2.9.10+dfsg-6.7) ... Selecting previously unselected package libarchive13:amd64. Preparing to unpack .../24-libarchive13_3.4.3-2+b1_amd64.deb ... Unpacking libarchive13:amd64 (3.4.3-2+b1) ... Selecting previously unselected package libbrotli1:amd64. Preparing to unpack .../25-libbrotli1_1.0.9-2+b2_amd64.deb ... Unpacking libbrotli1:amd64 (1.0.9-2+b2) ... Selecting previously unselected package libsasl2-modules-db:amd64. Preparing to unpack .../26-libsasl2-modules-db_2.1.27+dfsg-2.1_amd64.deb ... Unpacking libsasl2-modules-db:amd64 (2.1.27+dfsg-2.1) ... Selecting previously unselected package libsasl2-2:amd64. Preparing to unpack .../27-libsasl2-2_2.1.27+dfsg-2.1_amd64.deb ... Unpacking libsasl2-2:amd64 (2.1.27+dfsg-2.1) ... Selecting previously unselected package libldap-2.4-2:amd64. Preparing to unpack .../28-libldap-2.4-2_2.4.57+dfsg-3_amd64.deb ... Unpacking libldap-2.4-2:amd64 (2.4.57+dfsg-3) ... Selecting previously unselected package libnghttp2-14:amd64. Preparing to unpack .../29-libnghttp2-14_1.43.0-1_amd64.deb ... Unpacking libnghttp2-14:amd64 (1.43.0-1) ... Selecting previously unselected package libpsl5:amd64. Preparing to unpack .../30-libpsl5_0.21.0-1.2_amd64.deb ... Unpacking libpsl5:amd64 (0.21.0-1.2) ... Selecting previously unselected package librtmp1:amd64. Preparing to unpack .../31-librtmp1_2.4+20151223.gitfa8646d.1-2+b2_amd64.deb ... Unpacking librtmp1:amd64 (2.4+20151223.gitfa8646d.1-2+b2) ... Selecting previously unselected package libssh2-1:amd64. Preparing to unpack .../32-libssh2-1_1.9.0-2_amd64.deb ... Unpacking libssh2-1:amd64 (1.9.0-2) ... Selecting previously unselected package libcurl4:amd64. Preparing to unpack .../33-libcurl4_7.74.0-1.3+deb11u1_amd64.deb ... Unpacking libcurl4:amd64 (7.74.0-1.3+deb11u1) ... Selecting previously unselected package libexpat1:amd64. Preparing to unpack .../34-libexpat1_2.2.10-2_amd64.deb ... Unpacking libexpat1:amd64 (2.2.10-2) ... Selecting previously unselected package libjsoncpp24:amd64. Preparing to unpack .../35-libjsoncpp24_1.9.4-4_amd64.deb ... Unpacking libjsoncpp24:amd64 (1.9.4-4) ... Selecting previously unselected package librhash0:amd64. Preparing to unpack .../36-librhash0_1.4.1-2_amd64.deb ... Unpacking librhash0:amd64 (1.4.1-2) ... Selecting previously unselected package libuv1:amd64. Preparing to unpack .../37-libuv1_1.40.0-2_amd64.deb ... Unpacking libuv1:amd64 (1.40.0-2) ... Selecting previously unselected package cmake. Preparing to unpack .../38-cmake_3.18.4-2+deb11u1_amd64.deb ... Unpacking cmake (3.18.4-2+deb11u1) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../39-libdebhelper-perl_13.3.4_all.deb ... Unpacking libdebhelper-perl (13.3.4) ... Selecting previously unselected package libtool. Preparing to unpack .../40-libtool_2.4.6-15_all.deb ... Unpacking libtool (2.4.6-15) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../41-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../42-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libsub-override-perl. Preparing to unpack .../43-libsub-override-perl_0.09-2_all.deb ... Unpacking libsub-override-perl (0.09-2) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../44-libfile-stripnondeterminism-perl_1.12.0-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.12.0-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../45-dh-strip-nondeterminism_1.12.0-1_all.deb ... Unpacking dh-strip-nondeterminism (1.12.0-1) ... Selecting previously unselected package libelf1:amd64. Preparing to unpack .../46-libelf1_0.183-1_amd64.deb ... Unpacking libelf1:amd64 (0.183-1) ... Selecting previously unselected package dwz. Preparing to unpack .../47-dwz_0.13+20210201-1_amd64.deb ... Unpacking dwz (0.13+20210201-1) ... Selecting previously unselected package gettext. Preparing to unpack .../48-gettext_0.21-4_amd64.deb ... Unpacking gettext (0.21-4) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../49-intltool-debian_0.35.0+20060710.5_all.deb ... Unpacking intltool-debian (0.35.0+20060710.5) ... Selecting previously unselected package po-debconf. Preparing to unpack .../50-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../51-debhelper_13.3.4_all.deb ... Unpacking debhelper (13.3.4) ... Setting up libexpat1:amd64 (2.2.10-2) ... Setting up libpipeline1:amd64 (1.5.3-1) ... Setting up libpsl5:amd64 (0.21.0-1.2) ... Setting up bsdextrautils (2.36.1-8) ... update-alternatives: using /usr/bin/write.ul to provide /usr/bin/write (write) in auto mode Setting up libicu67:amd64 (67.1-7) ... Setting up libmagic-mgc (1:5.39-3) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libdebhelper-perl (13.3.4) ... Setting up libbrotli1:amd64 (1.0.9-2+b2) ... Setting up libnghttp2-14:amd64 (1.43.0-1) ... Setting up libmagic1:amd64 (1:5.39-3) ... Setting up gettext-base (0.21-4) ... Setting up file (1:5.39-3) ... Setting up libsasl2-modules-db:amd64 (2.1.27+dfsg-2.1) ... Setting up autotools-dev (20180224.1+nmu1) ... Setting up libuv1:amd64 (1.40.0-2) ... Setting up librtmp1:amd64 (2.4+20151223.gitfa8646d.1-2+b2) ... Setting up libncurses6:amd64 (6.2+20201114-2) ... Setting up libsigsegv2:amd64 (2.13-1) ... Setting up autopoint (0.21-4) ... Setting up libsasl2-2:amd64 (2.1.27+dfsg-2.1) ... Setting up libjsoncpp24:amd64 (1.9.4-4) ... Setting up sensible-utils (0.0.14) ... Setting up librhash0:amd64 (1.4.1-2) ... Setting up libuchardet0:amd64 (0.0.7-1) ... Setting up libsub-override-perl (0.09-2) ... Setting up libssh2-1:amd64 (1.9.0-2) ... Setting up cmake-data (3.18.4-2+deb11u1) ... Setting up libelf1:amd64 (0.183-1) ... Setting up libxml2:amd64 (2.9.10+dfsg-6.7) ... Setting up libprocps8:amd64 (2:3.3.17-5) ... Setting up libfile-stripnondeterminism-perl (1.12.0-1) ... Setting up gettext (0.21-4) ... Setting up libtool (2.4.6-15) ... Setting up libarchive13:amd64 (3.4.3-2+b1) ... Setting up libldap-2.4-2:amd64 (2.4.57+dfsg-3) ... Setting up m4 (1.4.18-5) ... Setting up intltool-debian (0.35.0+20060710.5) ... Setting up autoconf (2.69-14) ... Setting up dh-strip-nondeterminism (1.12.0-1) ... Setting up dwz (0.13+20210201-1) ... Setting up groff-base (1.22.4-6) ... Setting up procps (2:3.3.17-5) ... Setting up bison (2:3.7.5+dfsg-1) ... update-alternatives: using /usr/bin/bison.yacc to provide /usr/bin/yacc (yacc) in auto mode Setting up libcurl4:amd64 (7.74.0-1.3+deb11u1) ... Setting up automake (1:1.16.3-2) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up flex (2.6.4-8) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up man-db (2.9.4-2) ... Not building database; man-db/auto-update is not 'true'. Setting up dh-autoreconf (20) ... Setting up cmake (3.18.4-2+deb11u1) ... Setting up debhelper (13.3.4) ... Processing triggers for libc-bin (2.31-13+deb11u2) ... Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps I: Building the package I: Running cd /build/dawg-1.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../dawg_1.2-3_source.changes dpkg-buildpackage: info: source package dawg dpkg-buildpackage: info: source version 1.2-3 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Andreas Tille dpkg-source --before-build . dpkg-buildpackage: info: host architecture amd64 debian/rules clean dh clean dh_clean debian/rules binary dh binary dh_update_autotools_config dh_autoreconf debian/rules override_dh_auto_configure make[1]: Entering directory '/build/dawg-1.2' dh_auto_configure -- \ -DCMAKE_LIBRARY_PATH=x86_64-linux-gnu \ -DCMAKE_DATA_DIR=/usr/share/doc/dawg cd obj-x86_64-linux-gnu && cmake -DCMAKE_INSTALL_PREFIX=/usr -DCMAKE_BUILD_TYPE=None -DCMAKE_INSTALL_SYSCONFDIR=/etc -DCMAKE_INSTALL_LOCALSTATEDIR=/var -DCMAKE_EXPORT_NO_PACKAGE_REGISTRY=ON -DCMAKE_FIND_PACKAGE_NO_PACKAGE_REGISTRY=ON -DCMAKE_INSTALL_RUNSTATEDIR=/run -DCMAKE_SKIP_INSTALL_ALL_DEPENDENCY=ON "-GUnix Makefiles" -DCMAKE_VERBOSE_MAKEFILE=ON -DCMAKE_INSTALL_LIBDIR=lib/x86_64-linux-gnu -DCMAKE_LIBRARY_PATH=x86_64-linux-gnu -DCMAKE_DATA_DIR=/usr/share/doc/dawg .. -- The C compiler identification is GNU 10.2.1 -- The CXX compiler identification is GNU 10.2.1 -- Detecting C compiler ABI info -- Detecting C compiler ABI info - done -- Check for working C compiler: /usr/bin/cc - skipped -- Detecting C compile features -- Detecting C compile features - done -- Detecting CXX compiler ABI info -- Detecting CXX compiler ABI info - done -- Check for working CXX compiler: /usr/bin/c++ - skipped -- Detecting CXX compile features -- Detecting CXX compile features - done -- Looking for bison -- Looking for bison -- /usr/bin/bison -- Looking for flex -- Looking for flex -- /usr/bin/flex -- Looking for unistd.h -- Looking for unistd.h - found -- Looking for process.h -- Looking for process.h - not found -- Looking for io.h -- Looking for io.h - not found -- Looking for getopt.h -- Looking for getopt.h - found -- Looking for stdint.h -- Looking for stdint.h - found -- Looking for sys/types.h -- Looking for sys/types.h - found -- Looking for getpid -- Looking for getpid - found -- Looking for _getpid -- Looking for _getpid - not found -- Looking for copysign -- Looking for copysign - found -- Looking for _copysign -- Looking for _copysign - not found -- Looking for snprintf -- Looking for snprintf - found -- Looking for _snprintf -- Looking for _snprintf - not found -- Configuring done -- Generating done CMake Warning: Manually-specified variables were not used by the project: CMAKE_EXPORT_NO_PACKAGE_REGISTRY CMAKE_FIND_PACKAGE_NO_PACKAGE_REGISTRY CMAKE_INSTALL_LIBDIR CMAKE_INSTALL_LOCALSTATEDIR CMAKE_INSTALL_RUNSTATEDIR CMAKE_INSTALL_SYSCONFDIR CMAKE_LIBRARY_PATH -- Build files have been written to: /build/dawg-1.2/obj-x86_64-linux-gnu make[1]: Leaving directory '/build/dawg-1.2' dh_auto_build cd obj-x86_64-linux-gnu && make -j16 "INSTALL=install --strip-program=true" VERBOSE=1 make[1]: Entering directory '/build/dawg-1.2/obj-x86_64-linux-gnu' /usr/bin/cmake -S/build/dawg-1.2 -B/build/dawg-1.2/obj-x86_64-linux-gnu --check-build-system CMakeFiles/Makefile.cmake 0 /usr/bin/cmake -E cmake_progress_start /build/dawg-1.2/obj-x86_64-linux-gnu/CMakeFiles /build/dawg-1.2/obj-x86_64-linux-gnu//CMakeFiles/progress.marks make -f CMakeFiles/Makefile2 all make[2]: Entering directory '/build/dawg-1.2/obj-x86_64-linux-gnu' make -f src/CMakeFiles/dawg.dir/build.make src/CMakeFiles/dawg.dir/depend make[3]: Entering directory '/build/dawg-1.2/obj-x86_64-linux-gnu' [ 7%] Generating parser.tab.cpp, parser.tab.hpp cd /build/dawg-1.2/obj-x86_64-linux-gnu/src && /usr/bin/bison --name-prefix=parser --defines --output-file=/build/dawg-1.2/obj-x86_64-linux-gnu/src/parser.tab.cpp /build/dawg-1.2/src/parser.ypp [ 15%] Generating lex.parser.cpp cd /build/dawg-1.2/obj-x86_64-linux-gnu/src && /usr/bin/flex -Pparser -o/build/dawg-1.2/obj-x86_64-linux-gnu/src/lex.parser.cpp /build/dawg-1.2/src/parser.lpp cd /build/dawg-1.2/obj-x86_64-linux-gnu && /usr/bin/cmake -E cmake_depends "Unix Makefiles" /build/dawg-1.2 /build/dawg-1.2/src /build/dawg-1.2/obj-x86_64-linux-gnu /build/dawg-1.2/obj-x86_64-linux-gnu/src /build/dawg-1.2/obj-x86_64-linux-gnu/src/CMakeFiles/dawg.dir/DependInfo.cmake --color= Dependee "/build/dawg-1.2/obj-x86_64-linux-gnu/src/CMakeFiles/dawg.dir/DependInfo.cmake" is newer than depender "/build/dawg-1.2/obj-x86_64-linux-gnu/src/CMakeFiles/dawg.dir/depend.internal". Dependee "/build/dawg-1.2/obj-x86_64-linux-gnu/src/CMakeFiles/CMakeDirectoryInformation.cmake" is newer than depender "/build/dawg-1.2/obj-x86_64-linux-gnu/src/CMakeFiles/dawg.dir/depend.internal". Scanning dependencies of target dawg make[3]: Leaving directory '/build/dawg-1.2/obj-x86_64-linux-gnu' make -f src/CMakeFiles/dawg.dir/build.make src/CMakeFiles/dawg.dir/build make[3]: Entering directory '/build/dawg-1.2/obj-x86_64-linux-gnu' [ 23%] Building CXX object src/CMakeFiles/dawg.dir/eigen.cpp.o [ 30%] Building CXX object src/CMakeFiles/dawg.dir/dawg.cpp.o cd /build/dawg-1.2/obj-x86_64-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-x86_64-linux-gnu/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/eigen.cpp.o -c /build/dawg-1.2/src/eigen.cpp cd /build/dawg-1.2/obj-x86_64-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-x86_64-linux-gnu/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/dawg.cpp.o -c /build/dawg-1.2/src/dawg.cpp [ 38%] Building CXX object src/CMakeFiles/dawg.dir/output.cpp.o [ 46%] Building CXX object src/CMakeFiles/dawg.dir/indel.cpp.o cd /build/dawg-1.2/obj-x86_64-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-x86_64-linux-gnu/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/output.cpp.o -c /build/dawg-1.2/src/output.cpp [ 53%] Building CXX object src/CMakeFiles/dawg.dir/matrix.cpp.o cd /build/dawg-1.2/obj-x86_64-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-x86_64-linux-gnu/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/indel.cpp.o -c /build/dawg-1.2/src/indel.cpp cd /build/dawg-1.2/obj-x86_64-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-x86_64-linux-gnu/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/matrix.cpp.o -c /build/dawg-1.2/src/matrix.cpp [ 61%] Building CXX object src/CMakeFiles/dawg.dir/rand.cpp.o [ 69%] Building CXX object src/CMakeFiles/dawg.dir/tree.cpp.o cd /build/dawg-1.2/obj-x86_64-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-x86_64-linux-gnu/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/rand.cpp.o -c /build/dawg-1.2/src/rand.cpp [ 76%] Building CXX object src/CMakeFiles/dawg.dir/var.cpp.o cd /build/dawg-1.2/obj-x86_64-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-x86_64-linux-gnu/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/tree.cpp.o -c /build/dawg-1.2/src/tree.cpp [ 84%] Building CXX object src/CMakeFiles/dawg.dir/lex.parser.cpp.o cd /build/dawg-1.2/obj-x86_64-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-x86_64-linux-gnu/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/var.cpp.o -c /build/dawg-1.2/src/var.cpp [ 92%] Building CXX object src/CMakeFiles/dawg.dir/parser.tab.cpp.o cd /build/dawg-1.2/obj-x86_64-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-x86_64-linux-gnu/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -I "/build/dawg-1.2/src" -o CMakeFiles/dawg.dir/lex.parser.cpp.o -c /build/dawg-1.2/obj-x86_64-linux-gnu/src/lex.parser.cpp cd /build/dawg-1.2/obj-x86_64-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-x86_64-linux-gnu/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -I "/build/dawg-1.2/src" -o CMakeFiles/dawg.dir/parser.tab.cpp.o -c /build/dawg-1.2/obj-x86_64-linux-gnu/src/parser.tab.cpp In file included from /build/dawg-1.2/src/dawg.cpp:20: /build/dawg-1.2/src/tree.h:17:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/dawg.cpp:19: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/dawg.cpp:20: /build/dawg-1.2/src/tree.h:18:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/dawg.cpp:19: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.lpp:5: /build/dawg-1.2/src/tree.h:17:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.lpp:4: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.lpp:5: /build/dawg-1.2/src/tree.h:18:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.lpp:4: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/dawg.cpp:20: /build/dawg-1.2/src/tree.h:199:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/dawg.cpp:19: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/dawg.cpp:20: /build/dawg-1.2/src/tree.h:200:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/dawg.cpp:19: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.lpp:5: /build/dawg-1.2/src/tree.h:199:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.lpp:4: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.lpp:5: /build/dawg-1.2/src/tree.h:200:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.lpp:4: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/tree.cpp:4: /build/dawg-1.2/src/tree.h:17:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/tree.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/tree.cpp:4: /build/dawg-1.2/src/tree.h:18:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/tree.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/output.cpp:4: /build/dawg-1.2/src/tree.h:17:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/output.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/output.cpp:4: /build/dawg-1.2/src/tree.h:18:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/output.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/tree.cpp:4: /build/dawg-1.2/src/tree.h:199:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/tree.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/tree.cpp:4: /build/dawg-1.2/src/tree.h:200:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/tree.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/var.cpp:4: /build/dawg-1.2/src/tree.h:17:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/var.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/var.cpp:4: /build/dawg-1.2/src/tree.h:18:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/var.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/output.cpp:4: /build/dawg-1.2/src/tree.h:199:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/output.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/output.cpp:4: /build/dawg-1.2/src/tree.h:200:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/output.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/var.cpp:4: /build/dawg-1.2/src/tree.h:199:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/var.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/var.cpp:4: /build/dawg-1.2/src/tree.h:200:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/var.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.ypp:5: /build/dawg-1.2/src/tree.h:17:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.ypp:4: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.ypp:5: /build/dawg-1.2/src/tree.h:18:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.ypp:4: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.ypp:5: /build/dawg-1.2/src/tree.h:199:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.ypp:4: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.ypp:5: /build/dawg-1.2/src/tree.h:200:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.ypp:4: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ [100%] Linking CXX executable dawg cd /build/dawg-1.2/obj-x86_64-linux-gnu/src && /usr/bin/cmake -E cmake_link_script CMakeFiles/dawg.dir/link.txt --verbose=1 /usr/bin/c++ -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -Wl,-z,relro -Wl,-z,now -rdynamic CMakeFiles/dawg.dir/dawg.cpp.o CMakeFiles/dawg.dir/eigen.cpp.o CMakeFiles/dawg.dir/indel.cpp.o CMakeFiles/dawg.dir/matrix.cpp.o CMakeFiles/dawg.dir/output.cpp.o CMakeFiles/dawg.dir/rand.cpp.o CMakeFiles/dawg.dir/tree.cpp.o CMakeFiles/dawg.dir/var.cpp.o CMakeFiles/dawg.dir/lex.parser.cpp.o CMakeFiles/dawg.dir/parser.tab.cpp.o -o dawg make[3]: Leaving directory '/build/dawg-1.2/obj-x86_64-linux-gnu' [100%] Built target dawg make[2]: Leaving directory '/build/dawg-1.2/obj-x86_64-linux-gnu' /usr/bin/cmake -E cmake_progress_start /build/dawg-1.2/obj-x86_64-linux-gnu/CMakeFiles 0 make[1]: Leaving directory '/build/dawg-1.2/obj-x86_64-linux-gnu' debian/rules override_dh_auto_test make[1]: Entering directory '/build/dawg-1.2' # FIXME: This test fails - but let the build pass anyway for the moment cd tests && PATH=$PATH:/build/dawg-1.2/obj-x86_64-linux-gnu/src sh test0.sh || true 2,3c2,3 < TCCTTGACCAGTTAGCAAGACGATATGCATCAAGTGCACTGGC---GTAAGTCTTTTTAC < GCTGATCATA--TAGTCCGTATAGTCACTGAACGCCGTCCTCTCG --- > AGGAACTGGTCACGTTCTGCTATACGTAGTTCACGTGACCGCATTCAGAAAAATGCGACT > AGTATTGTGATCAGGCATATCAGTGACTTGCGGCAGGAGAGC 6,7c6,7 < TCGTTGGACAGT--GCAAGACGCTATGCATCAAGTGCACTGGCTAGGTAAGTGCGTTTAT < GATGAGCACAACAGGTCCGGATAGTCCCTGAACGCTATACTCCCG --- > AGCAACTTGTCACGTTCTGCGATACGTAGTTCACGTGACCGCATTCACGCAAACACTACT > TGTGCT--GACCATGCATATCAGGGACTTGCGACATGTGGGC 10,11c10,11 < TCGA-CCCCAAA--TTAATACGTTAGTCATCAAGTGCACTGAC---GTAATAGCGTTTAT < GATGATGAGTACTAGCCCGTGGAAACCCTAAAAGCGTTACCCCCG --- > AGCATGGTGTCAAGTTCTGCGTTCAGTAGTTAACCAGACGGCATTAACGCTAATACATC- > -GTGTT--GACCTACCAACGTACGGACTTGCGTAATGTGGTC 14,15c14,15 < TCGTTGAACAGT--GCAAGACGCTATGCATCAAGTGCACTGGC---GTAAGTGCGTTTAT < GATGAACACAACTGGTCCGTATAGTCCCTGAACGCTGTACTCCCG --- > AGCAACTTGTCACGTTCTGCGATACGTAGTTCACGTGACCGCATTCACGCAAATACTACT > TGTGTT--GACCAGGCATATCAGGGACTTGCGACATGAGGGC 18,19c18,19 < TCGTACCACAGT--TCAAGACGCTAGGCATCAAGTGCACTGGC---GTAATTGCGTTTAT < GATGGACACAACTAGTCCGTTGAATCCCTGAACGCTTTACCCCCG --- > AGCATGGTGTCAAGTTCTGCGATCCGTAGTTCACGTGACCGCATTAACGCAAATACTACC > TGTGTT--GATCAGGCAACTTAGGGACTTGCGAAATGGGGGC make[1]: Leaving directory '/build/dawg-1.2' create-stamp debian/debhelper-build-stamp dh_prep dh_auto_install cd obj-x86_64-linux-gnu && make -j16 install DESTDIR=/build/dawg-1.2/debian/dawg AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[1]: Entering directory '/build/dawg-1.2/obj-x86_64-linux-gnu' /usr/bin/cmake -S/build/dawg-1.2 -B/build/dawg-1.2/obj-x86_64-linux-gnu --check-build-system CMakeFiles/Makefile.cmake 0 make -f CMakeFiles/Makefile2 preinstall make[2]: Entering directory '/build/dawg-1.2/obj-x86_64-linux-gnu' make[2]: Nothing to be done for 'preinstall'. make[2]: Leaving directory '/build/dawg-1.2/obj-x86_64-linux-gnu' Install the project... /usr/bin/cmake -P cmake_install.cmake -- Install configuration: "None" -- Installing: /build/dawg-1.2/debian/dawg/usr/bin/dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/applications/dawg.desktop -- Installing: /build/dawg-1.2/debian/dawg/usr/share/pixmaps/dawg.png -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example0.dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example1.dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example2.dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example3.dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example4.dawg make[1]: Leaving directory '/build/dawg-1.2/obj-x86_64-linux-gnu' dh_install dh_installdocs dh_installchangelogs dh_installman dh_perl dh_link dh_strip_nondeterminism dh_compress debian/rules override_dh_fixperms make[1]: Entering directory '/build/dawg-1.2' dh_fixperms chmod -x debian/dawg/usr/share/doc/dawg/examples/* make[1]: Leaving directory '/build/dawg-1.2' dh_missing dh_dwz -a dh_strip -a dh_makeshlibs -a dh_shlibdeps -a dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'dawg' in '../dawg_1.2-3_amd64.deb'. dpkg-deb: building package 'dawg-dbgsym' in '../dawg-dbgsym_1.2-3_amd64.deb'. dpkg-genbuildinfo --build=binary dpkg-genchanges --build=binary >../dawg_1.2-3_amd64.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/861422 and its subdirectories I: Current time: Fri Jan 27 16:46:10 -12 2023 I: pbuilder-time-stamp: 1674881170 Sat Dec 25 22:23:05 UTC 2021 I: 1st build successful. Starting 2nd build on remote node ionos11-amd64.debian.net. Sat Dec 25 22:23:05 UTC 2021 I: Preparing to do remote build '2' on ionos11-amd64.debian.net. Sat Dec 25 22:23:45 UTC 2021 I: Deleting $TMPDIR on ionos11-amd64.debian.net. Sat Dec 25 22:23:45 UTC 2021 I: dawg_1.2-3_amd64.changes: Format: 1.8 Date: Mon, 16 Nov 2020 10:20:01 +0100 Source: dawg Binary: dawg dawg-dbgsym Architecture: amd64 Version: 1.2-3 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team Changed-By: Andreas Tille Description: dawg - simulate the evolution of recombinant DNA sequences Changes: dawg (1.2-3) unstable; urgency=medium . * Team upload. * Standards-Version: 4.5.0 (routine-update) * debhelper-compat 13 (routine-update) * Respect DEB_BUILD_OPTIONS in override_dh_auto_test target (routine- update) * autopkgtest: s/ADTTMP/AUTOPKGTEST_TMP/g (routine-update) * Add salsa-ci file (routine-update) * Rules-Requires-Root: no (routine-update) * Set upstream metadata fields: Bug-Database, Bug-Submit, Repository, Repository-Browse. Checksums-Sha1: 57a15e20ca1ebad23ba2dda39117c602c3fad224 755724 dawg-dbgsym_1.2-3_amd64.deb ddb7928319e065e049adfaed06d7f3cebe4e81a0 5793 dawg_1.2-3_amd64.buildinfo e1b4bd98a0d03c151aeb60978068c73e96d187e6 76600 dawg_1.2-3_amd64.deb Checksums-Sha256: aa3971ad362f77eff598e3f86f796c57231acd161c6a7a8edff23c88fbf098eb 755724 dawg-dbgsym_1.2-3_amd64.deb dfebc91f41d72b4a744ef92142323d51628d47a9cbf08c8c2c438d6b74973bc0 5793 dawg_1.2-3_amd64.buildinfo 568c8ccda5da9ec26d00228b925fb9b023236d0c4aca11088d1e0d2c065adf30 76600 dawg_1.2-3_amd64.deb Files: 479912675d74b821319b2d597a0320d4 755724 debug optional dawg-dbgsym_1.2-3_amd64.deb 996f6fe005776ba76f0a94090e296494 5793 science optional dawg_1.2-3_amd64.buildinfo d3255083bfa426ce8a5376bcc341f41f 76600 science optional dawg_1.2-3_amd64.deb Sat Dec 25 22:23:46 UTC 2021 I: will be used to compare the two builds: # Profiling output for: /usr/bin/diffoscope --html /srv/reproducible-results/rbuild-debian/tmp.gDIa6cZ0NS/dawg_1.2-3.diffoscope.html --text /srv/reproducible-results/rbuild-debian/tmp.gDIa6cZ0NS/dawg_1.2-3.diffoscope.txt --json /srv/reproducible-results/rbuild-debian/tmp.gDIa6cZ0NS/dawg_1.2-3.diffoscope.json --profile=- /srv/reproducible-results/rbuild-debian/tmp.gDIa6cZ0NS/b1/dawg_1.2-3_amd64.changes /srv/reproducible-results/rbuild-debian/tmp.gDIa6cZ0NS/b2/dawg_1.2-3_amd64.changes ## command (total time: 0.000s) 0.000s 1 call cmp (internal) ## has_same_content_as (total time: 0.000s) 0.000s 1 call abc.DotChangesFile ## main (total time: 0.275s) 0.275s 2 calls outputs 0.000s 1 call cleanup ## recognizes (total time: 0.028s) 0.027s 10 calls diffoscope.comparators.binary.FilesystemFile 0.000s 8 calls abc.DotChangesFile Sat Dec 25 22:23:47 UTC 2021 I: found no differences in the changes files, and a .buildinfo file also exists. Sat Dec 25 22:23:47 UTC 2021 I: dawg from bullseye built successfully and reproducibly on amd64. Sat Dec 25 22:23:48 UTC 2021 I: Submitting .buildinfo files to external archives: Sat Dec 25 22:23:48 UTC 2021 I: Submitting 8.0K b1/dawg_1.2-3_amd64.buildinfo.asc Sat Dec 25 22:23:50 UTC 2021 I: Submitting 8.0K b2/dawg_1.2-3_amd64.buildinfo.asc Sat Dec 25 22:23:51 UTC 2021 I: Done submitting .buildinfo files to http://buildinfo.debian.net/api/submit. Sat Dec 25 22:23:51 UTC 2021 I: Done submitting .buildinfo files. Sat Dec 25 22:23:51 UTC 2021 I: Removing signed dawg_1.2-3_amd64.buildinfo.asc files: removed './b1/dawg_1.2-3_amd64.buildinfo.asc' removed './b2/dawg_1.2-3_amd64.buildinfo.asc'