Wed Apr 26 22:59:46 UTC 2023 I: starting to build seqprep/bookworm/i386 on jenkins on '2023-04-26 22:59' Wed Apr 26 22:59:46 UTC 2023 I: The jenkins build log is/was available at https://jenkins.debian.net/userContent/reproducible/debian/build_service/i386_10/12233/console.log Wed Apr 26 22:59:47 UTC 2023 I: Downloading source for bookworm/seqprep=1.3.2-8 --2023-04-26 22:59:47-- http://cdn-fastly.deb.debian.org/debian/pool/main/s/seqprep/seqprep_1.3.2-8.dsc Connecting to 78.137.99.97:3128... connected. Proxy request sent, awaiting response... 200 OK Length: 2143 (2.1K) [text/prs.lines.tag] Saving to: ‘seqprep_1.3.2-8.dsc’ 0K .. 100% 52.9M=0s 2023-04-26 22:59:47 (52.9 MB/s) - ‘seqprep_1.3.2-8.dsc’ saved [2143/2143] Wed Apr 26 22:59:47 UTC 2023 I: seqprep_1.3.2-8.dsc -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA512 Format: 3.0 (quilt) Source: seqprep Binary: seqprep, seqprep-data Architecture: any all Version: 1.3.2-8 Maintainer: Debian Med Packaging Team Uploaders: Tim Booth , Andreas Tille , Nilesh Patra Homepage: http://seqanswers.com/wiki/SeqPrep Standards-Version: 4.6.1 Vcs-Browser: https://salsa.debian.org/med-team/seqprep Vcs-Git: https://salsa.debian.org/med-team/seqprep.git Testsuite: autopkgtest Testsuite-Triggers: python3 Build-Depends: debhelper-compat (= 13), python3 , zlib1g-dev Package-List: seqprep deb science optional arch=any seqprep-data deb science optional arch=all Checksums-Sha1: 9f533e1fd14d310ba0ccd4ef38c3abc55b8fc5fd 37177540 seqprep_1.3.2.orig.tar.gz a175b2f7a43e532129f2bb5c81bbe464bd83c9d8 12180 seqprep_1.3.2-8.debian.tar.xz Checksums-Sha256: 2b8a462a0e0a3e51f70be7730dc77b1f2bb69e74845dd0fbd2110a921c32265a 37177540 seqprep_1.3.2.orig.tar.gz fb698cdd1545fa015eb7d966d108e81fdf2a0f9358e5fa83c860fd72029cecd7 12180 seqprep_1.3.2-8.debian.tar.xz Files: b6a4f5491dfdb0ce38bf791454151468 37177540 seqprep_1.3.2.orig.tar.gz c179b649ac1e8d34d347fc3aa3328767 12180 seqprep_1.3.2-8.debian.tar.xz -----BEGIN PGP SIGNATURE----- iQJFBAEBCgAvFiEE8fAHMgoDVUHwpmPKV4oElNHGRtEFAmOPWbURHHRpbGxlQGRl Ymlhbi5vcmcACgkQV4oElNHGRtGRbw/9EMTH/5FafL6zgw9OLR6GQxegzEAMBcqR hO2XHxgsYHVJTKrKnNcA18JVHmokdxNm8H9GwPYhg0XdITqvWdnOkR30QMvBWtS4 fz9cgrgiKFGhAAKHH5jJ7Cu2k9FW+KYp2uipqLkxYTR4cF4jP1c1BVDDHkgNgYKE 6AfFWq4L9BYSb1bhI/WbU04lNWIYkeoKxrZ+Z7hJY9uyoIeoq2D1Q6YgcVNdWhAj XpTE97Fp9vZigddYjLtixQS/Vb4+Jq3TRunlIirjAozCfRtlQOJMXtBN8YwFReny 5dHZzIvNmrmND7DrY5YHfkDS2FP9iOeZfGySSebDvhEL9U5rYrWWpJ+hrwjQZakL KMxMtLOIUUxttK9vDPLvedMmUubnvbuYN5VvDgDn6RIKvjyaLCw2h5T6WQ/5Ca2J IE5AVlFtcb2f2Tya0q+h7f6Oli+9AVlmNhgWlB/aNrUaQqdgBf68yCmd1Ebzh4Dc 8TFz7mzSiCVaiQU84Z6WQ8cbBxauSX5wiFXJgkO60p9/rCZ/T/xB3y2v5t+5nBwS aQHkJ/veB4f4+LmFW8lBB8XrcAz+DyQV8iNYCzVqR/cxYGKaLQ7aaW2oLyjpoait lCWowTPwh61Kue+OfHe8ptt89kWpATeR1V4ybQaa0WlTMlecEisl/jxMQjhmwDmT eHSlcTzv57U= =Sf2w -----END PGP SIGNATURE----- Wed Apr 26 22:59:47 UTC 2023 I: Checking whether the package is not for us Wed Apr 26 22:59:47 UTC 2023 I: Starting 1st build on remote node ionos6-i386.debian.net. Wed Apr 26 22:59:47 UTC 2023 I: Preparing to do remote build '1' on ionos6-i386.debian.net. Wed Apr 26 23:01:00 UTC 2023 I: Deleting $TMPDIR on ionos6-i386.debian.net. I: pbuilder: network access will be disabled during build I: Current time: Tue May 28 17:22:50 -12 2024 I: pbuilder-time-stamp: 1716960170 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/bookworm-reproducible-base.tgz] I: copying local configuration W: --override-config is not set; not updating apt.conf Read the manpage for details. I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: using eatmydata during job I: Copying source file I: copying [seqprep_1.3.2-8.dsc] I: copying [./seqprep_1.3.2.orig.tar.gz] I: copying [./seqprep_1.3.2-8.debian.tar.xz] I: Extracting source gpgv: Signature made Tue Dec 6 03:03:17 2022 -12 gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 gpgv: issuer "tille@debian.org" gpgv: Can't check signature: No public key dpkg-source: warning: cannot verify inline signature for ./seqprep_1.3.2-8.dsc: no acceptable signature found dpkg-source: info: extracting seqprep in seqprep-1.3.2 dpkg-source: info: unpacking seqprep_1.3.2.orig.tar.gz dpkg-source: info: unpacking seqprep_1.3.2-8.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying fix_unused_variable_errors.patch dpkg-source: info: applying hardening.patch dpkg-source: info: applying replace-float-with-double.patch dpkg-source: info: applying 2to3.patch I: Not using root during the build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/37550/tmp/hooks/D02_print_environment starting I: set BUILDDIR='/build' BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' BUILDUSERNAME='pbuilder1' BUILD_ARCH='i386' DEBIAN_FRONTEND='noninteractive' DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=16' DISTRIBUTION='bookworm' HOME='/root' HOST_ARCH='i386' IFS=' ' INVOCATION_ID='120449bf8432464ead873ec8d0c59091' LANG='C' LANGUAGE='en_US:en' LC_ALL='C' LD_LIBRARY_PATH='/usr/lib/libeatmydata' LD_PRELOAD='libeatmydata.so' MAIL='/var/mail/root' OPTIND='1' PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' PBCURRENTCOMMANDLINEOPERATION='build' PBUILDER_OPERATION='build' PBUILDER_PKGDATADIR='/usr/share/pbuilder' PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' PBUILDER_SYSCONFDIR='/etc' PPID='37550' PS1='# ' PS2='> ' PS4='+ ' PWD='/' SHELL='/bin/bash' SHLVL='2' SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.IPQ6UWc1/pbuilderrc_txuN --distribution bookworm --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/bookworm-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.IPQ6UWc1/b1 --logfile b1/build.log seqprep_1.3.2-8.dsc' SUDO_GID='112' SUDO_UID='107' SUDO_USER='jenkins' TERM='unknown' TZ='/usr/share/zoneinfo/Etc/GMT+12' USER='root' _='/usr/bin/systemd-run' http_proxy='http://85.184.249.68:3128' I: uname -a Linux ionos6-i386 5.10.0-21-amd64 #1 SMP Debian 5.10.162-1 (2023-01-21) x86_64 GNU/Linux I: ls -l /bin total 6036 -rwxr-xr-x 1 root root 1408088 Apr 23 2023 bash -rwxr-xr-x 3 root root 38404 Sep 18 2022 bunzip2 -rwxr-xr-x 3 root root 38404 Sep 18 2022 bzcat lrwxrwxrwx 1 root root 6 Sep 18 2022 bzcmp -> bzdiff -rwxr-xr-x 1 root root 2225 Sep 18 2022 bzdiff lrwxrwxrwx 1 root root 6 Sep 18 2022 bzegrep -> bzgrep -rwxr-xr-x 1 root root 4893 Nov 27 2021 bzexe lrwxrwxrwx 1 root root 6 Sep 18 2022 bzfgrep -> bzgrep -rwxr-xr-x 1 root root 3775 Sep 18 2022 bzgrep -rwxr-xr-x 3 root root 38404 Sep 18 2022 bzip2 -rwxr-xr-x 1 root root 17892 Sep 18 2022 bzip2recover lrwxrwxrwx 1 root root 6 Sep 18 2022 bzless -> bzmore -rwxr-xr-x 1 root root 1297 Sep 18 2022 bzmore -rwxr-xr-x 1 root root 42920 Sep 20 2022 cat -rwxr-xr-x 1 root root 79816 Sep 20 2022 chgrp -rwxr-xr-x 1 root root 67496 Sep 20 2022 chmod -rwxr-xr-x 1 root root 79816 Sep 20 2022 chown -rwxr-xr-x 1 root root 162024 Sep 20 2022 cp -rwxr-xr-x 1 root root 136916 Jan 5 2023 dash -rwxr-xr-x 1 root root 137160 Sep 20 2022 date -rwxr-xr-x 1 root root 100364 Sep 20 2022 dd -rwxr-xr-x 1 root root 108940 Sep 20 2022 df -rwxr-xr-x 1 root root 162152 Sep 20 2022 dir -rwxr-xr-x 1 root root 87760 Mar 22 2023 dmesg lrwxrwxrwx 1 root root 8 Dec 19 2022 dnsdomainname -> hostname lrwxrwxrwx 1 root root 8 Dec 19 2022 domainname -> hostname -rwxr-xr-x 1 root root 38760 Sep 20 2022 echo -rwxr-xr-x 1 root root 41 Jan 24 2023 egrep -rwxr-xr-x 1 root root 34664 Sep 20 2022 false -rwxr-xr-x 1 root root 41 Jan 24 2023 fgrep -rwxr-xr-x 1 root root 84272 Mar 22 2023 findmnt -rwsr-xr-x 1 root root 30240 Mar 22 2023 fusermount -rwxr-xr-x 1 root root 218680 Jan 24 2023 grep -rwxr-xr-x 2 root root 2346 Apr 9 2022 gunzip -rwxr-xr-x 1 root root 6447 Apr 9 2022 gzexe -rwxr-xr-x 1 root root 100952 Apr 9 2022 gzip -rwxr-xr-x 1 root root 21916 Dec 19 2022 hostname -rwxr-xr-x 1 root root 75756 Sep 20 2022 ln -rwxr-xr-x 1 root root 55600 Mar 22 2023 login -rwxr-xr-x 1 root root 162152 Sep 20 2022 ls -rwxr-xr-x 1 root root 214568 Mar 22 2023 lsblk -rwxr-xr-x 1 root root 96328 Sep 20 2022 mkdir -rwxr-xr-x 1 root root 84008 Sep 20 2022 mknod -rwxr-xr-x 1 root root 38792 Sep 20 2022 mktemp -rwxr-xr-x 1 root root 63016 Mar 22 2023 more -rwsr-xr-x 1 root root 58912 Mar 22 2023 mount -rwxr-xr-x 1 root root 13856 Mar 22 2023 mountpoint -rwxr-xr-x 1 root root 157932 Sep 20 2022 mv lrwxrwxrwx 1 root root 8 Dec 19 2022 nisdomainname -> hostname lrwxrwxrwx 1 root root 14 Apr 2 2023 pidof -> /sbin/killall5 -rwxr-xr-x 1 root root 38792 Sep 20 2022 pwd lrwxrwxrwx 1 root root 4 Apr 23 2023 rbash -> bash -rwxr-xr-x 1 root root 51080 Sep 20 2022 readlink -rwxr-xr-x 1 root root 75720 Sep 20 2022 rm -rwxr-xr-x 1 root root 51080 Sep 20 2022 rmdir -rwxr-xr-x 1 root root 22308 Nov 2 2022 run-parts -rwxr-xr-x 1 root root 133224 Jan 5 2023 sed lrwxrwxrwx 1 root root 4 Jan 5 2023 sh -> dash -rwxr-xr-x 1 root root 38760 Sep 20 2022 sleep -rwxr-xr-x 1 root root 87976 Sep 20 2022 stty -rwsr-xr-x 1 root root 83492 Mar 22 2023 su -rwxr-xr-x 1 root root 38792 Sep 20 2022 sync -rwxr-xr-x 1 root root 598456 Apr 6 2023 tar -rwxr-xr-x 1 root root 13860 Nov 2 2022 tempfile -rwxr-xr-x 1 root root 120776 Sep 20 2022 touch -rwxr-xr-x 1 root root 34664 Sep 20 2022 true -rwxr-xr-x 1 root root 17892 Mar 22 2023 ulockmgr_server -rwsr-xr-x 1 root root 30236 Mar 22 2023 umount -rwxr-xr-x 1 root root 38760 Sep 20 2022 uname -rwxr-xr-x 2 root root 2346 Apr 9 2022 uncompress -rwxr-xr-x 1 root root 162152 Sep 20 2022 vdir -rwxr-xr-x 1 root root 71216 Mar 22 2023 wdctl lrwxrwxrwx 1 root root 8 Dec 19 2022 ypdomainname -> hostname -rwxr-xr-x 1 root root 1984 Apr 9 2022 zcat -rwxr-xr-x 1 root root 1678 Apr 9 2022 zcmp -rwxr-xr-x 1 root root 6460 Apr 9 2022 zdiff -rwxr-xr-x 1 root root 29 Apr 9 2022 zegrep -rwxr-xr-x 1 root root 29 Apr 9 2022 zfgrep -rwxr-xr-x 1 root root 2081 Apr 9 2022 zforce -rwxr-xr-x 1 root root 8103 Apr 9 2022 zgrep -rwxr-xr-x 1 root root 2206 Apr 9 2022 zless -rwxr-xr-x 1 root root 1842 Apr 9 2022 zmore -rwxr-xr-x 1 root root 4577 Apr 9 2022 znew I: user script /srv/workspace/pbuilder/37550/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: i386 Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 13), python3, zlib1g-dev dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19604 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 13); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on python3; however: Package python3 is not installed. pbuilder-satisfydepends-dummy depends on zlib1g-dev; however: Package zlib1g-dev is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} automake{a} autopoint{a} autotools-dev{a} bsdextrautils{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} gettext{a} gettext-base{a} groff-base{a} intltool-debian{a} libarchive-zip-perl{a} libdebhelper-perl{a} libelf1{a} libexpat1{a} libfile-stripnondeterminism-perl{a} libicu72{a} libmagic-mgc{a} libmagic1{a} libpipeline1{a} libpython3-stdlib{a} libpython3.11-minimal{a} libpython3.11-stdlib{a} libreadline8{a} libsub-override-perl{a} libtool{a} libuchardet0{a} libxml2{a} m4{a} man-db{a} media-types{a} po-debconf{a} python3{a} python3-minimal{a} python3.11{a} python3.11-minimal{a} readline-common{a} sensible-utils{a} zlib1g-dev{a} The following packages are RECOMMENDED but will NOT be installed: ca-certificates curl libarchive-cpio-perl libltdl-dev libmail-sendmail-perl lynx wget 0 packages upgraded, 42 newly installed, 0 to remove and 0 not upgraded. Need to get 25.7 MB of archives. After unpacking 96.4 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian bookworm/main i386 libpython3.11-minimal i386 3.11.2-6 [813 kB] Get: 2 http://deb.debian.org/debian bookworm/main i386 libexpat1 i386 2.5.0-1 [103 kB] Get: 3 http://deb.debian.org/debian bookworm/main i386 python3.11-minimal i386 3.11.2-6 [2130 kB] Get: 4 http://deb.debian.org/debian bookworm/main i386 python3-minimal i386 3.11.2-1+b1 [26.3 kB] Get: 5 http://deb.debian.org/debian bookworm/main i386 media-types all 10.0.0 [26.1 kB] Get: 6 http://deb.debian.org/debian bookworm/main i386 readline-common all 8.2-1.3 [69.0 kB] Get: 7 http://deb.debian.org/debian bookworm/main i386 libreadline8 i386 8.2-1.3 [171 kB] Get: 8 http://deb.debian.org/debian bookworm/main i386 libpython3.11-stdlib i386 3.11.2-6 [1799 kB] Get: 9 http://deb.debian.org/debian bookworm/main i386 python3.11 i386 3.11.2-6 [572 kB] Get: 10 http://deb.debian.org/debian bookworm/main i386 libpython3-stdlib i386 3.11.2-1+b1 [9308 B] Get: 11 http://deb.debian.org/debian bookworm/main i386 python3 i386 3.11.2-1+b1 [26.3 kB] Get: 12 http://deb.debian.org/debian bookworm/main i386 sensible-utils all 0.0.17+nmu1 [19.0 kB] Get: 13 http://deb.debian.org/debian bookworm/main i386 libmagic-mgc i386 1:5.44-3 [305 kB] Get: 14 http://deb.debian.org/debian bookworm/main i386 libmagic1 i386 1:5.44-3 [114 kB] Get: 15 http://deb.debian.org/debian bookworm/main i386 file i386 1:5.44-3 [42.5 kB] Get: 16 http://deb.debian.org/debian bookworm/main i386 gettext-base i386 0.21-12 [162 kB] Get: 17 http://deb.debian.org/debian bookworm/main i386 libuchardet0 i386 0.0.7-1 [67.9 kB] Get: 18 http://deb.debian.org/debian bookworm/main i386 groff-base i386 1.22.4-10 [932 kB] Get: 19 http://deb.debian.org/debian bookworm/main i386 bsdextrautils i386 2.38.1-5+b1 [90.3 kB] Get: 20 http://deb.debian.org/debian bookworm/main i386 libpipeline1 i386 1.5.7-1 [40.0 kB] Get: 21 http://deb.debian.org/debian bookworm/main i386 man-db i386 2.11.2-2 [1397 kB] Get: 22 http://deb.debian.org/debian bookworm/main i386 m4 i386 1.4.19-3 [294 kB] Get: 23 http://deb.debian.org/debian bookworm/main i386 autoconf all 2.71-3 [332 kB] Get: 24 http://deb.debian.org/debian bookworm/main i386 autotools-dev all 20220109.1 [51.6 kB] Get: 25 http://deb.debian.org/debian bookworm/main i386 automake all 1:1.16.5-1.3 [823 kB] Get: 26 http://deb.debian.org/debian bookworm/main i386 autopoint all 0.21-12 [495 kB] Get: 27 http://deb.debian.org/debian bookworm/main i386 libdebhelper-perl all 13.11.4 [81.2 kB] Get: 28 http://deb.debian.org/debian bookworm/main i386 libtool all 2.4.7-5 [517 kB] Get: 29 http://deb.debian.org/debian bookworm/main i386 dh-autoreconf all 20 [17.1 kB] Get: 30 http://deb.debian.org/debian bookworm/main i386 libarchive-zip-perl all 1.68-1 [104 kB] Get: 31 http://deb.debian.org/debian bookworm/main i386 libsub-override-perl all 0.09-4 [9304 B] Get: 32 http://deb.debian.org/debian bookworm/main i386 libfile-stripnondeterminism-perl all 1.13.1-1 [19.4 kB] Get: 33 http://deb.debian.org/debian bookworm/main i386 dh-strip-nondeterminism all 1.13.1-1 [8620 B] Get: 34 http://deb.debian.org/debian bookworm/main i386 libelf1 i386 0.188-2.1 [179 kB] Get: 35 http://deb.debian.org/debian bookworm/main i386 dwz i386 0.15-1 [118 kB] Get: 36 http://deb.debian.org/debian bookworm/main i386 libicu72 i386 72.1-3 [9541 kB] Get: 37 http://deb.debian.org/debian bookworm/main i386 libxml2 i386 2.9.14+dfsg-1.2 [720 kB] Get: 38 http://deb.debian.org/debian bookworm/main i386 gettext i386 0.21-12 [1311 kB] Get: 39 http://deb.debian.org/debian bookworm/main i386 intltool-debian all 0.35.0+20060710.6 [22.9 kB] Get: 40 http://deb.debian.org/debian bookworm/main i386 po-debconf all 1.0.21+nmu1 [248 kB] Get: 41 http://deb.debian.org/debian bookworm/main i386 debhelper all 13.11.4 [942 kB] Get: 42 http://deb.debian.org/debian bookworm/main i386 zlib1g-dev i386 1:1.2.13.dfsg-1 [913 kB] Fetched 25.7 MB in 0s (82.0 MB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package libpython3.11-minimal:i386. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19604 files and directories currently installed.) Preparing to unpack .../libpython3.11-minimal_3.11.2-6_i386.deb ... Unpacking libpython3.11-minimal:i386 (3.11.2-6) ... Selecting previously unselected package libexpat1:i386. Preparing to unpack .../libexpat1_2.5.0-1_i386.deb ... Unpacking libexpat1:i386 (2.5.0-1) ... Selecting previously unselected package python3.11-minimal. Preparing to unpack .../python3.11-minimal_3.11.2-6_i386.deb ... Unpacking python3.11-minimal (3.11.2-6) ... Setting up libpython3.11-minimal:i386 (3.11.2-6) ... Setting up libexpat1:i386 (2.5.0-1) ... Setting up python3.11-minimal (3.11.2-6) ... Selecting previously unselected package python3-minimal. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19920 files and directories currently installed.) Preparing to unpack .../0-python3-minimal_3.11.2-1+b1_i386.deb ... Unpacking python3-minimal (3.11.2-1+b1) ... Selecting previously unselected package media-types. Preparing to unpack .../1-media-types_10.0.0_all.deb ... Unpacking media-types (10.0.0) ... Selecting previously unselected package readline-common. Preparing to unpack .../2-readline-common_8.2-1.3_all.deb ... Unpacking readline-common (8.2-1.3) ... Selecting previously unselected package libreadline8:i386. Preparing to unpack .../3-libreadline8_8.2-1.3_i386.deb ... Unpacking libreadline8:i386 (8.2-1.3) ... Selecting previously unselected package libpython3.11-stdlib:i386. Preparing to unpack .../4-libpython3.11-stdlib_3.11.2-6_i386.deb ... Unpacking libpython3.11-stdlib:i386 (3.11.2-6) ... Selecting previously unselected package python3.11. Preparing to unpack .../5-python3.11_3.11.2-6_i386.deb ... Unpacking python3.11 (3.11.2-6) ... Selecting previously unselected package libpython3-stdlib:i386. Preparing to unpack .../6-libpython3-stdlib_3.11.2-1+b1_i386.deb ... Unpacking libpython3-stdlib:i386 (3.11.2-1+b1) ... Setting up python3-minimal (3.11.2-1+b1) ... Selecting previously unselected package python3. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20354 files and directories currently installed.) Preparing to unpack .../00-python3_3.11.2-1+b1_i386.deb ... Unpacking python3 (3.11.2-1+b1) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../01-sensible-utils_0.0.17+nmu1_all.deb ... Unpacking sensible-utils (0.0.17+nmu1) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../02-libmagic-mgc_1%3a5.44-3_i386.deb ... Unpacking libmagic-mgc (1:5.44-3) ... Selecting previously unselected package libmagic1:i386. Preparing to unpack .../03-libmagic1_1%3a5.44-3_i386.deb ... Unpacking libmagic1:i386 (1:5.44-3) ... Selecting previously unselected package file. Preparing to unpack .../04-file_1%3a5.44-3_i386.deb ... Unpacking file (1:5.44-3) ... Selecting previously unselected package gettext-base. Preparing to unpack .../05-gettext-base_0.21-12_i386.deb ... Unpacking gettext-base (0.21-12) ... Selecting previously unselected package libuchardet0:i386. Preparing to unpack .../06-libuchardet0_0.0.7-1_i386.deb ... Unpacking libuchardet0:i386 (0.0.7-1) ... Selecting previously unselected package groff-base. Preparing to unpack .../07-groff-base_1.22.4-10_i386.deb ... Unpacking groff-base (1.22.4-10) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../08-bsdextrautils_2.38.1-5+b1_i386.deb ... Unpacking bsdextrautils (2.38.1-5+b1) ... Selecting previously unselected package libpipeline1:i386. Preparing to unpack .../09-libpipeline1_1.5.7-1_i386.deb ... Unpacking libpipeline1:i386 (1.5.7-1) ... Selecting previously unselected package man-db. Preparing to unpack .../10-man-db_2.11.2-2_i386.deb ... Unpacking man-db (2.11.2-2) ... Selecting previously unselected package m4. Preparing to unpack .../11-m4_1.4.19-3_i386.deb ... Unpacking m4 (1.4.19-3) ... Selecting previously unselected package autoconf. Preparing to unpack .../12-autoconf_2.71-3_all.deb ... Unpacking autoconf (2.71-3) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../13-autotools-dev_20220109.1_all.deb ... Unpacking autotools-dev (20220109.1) ... Selecting previously unselected package automake. Preparing to unpack .../14-automake_1%3a1.16.5-1.3_all.deb ... Unpacking automake (1:1.16.5-1.3) ... Selecting previously unselected package autopoint. Preparing to unpack .../15-autopoint_0.21-12_all.deb ... Unpacking autopoint (0.21-12) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../16-libdebhelper-perl_13.11.4_all.deb ... Unpacking libdebhelper-perl (13.11.4) ... Selecting previously unselected package libtool. Preparing to unpack .../17-libtool_2.4.7-5_all.deb ... Unpacking libtool (2.4.7-5) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../18-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../19-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libsub-override-perl. Preparing to unpack .../20-libsub-override-perl_0.09-4_all.deb ... Unpacking libsub-override-perl (0.09-4) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../21-libfile-stripnondeterminism-perl_1.13.1-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.13.1-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../22-dh-strip-nondeterminism_1.13.1-1_all.deb ... Unpacking dh-strip-nondeterminism (1.13.1-1) ... Selecting previously unselected package libelf1:i386. Preparing to unpack .../23-libelf1_0.188-2.1_i386.deb ... Unpacking libelf1:i386 (0.188-2.1) ... Selecting previously unselected package dwz. Preparing to unpack .../24-dwz_0.15-1_i386.deb ... Unpacking dwz (0.15-1) ... Selecting previously unselected package libicu72:i386. Preparing to unpack .../25-libicu72_72.1-3_i386.deb ... Unpacking libicu72:i386 (72.1-3) ... Selecting previously unselected package libxml2:i386. Preparing to unpack .../26-libxml2_2.9.14+dfsg-1.2_i386.deb ... Unpacking libxml2:i386 (2.9.14+dfsg-1.2) ... Selecting previously unselected package gettext. Preparing to unpack .../27-gettext_0.21-12_i386.deb ... Unpacking gettext (0.21-12) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../28-intltool-debian_0.35.0+20060710.6_all.deb ... Unpacking intltool-debian (0.35.0+20060710.6) ... Selecting previously unselected package po-debconf. Preparing to unpack .../29-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../30-debhelper_13.11.4_all.deb ... Unpacking debhelper (13.11.4) ... Selecting previously unselected package zlib1g-dev:i386. Preparing to unpack .../31-zlib1g-dev_1%3a1.2.13.dfsg-1_i386.deb ... Unpacking zlib1g-dev:i386 (1:1.2.13.dfsg-1) ... Setting up media-types (10.0.0) ... Setting up libpipeline1:i386 (1.5.7-1) ... Setting up libicu72:i386 (72.1-3) ... Setting up bsdextrautils (2.38.1-5+b1) ... Setting up libmagic-mgc (1:5.44-3) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libdebhelper-perl (13.11.4) ... Setting up libmagic1:i386 (1:5.44-3) ... Setting up gettext-base (0.21-12) ... Setting up m4 (1.4.19-3) ... Setting up file (1:5.44-3) ... Setting up autotools-dev (20220109.1) ... Setting up autopoint (0.21-12) ... Setting up autoconf (2.71-3) ... Setting up zlib1g-dev:i386 (1:1.2.13.dfsg-1) ... Setting up sensible-utils (0.0.17+nmu1) ... Setting up libuchardet0:i386 (0.0.7-1) ... Setting up libsub-override-perl (0.09-4) ... Setting up libelf1:i386 (0.188-2.1) ... Setting up readline-common (8.2-1.3) ... Setting up libxml2:i386 (2.9.14+dfsg-1.2) ... Setting up automake (1:1.16.5-1.3) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up libfile-stripnondeterminism-perl (1.13.1-1) ... Setting up gettext (0.21-12) ... Setting up libtool (2.4.7-5) ... Setting up libreadline8:i386 (8.2-1.3) ... Setting up intltool-debian (0.35.0+20060710.6) ... Setting up dh-autoreconf (20) ... Setting up dh-strip-nondeterminism (1.13.1-1) ... Setting up dwz (0.15-1) ... Setting up groff-base (1.22.4-10) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up libpython3.11-stdlib:i386 (3.11.2-6) ... Setting up man-db (2.11.2-2) ... Not building database; man-db/auto-update is not 'true'. Setting up libpython3-stdlib:i386 (3.11.2-1+b1) ... Setting up python3.11 (3.11.2-6) ... Setting up debhelper (13.11.4) ... Setting up python3 (3.11.2-1+b1) ... Processing triggers for libc-bin (2.36-9) ... Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps I: Building the package I: Running cd /build/seqprep-1.3.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../seqprep_1.3.2-8_source.changes dpkg-buildpackage: info: source package seqprep dpkg-buildpackage: info: source version 1.3.2-8 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Andreas Tille dpkg-source --before-build . dpkg-buildpackage: info: host architecture i386 debian/rules clean dh clean dh_auto_clean make -j16 clean make[1]: Entering directory '/build/seqprep-1.3.2' rm -f SeqPrep.o utils.o stdaln.o SeqPrep make[1]: Leaving directory '/build/seqprep-1.3.2' debian/rules override_dh_clean make[1]: Entering directory '/build/seqprep-1.3.2' dh_clean rm -f seqprep rm -f README.html make[1]: Leaving directory '/build/seqprep-1.3.2' debian/rules binary dh binary dh_update_autotools_config dh_autoreconf dh_auto_configure debian/rules override_dh_auto_build make[1]: Entering directory '/build/seqprep-1.3.2' dh_auto_build make -j16 "INSTALL=install --strip-program=true" make[2]: Entering directory '/build/seqprep-1.3.2' cc -g -O2 -ffile-prefix-map=/build/seqprep-1.3.2=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 SeqPrep.c -o SeqPrep.o cc -g -O2 -ffile-prefix-map=/build/seqprep-1.3.2=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 utils.c -o utils.o cc -g -O2 -ffile-prefix-map=/build/seqprep-1.3.2=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 stdaln.c -o stdaln.o SeqPrep.c: In function 'main': SeqPrep.c:166:15: warning: implicit declaration of function 'getopt' [-Wimplicit-function-declaration] 166 | while( (ich=getopt( argc, argv, "f:r:1:2:3:4:q:A:s:y:B:O:E:x:M:N:L:o:m:b:w:W:p:P:X:Q:t:e:Z:n:S6ghz" )) != -1 ) { | ^~~~~~ cc SeqPrep.o utils.o stdaln.o -Wl,-z,relro -Wl,-z,now -lz -lm -o SeqPrep make[2]: Leaving directory '/build/seqprep-1.3.2' cp SeqPrep seqprep mv /build/seqprep-1.3.2/debian/README.html /build/seqprep-1.3.2 make[1]: Leaving directory '/build/seqprep-1.3.2' debian/rules override_dh_auto_test make[1]: Entering directory '/build/seqprep-1.3.2' # This checks that the tests run and produce byte-identical results. cd Test && mkdir -p out info && \ bash -xc 'gzcat(){ zcat "$@" ; } ; . RUNTEST.sh' + . RUNTEST.sh ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_merged_1.fastq.gz -2 ./out/pe_bad_contam_merged_2.fastq.gz -s ./out/pe_bad_contam_merged_s.fastq.gz -E ./info/alignments_merged.txt.gz Pairs Processed: 0 Pairs Merged: 14314 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.215443 ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_trimmed_1.fastq.gz -2 ./out/pe_bad_contam_trimmed_2.fastq.gz -E ./info/alignments_trimmed.txt.gz Pairs Processed: 0 Pairs Merged: 0 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.201334 ++ prog=gzcat ++ gzcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ zcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ zcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_1.fastq.gz ++ zcat ./out/pe_bad_contam_merged_1.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_2.fastq.gz ++ zcat ./out/pe_bad_contam_merged_2.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_s.fastq.gz ++ zcat ./out/pe_bad_contam_merged_s.fastq.gz ++ python3 seqlens.py [ `cat Test/info/pe_*.txt | md5sum | cut -b -10` = 8bc8e0787e ] # remove output dirs right after testing to make sure the files # will not be included in the data package rm -rf Test/info Test/out make[1]: Leaving directory '/build/seqprep-1.3.2' create-stamp debian/debhelper-build-stamp dh_prep dh_auto_install make -j16 install DESTDIR=/build/seqprep-1.3.2/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[1]: Entering directory '/build/seqprep-1.3.2' cp SeqPrep /build/seqprep-1.3.2/debian/.debhelper/generated/_source/home/bin make[1]: Leaving directory '/build/seqprep-1.3.2' debian/rules override_dh_install-indep make[1]: Entering directory '/build/seqprep-1.3.2' dh_install sed -i 's#../SeqPrep#/usr/bin/seqprep#' /build/seqprep-1.3.2/debian/seqprep-data/usr/share/doc/seqprep/examples/RUNTEST.sh make[1]: Leaving directory '/build/seqprep-1.3.2' dh_install -Nseqprep-data dh_installdocs dh_installchangelogs dh_installman dh_perl dh_link dh_strip_nondeterminism dh_compress dh_fixperms dh_missing dh_dwz -a dh_strip -a dh_makeshlibs -a dh_shlibdeps -a dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'seqprep' in '../seqprep_1.3.2-8_i386.deb'. dpkg-deb: building package 'seqprep-dbgsym' in '../seqprep-dbgsym_1.3.2-8_i386.deb'. dpkg-deb: building package 'seqprep-data' in '../seqprep-data_1.3.2-8_all.deb'. dpkg-genbuildinfo --build=binary -O../seqprep_1.3.2-8_i386.buildinfo dpkg-genchanges --build=binary -O../seqprep_1.3.2-8_i386.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/37550 and its subdirectories I: Current time: Tue May 28 17:23:59 -12 2024 I: pbuilder-time-stamp: 1716960239 Wed Apr 26 23:01:01 UTC 2023 I: 1st build successful. Starting 2nd build on remote node ionos2-i386.debian.net. Wed Apr 26 23:01:01 UTC 2023 I: Preparing to do remote build '2' on ionos2-i386.debian.net. Wed Apr 26 23:02:37 UTC 2023 I: Deleting $TMPDIR on ionos2-i386.debian.net. Wed Apr 26 23:02:38 UTC 2023 I: seqprep_1.3.2-8_i386.changes: Format: 1.8 Date: Tue, 06 Dec 2022 15:59:49 +0100 Source: seqprep Binary: seqprep seqprep-data seqprep-dbgsym Architecture: all i386 Version: 1.3.2-8 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team Changed-By: Andreas Tille Description: seqprep - stripping adaptors and/or merging paired reads of DNA sequences w seqprep-data - example data set for seqprep - only used for testing Changes: seqprep (1.3.2-8) unstable; urgency=medium . * Fix watch file * Standards-Version: 4.6.1 (routine-update) * lintian-overrides (see lintian bug #1017966) Checksums-Sha1: f3c5d02edd55042b47b16ed9a19f3aadf6e56707 35859620 seqprep-data_1.3.2-8_all.deb 00291b420fd98bbf596287c62fa41df45ac57e30 19144 seqprep-dbgsym_1.3.2-8_i386.deb b108c78e65d660c930e21b81e5c1f073fb0099cc 5777 seqprep_1.3.2-8_i386.buildinfo 8d9bba035060198d2bcadbf7935ed692d198fde5 27812 seqprep_1.3.2-8_i386.deb Checksums-Sha256: 6145b1197c4451ff19b1ce1351c0d2fad9bcddc79a11924371155355d04bbf16 35859620 seqprep-data_1.3.2-8_all.deb 53f450aa516dece8de0b172caab752d1804c923151d5a5773882d363d858f7f1 19144 seqprep-dbgsym_1.3.2-8_i386.deb e280fe7f0975f1219a5d94568dc4568a2e166247b1d3ccfb2a0759916dc1c51f 5777 seqprep_1.3.2-8_i386.buildinfo d91379c08e164ca92f485c3b8b813e5c9ac81979398eba4936a632ab85425df0 27812 seqprep_1.3.2-8_i386.deb Files: 42e7fb259d82acaf8695831e10159022 35859620 science optional seqprep-data_1.3.2-8_all.deb 6655ee220135574dfda70a2ec7382c08 19144 debug optional seqprep-dbgsym_1.3.2-8_i386.deb 00c6a4cb7cb5bf7ceb91d0432209cc2b 5777 science optional seqprep_1.3.2-8_i386.buildinfo 7736c559dc08587afafc37f12bb89a45 27812 science optional seqprep_1.3.2-8_i386.deb Wed Apr 26 23:02:39 UTC 2023 I: diffoscope 241 will be used to compare the two builds: # Profiling output for: /usr/bin/diffoscope --timeout 7200 --html /srv/reproducible-results/rbuild-debian/r-b-build.IPQ6UWc1/seqprep_1.3.2-8.diffoscope.html --text /srv/reproducible-results/rbuild-debian/r-b-build.IPQ6UWc1/seqprep_1.3.2-8.diffoscope.txt --json /srv/reproducible-results/rbuild-debian/r-b-build.IPQ6UWc1/seqprep_1.3.2-8.diffoscope.json --profile=- /srv/reproducible-results/rbuild-debian/r-b-build.IPQ6UWc1/b1/seqprep_1.3.2-8_i386.changes /srv/reproducible-results/rbuild-debian/r-b-build.IPQ6UWc1/b2/seqprep_1.3.2-8_i386.changes ## command (total time: 0.000s) 0.000s 1 call cmp (internal) ## has_same_content_as (total time: 0.000s) 0.000s 1 call abc.DotChangesFile ## main (total time: 1.472s) 1.472s 2 calls outputs 0.000s 1 call cleanup ## recognizes (total time: 0.984s) 0.984s 12 calls diffoscope.comparators.binary.FilesystemFile 0.000s 10 calls abc.DotChangesFile ## specialize (total time: 0.000s) 0.000s 1 call specialize Wed Apr 26 23:04:59 UTC 2023 I: diffoscope 241 found no differences in the changes files, and a .buildinfo file also exists. Wed Apr 26 23:04:59 UTC 2023 I: seqprep from bookworm built successfully and reproducibly on i386. Wed Apr 26 23:05:01 UTC 2023 I: Submitting .buildinfo files to external archives: Wed Apr 26 23:05:01 UTC 2023 I: Submitting 8.0K b1/seqprep_1.3.2-8_i386.buildinfo.asc Wed Apr 26 23:05:03 UTC 2023 I: Submitting 8.0K b2/seqprep_1.3.2-8_i386.buildinfo.asc Wed Apr 26 23:05:08 UTC 2023 I: Done submitting .buildinfo files to http://buildinfo.debian.net/api/submit. Wed Apr 26 23:05:08 UTC 2023 I: Done submitting .buildinfo files. Wed Apr 26 23:05:08 UTC 2023 I: Removing signed seqprep_1.3.2-8_i386.buildinfo.asc files: removed './b1/seqprep_1.3.2-8_i386.buildinfo.asc' removed './b2/seqprep_1.3.2-8_i386.buildinfo.asc'