I: pbuilder: network access will be disabled during build I: Current time: Sun Jul 18 14:03:05 -12 2021 I: pbuilder-time-stamp: 1626660185 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/bullseye-reproducible-base.tgz] I: copying local configuration I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: Copying source file I: copying [dawg_1.2-3.dsc] I: copying [./dawg_1.2.orig.tar.gz] I: copying [./dawg_1.2-3.debian.tar.xz] I: Extracting source gpgv: unknown type of key resource 'trustedkeys.kbx' gpgv: keyblock resource '/tmp/dpkg-verify-sig.5V3enLKM/trustedkeys.kbx': General error gpgv: Signature made Sun Nov 15 21:30:50 2020 -12 gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 gpgv: issuer "tille@debian.org" gpgv: Can't check signature: No public key dpkg-source: warning: failed to verify signature on ./dawg_1.2-3.dsc dpkg-source: info: extracting dawg in dawg-1.2 dpkg-source: info: unpacking dawg_1.2.orig.tar.gz dpkg-source: info: unpacking dawg_1.2-3.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying 0001-Add-missing-include-of-cstring.patch dpkg-source: info: applying 0003-Don-t-override-install-directories.patch dpkg-source: info: applying 0004-Fix-typo-in-help-text.patch dpkg-source: info: applying 0005-Remove-Encoding-add-Keywords-to-dawg.desktop.patch dpkg-source: info: applying 0006-relative-path-in-test-script.patch I: Not using root during the build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/31703/tmp/hooks/D02_print_environment starting I: set BUILDDIR='/build' BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' BUILDUSERNAME='pbuilder1' BUILD_ARCH='armhf' DEBIAN_FRONTEND='noninteractive' DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all,-fixfilepath parallel=3' DISTRIBUTION='' HOME='/root' HOST_ARCH='armhf' IFS=' ' INVOCATION_ID='22dc42c38f3a4ec2ab5fa8b2f1390ebe' LANG='C' LANGUAGE='en_US:en' LC_ALL='C' MAIL='/var/mail/root' OPTIND='1' PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' PBCURRENTCOMMANDLINEOPERATION='build' PBUILDER_OPERATION='build' PBUILDER_PKGDATADIR='/usr/share/pbuilder' PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' PBUILDER_SYSCONFDIR='/etc' PPID='31703' PS1='# ' PS2='> ' PS4='+ ' PWD='/' SHELL='/bin/bash' SHLVL='2' SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/tmp.xgMFI7D1o3/pbuilderrc_j1qR --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/bullseye-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/tmp.xgMFI7D1o3/b1 --logfile b1/build.log dawg_1.2-3.dsc' SUDO_GID='116' SUDO_UID='112' SUDO_USER='jenkins' TERM='unknown' TZ='/usr/share/zoneinfo/Etc/GMT+12' USER='root' _='/usr/bin/systemd-run' http_proxy='http://10.0.0.15:8000/' I: uname -a Linux cbxi4b 5.10.0-7-armmp #1 SMP Debian 5.10.40-1 (2021-05-28) armv7l GNU/Linux I: ls -l /bin total 3580 -rwxr-xr-x 1 root root 816764 Jun 21 14:26 bash -rwxr-xr-x 3 root root 26052 Jul 20 2020 bunzip2 -rwxr-xr-x 3 root root 26052 Jul 20 2020 bzcat lrwxrwxrwx 1 root root 6 Jul 20 2020 bzcmp -> bzdiff -rwxr-xr-x 1 root root 2225 Jul 20 2020 bzdiff lrwxrwxrwx 1 root root 6 Jul 20 2020 bzegrep -> bzgrep -rwxr-xr-x 1 root root 4877 Sep 4 2019 bzexe lrwxrwxrwx 1 root root 6 Jul 20 2020 bzfgrep -> bzgrep -rwxr-xr-x 1 root root 3775 Jul 20 2020 bzgrep -rwxr-xr-x 3 root root 26052 Jul 20 2020 bzip2 -rwxr-xr-x 1 root root 9636 Jul 20 2020 bzip2recover lrwxrwxrwx 1 root root 6 Jul 20 2020 bzless -> bzmore -rwxr-xr-x 1 root root 1297 Jul 20 2020 bzmore -rwxr-xr-x 1 root root 26668 Sep 22 2020 cat -rwxr-xr-x 1 root root 43104 Sep 22 2020 chgrp -rwxr-xr-x 1 root root 38984 Sep 22 2020 chmod -rwxr-xr-x 1 root root 43112 Sep 22 2020 chown -rwxr-xr-x 1 root root 92616 Sep 22 2020 cp -rwxr-xr-x 1 root root 75524 Dec 10 2020 dash -rwxr-xr-x 1 root root 75880 Sep 22 2020 date -rwxr-xr-x 1 root root 55436 Sep 22 2020 dd -rwxr-xr-x 1 root root 59912 Sep 22 2020 df -rwxr-xr-x 1 root root 96764 Sep 22 2020 dir -rwxr-xr-x 1 root root 55012 Feb 7 02:38 dmesg lrwxrwxrwx 1 root root 8 Nov 6 2019 dnsdomainname -> hostname lrwxrwxrwx 1 root root 8 Nov 6 2019 domainname -> hostname -rwxr-xr-x 1 root root 22508 Sep 22 2020 echo -rwxr-xr-x 1 root root 28 Nov 9 2020 egrep -rwxr-xr-x 1 root root 22496 Sep 22 2020 false -rwxr-xr-x 1 root root 28 Nov 9 2020 fgrep -rwxr-xr-x 1 root root 47492 Feb 7 02:38 findmnt -rwsr-xr-x 1 root root 26076 Feb 26 04:12 fusermount -rwxr-xr-x 1 root root 124508 Nov 9 2020 grep -rwxr-xr-x 2 root root 2346 Mar 2 11:30 gunzip -rwxr-xr-x 1 root root 6376 Mar 2 11:30 gzexe -rwxr-xr-x 1 root root 64212 Mar 2 11:30 gzip -rwxr-xr-x 1 root root 13784 Nov 6 2019 hostname -rwxr-xr-x 1 root root 43180 Sep 22 2020 ln -rwxr-xr-x 1 root root 35068 Feb 7 2020 login -rwxr-xr-x 1 root root 96764 Sep 22 2020 ls -rwxr-xr-x 1 root root 99940 Feb 7 02:38 lsblk -rwxr-xr-x 1 root root 51408 Sep 22 2020 mkdir -rwxr-xr-x 1 root root 43184 Sep 22 2020 mknod -rwxr-xr-x 1 root root 30780 Sep 22 2020 mktemp -rwxr-xr-x 1 root root 34408 Feb 7 02:38 more -rwsr-xr-x 1 root root 34400 Feb 7 02:38 mount -rwxr-xr-x 1 root root 9824 Feb 7 02:38 mountpoint -rwxr-xr-x 1 root root 88524 Sep 22 2020 mv lrwxrwxrwx 1 root root 8 Nov 6 2019 nisdomainname -> hostname lrwxrwxrwx 1 root root 14 Apr 18 03:38 pidof -> /sbin/killall5 -rwxr-xr-x 1 root root 26652 Sep 22 2020 pwd lrwxrwxrwx 1 root root 4 Jun 21 14:26 rbash -> bash -rwxr-xr-x 1 root root 30740 Sep 22 2020 readlink -rwxr-xr-x 1 root root 43104 Sep 22 2020 rm -rwxr-xr-x 1 root root 30732 Sep 22 2020 rmdir -rwxr-xr-x 1 root root 14144 Sep 27 2020 run-parts -rwxr-xr-x 1 root root 76012 Dec 22 2018 sed lrwxrwxrwx 1 root root 4 Jul 16 21:29 sh -> dash -rwxr-xr-x 1 root root 22532 Sep 22 2020 sleep -rwxr-xr-x 1 root root 55360 Sep 22 2020 stty -rwsr-xr-x 1 root root 46704 Feb 7 02:38 su -rwxr-xr-x 1 root root 22532 Sep 22 2020 sync -rwxr-xr-x 1 root root 340872 Feb 16 21:55 tar -rwxr-xr-x 1 root root 9808 Sep 27 2020 tempfile -rwxr-xr-x 1 root root 67696 Sep 22 2020 touch -rwxr-xr-x 1 root root 22496 Sep 22 2020 true -rwxr-xr-x 1 root root 9636 Feb 26 04:12 ulockmgr_server -rwsr-xr-x 1 root root 22108 Feb 7 02:38 umount -rwxr-xr-x 1 root root 22520 Sep 22 2020 uname -rwxr-xr-x 2 root root 2346 Mar 2 11:30 uncompress -rwxr-xr-x 1 root root 96764 Sep 22 2020 vdir -rwxr-xr-x 1 root root 38512 Feb 7 02:38 wdctl lrwxrwxrwx 1 root root 8 Nov 6 2019 ypdomainname -> hostname -rwxr-xr-x 1 root root 1984 Mar 2 11:30 zcat -rwxr-xr-x 1 root root 1678 Mar 2 11:30 zcmp -rwxr-xr-x 1 root root 5880 Mar 2 11:30 zdiff -rwxr-xr-x 1 root root 29 Mar 2 11:30 zegrep -rwxr-xr-x 1 root root 29 Mar 2 11:30 zfgrep -rwxr-xr-x 1 root root 2081 Mar 2 11:30 zforce -rwxr-xr-x 1 root root 7585 Mar 2 11:30 zgrep -rwxr-xr-x 1 root root 2206 Mar 2 11:30 zless -rwxr-xr-x 1 root root 1842 Mar 2 11:30 zmore -rwxr-xr-x 1 root root 4553 Mar 2 11:30 znew I: user script /srv/workspace/pbuilder/31703/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: armhf Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 13), cmake, bison, flex dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19398 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 13); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on cmake; however: Package cmake is not installed. pbuilder-satisfydepends-dummy depends on bison; however: Package bison is not installed. pbuilder-satisfydepends-dummy depends on flex; however: Package flex is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} automake{a} autopoint{a} autotools-dev{a} bison{a} bsdextrautils{a} cmake{a} cmake-data{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} flex{a} gettext{a} gettext-base{a} groff-base{a} intltool-debian{a} libarchive-zip-perl{a} libarchive13{a} libbrotli1{a} libcurl4{a} libdebhelper-perl{a} libelf1{a} libexpat1{a} libfile-stripnondeterminism-perl{a} libicu67{a} libjsoncpp24{a} libldap-2.4-2{a} libmagic-mgc{a} libmagic1{a} libncurses6{a} libnghttp2-14{a} libpipeline1{a} libprocps8{a} libpsl5{a} librhash0{a} librtmp1{a} libsasl2-2{a} libsasl2-modules-db{a} libsigsegv2{a} libssh2-1{a} libsub-override-perl{a} libtool{a} libuchardet0{a} libuv1{a} libxml2{a} m4{a} man-db{a} po-debconf{a} procps{a} sensible-utils{a} The following packages are RECOMMENDED but will NOT be installed: ca-certificates curl libarchive-cpio-perl libfl-dev libgpm2 libldap-common libltdl-dev libmail-sendmail-perl libsasl2-modules lynx psmisc publicsuffix wget 0 packages upgraded, 52 newly installed, 0 to remove and 0 not upgraded. Need to get 27.1 MB of archives. After unpacking 95.4 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian bullseye/main armhf bsdextrautils armhf 2.36.1-7 [138 kB] Get: 2 http://deb.debian.org/debian bullseye/main armhf libuchardet0 armhf 0.0.7-1 [65.0 kB] Get: 3 http://deb.debian.org/debian bullseye/main armhf groff-base armhf 1.22.4-6 [847 kB] Get: 4 http://deb.debian.org/debian bullseye/main armhf libpipeline1 armhf 1.5.3-1 [30.1 kB] Get: 5 http://deb.debian.org/debian bullseye/main armhf man-db armhf 2.9.4-2 [1319 kB] Get: 6 http://deb.debian.org/debian bullseye/main armhf libsigsegv2 armhf 2.13-1 [34.0 kB] Get: 7 http://deb.debian.org/debian bullseye/main armhf m4 armhf 1.4.18-5 [192 kB] Get: 8 http://deb.debian.org/debian bullseye/main armhf flex armhf 2.6.4-8 [424 kB] Get: 9 http://deb.debian.org/debian bullseye/main armhf libncurses6 armhf 6.2+20201114-2 [80.5 kB] Get: 10 http://deb.debian.org/debian bullseye/main armhf libprocps8 armhf 2:3.3.17-5 [60.7 kB] Get: 11 http://deb.debian.org/debian bullseye/main armhf procps armhf 2:3.3.17-5 [492 kB] Get: 12 http://deb.debian.org/debian bullseye/main armhf sensible-utils all 0.0.14 [14.8 kB] Get: 13 http://deb.debian.org/debian bullseye/main armhf libmagic-mgc armhf 1:5.39-3 [273 kB] Get: 14 http://deb.debian.org/debian bullseye/main armhf libmagic1 armhf 1:5.39-3 [117 kB] Get: 15 http://deb.debian.org/debian bullseye/main armhf file armhf 1:5.39-3 [68.1 kB] Get: 16 http://deb.debian.org/debian bullseye/main armhf gettext-base armhf 0.21-4 [171 kB] Get: 17 http://deb.debian.org/debian bullseye/main armhf autoconf all 2.69-14 [313 kB] Get: 18 http://deb.debian.org/debian bullseye/main armhf autotools-dev all 20180224.1+nmu1 [77.1 kB] Get: 19 http://deb.debian.org/debian bullseye/main armhf automake all 1:1.16.3-2 [814 kB] Get: 20 http://deb.debian.org/debian bullseye/main armhf autopoint all 0.21-4 [510 kB] Get: 21 http://deb.debian.org/debian bullseye/main armhf bison armhf 2:3.7.5+dfsg-1 [1072 kB] Get: 22 http://deb.debian.org/debian bullseye/main armhf cmake-data all 3.18.4-2 [1725 kB] Get: 23 http://deb.debian.org/debian bullseye/main armhf libicu67 armhf 67.1-7 [8319 kB] Get: 24 http://deb.debian.org/debian bullseye/main armhf libxml2 armhf 2.9.10+dfsg-6.7 [602 kB] Get: 25 http://deb.debian.org/debian bullseye/main armhf libarchive13 armhf 3.4.3-2+b1 [304 kB] Get: 26 http://deb.debian.org/debian bullseye/main armhf libbrotli1 armhf 1.0.9-2+b2 [262 kB] Get: 27 http://deb.debian.org/debian bullseye/main armhf libsasl2-modules-db armhf 2.1.27+dfsg-2.1 [67.6 kB] Get: 28 http://deb.debian.org/debian bullseye/main armhf libsasl2-2 armhf 2.1.27+dfsg-2.1 [99.1 kB] Get: 29 http://deb.debian.org/debian bullseye/main armhf libldap-2.4-2 armhf 2.4.57+dfsg-3 [210 kB] Get: 30 http://deb.debian.org/debian bullseye/main armhf libnghttp2-14 armhf 1.43.0-1 [65.6 kB] Get: 31 http://deb.debian.org/debian bullseye/main armhf libpsl5 armhf 0.21.0-1.2 [56.1 kB] Get: 32 http://deb.debian.org/debian bullseye/main armhf librtmp1 armhf 2.4+20151223.gitfa8646d.1-2+b2 [55.2 kB] Get: 33 http://deb.debian.org/debian bullseye/main armhf libssh2-1 armhf 1.9.0-2 [143 kB] Get: 34 http://deb.debian.org/debian bullseye/main armhf libcurl4 armhf 7.74.0-1.3+b1 [310 kB] Get: 35 http://deb.debian.org/debian bullseye/main armhf libexpat1 armhf 2.2.10-2 [76.3 kB] Get: 36 http://deb.debian.org/debian bullseye/main armhf libjsoncpp24 armhf 1.9.4-4 [68.5 kB] Get: 37 http://deb.debian.org/debian bullseye/main armhf librhash0 armhf 1.4.1-2 [144 kB] Get: 38 http://deb.debian.org/debian bullseye/main armhf libuv1 armhf 1.40.0-2 [120 kB] Get: 39 http://deb.debian.org/debian bullseye/main armhf cmake armhf 3.18.4-2 [3534 kB] Get: 40 http://deb.debian.org/debian bullseye/main armhf libdebhelper-perl all 13.3.4 [189 kB] Get: 41 http://deb.debian.org/debian bullseye/main armhf libtool all 2.4.6-15 [513 kB] Get: 42 http://deb.debian.org/debian bullseye/main armhf dh-autoreconf all 20 [17.1 kB] Get: 43 http://deb.debian.org/debian bullseye/main armhf libarchive-zip-perl all 1.68-1 [104 kB] Get: 44 http://deb.debian.org/debian bullseye/main armhf libsub-override-perl all 0.09-2 [10.2 kB] Get: 45 http://deb.debian.org/debian bullseye/main armhf libfile-stripnondeterminism-perl all 1.11.0-1 [25.6 kB] Get: 46 http://deb.debian.org/debian bullseye/main armhf dh-strip-nondeterminism all 1.11.0-1 [15.3 kB] Get: 47 http://deb.debian.org/debian bullseye/main armhf libelf1 armhf 0.183-1 [161 kB] Get: 48 http://deb.debian.org/debian bullseye/main armhf dwz armhf 0.13+20210201-1 [179 kB] Get: 49 http://deb.debian.org/debian bullseye/main armhf gettext armhf 0.21-4 [1243 kB] Get: 50 http://deb.debian.org/debian bullseye/main armhf intltool-debian all 0.35.0+20060710.5 [26.8 kB] Get: 51 http://deb.debian.org/debian bullseye/main armhf po-debconf all 1.0.21+nmu1 [248 kB] Get: 52 http://deb.debian.org/debian bullseye/main armhf debhelper all 13.3.4 [1049 kB] Fetched 27.1 MB in 10s (2772 kB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package bsdextrautils. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19398 files and directories currently installed.) Preparing to unpack .../00-bsdextrautils_2.36.1-7_armhf.deb ... Unpacking bsdextrautils (2.36.1-7) ... Selecting previously unselected package libuchardet0:armhf. Preparing to unpack .../01-libuchardet0_0.0.7-1_armhf.deb ... Unpacking libuchardet0:armhf (0.0.7-1) ... Selecting previously unselected package groff-base. Preparing to unpack .../02-groff-base_1.22.4-6_armhf.deb ... Unpacking groff-base (1.22.4-6) ... Selecting previously unselected package libpipeline1:armhf. Preparing to unpack .../03-libpipeline1_1.5.3-1_armhf.deb ... Unpacking libpipeline1:armhf (1.5.3-1) ... Selecting previously unselected package man-db. Preparing to unpack .../04-man-db_2.9.4-2_armhf.deb ... Unpacking man-db (2.9.4-2) ... Selecting previously unselected package libsigsegv2:armhf. Preparing to unpack .../05-libsigsegv2_2.13-1_armhf.deb ... Unpacking libsigsegv2:armhf (2.13-1) ... Selecting previously unselected package m4. Preparing to unpack .../06-m4_1.4.18-5_armhf.deb ... Unpacking m4 (1.4.18-5) ... Selecting previously unselected package flex. Preparing to unpack .../07-flex_2.6.4-8_armhf.deb ... Unpacking flex (2.6.4-8) ... Selecting previously unselected package libncurses6:armhf. Preparing to unpack .../08-libncurses6_6.2+20201114-2_armhf.deb ... Unpacking libncurses6:armhf (6.2+20201114-2) ... Selecting previously unselected package libprocps8:armhf. Preparing to unpack .../09-libprocps8_2%3a3.3.17-5_armhf.deb ... Unpacking libprocps8:armhf (2:3.3.17-5) ... Selecting previously unselected package procps. Preparing to unpack .../10-procps_2%3a3.3.17-5_armhf.deb ... Unpacking procps (2:3.3.17-5) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../11-sensible-utils_0.0.14_all.deb ... Unpacking sensible-utils (0.0.14) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../12-libmagic-mgc_1%3a5.39-3_armhf.deb ... Unpacking libmagic-mgc (1:5.39-3) ... Selecting previously unselected package libmagic1:armhf. Preparing to unpack .../13-libmagic1_1%3a5.39-3_armhf.deb ... Unpacking libmagic1:armhf (1:5.39-3) ... Selecting previously unselected package file. Preparing to unpack .../14-file_1%3a5.39-3_armhf.deb ... Unpacking file (1:5.39-3) ... Selecting previously unselected package gettext-base. Preparing to unpack .../15-gettext-base_0.21-4_armhf.deb ... Unpacking gettext-base (0.21-4) ... Selecting previously unselected package autoconf. Preparing to unpack .../16-autoconf_2.69-14_all.deb ... Unpacking autoconf (2.69-14) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../17-autotools-dev_20180224.1+nmu1_all.deb ... Unpacking autotools-dev (20180224.1+nmu1) ... Selecting previously unselected package automake. Preparing to unpack .../18-automake_1%3a1.16.3-2_all.deb ... Unpacking automake (1:1.16.3-2) ... Selecting previously unselected package autopoint. Preparing to unpack .../19-autopoint_0.21-4_all.deb ... Unpacking autopoint (0.21-4) ... Selecting previously unselected package bison. Preparing to unpack .../20-bison_2%3a3.7.5+dfsg-1_armhf.deb ... Unpacking bison (2:3.7.5+dfsg-1) ... Selecting previously unselected package cmake-data. Preparing to unpack .../21-cmake-data_3.18.4-2_all.deb ... Unpacking cmake-data (3.18.4-2) ... Selecting previously unselected package libicu67:armhf. Preparing to unpack .../22-libicu67_67.1-7_armhf.deb ... Unpacking libicu67:armhf (67.1-7) ... Selecting previously unselected package libxml2:armhf. Preparing to unpack .../23-libxml2_2.9.10+dfsg-6.7_armhf.deb ... Unpacking libxml2:armhf (2.9.10+dfsg-6.7) ... Selecting previously unselected package libarchive13:armhf. Preparing to unpack .../24-libarchive13_3.4.3-2+b1_armhf.deb ... Unpacking libarchive13:armhf (3.4.3-2+b1) ... Selecting previously unselected package libbrotli1:armhf. Preparing to unpack .../25-libbrotli1_1.0.9-2+b2_armhf.deb ... Unpacking libbrotli1:armhf (1.0.9-2+b2) ... Selecting previously unselected package libsasl2-modules-db:armhf. Preparing to unpack .../26-libsasl2-modules-db_2.1.27+dfsg-2.1_armhf.deb ... Unpacking libsasl2-modules-db:armhf (2.1.27+dfsg-2.1) ... Selecting previously unselected package libsasl2-2:armhf. Preparing to unpack .../27-libsasl2-2_2.1.27+dfsg-2.1_armhf.deb ... Unpacking libsasl2-2:armhf (2.1.27+dfsg-2.1) ... Selecting previously unselected package libldap-2.4-2:armhf. Preparing to unpack .../28-libldap-2.4-2_2.4.57+dfsg-3_armhf.deb ... Unpacking libldap-2.4-2:armhf (2.4.57+dfsg-3) ... Selecting previously unselected package libnghttp2-14:armhf. Preparing to unpack .../29-libnghttp2-14_1.43.0-1_armhf.deb ... Unpacking libnghttp2-14:armhf (1.43.0-1) ... Selecting previously unselected package libpsl5:armhf. Preparing to unpack .../30-libpsl5_0.21.0-1.2_armhf.deb ... Unpacking libpsl5:armhf (0.21.0-1.2) ... Selecting previously unselected package librtmp1:armhf. Preparing to unpack .../31-librtmp1_2.4+20151223.gitfa8646d.1-2+b2_armhf.deb ... Unpacking librtmp1:armhf (2.4+20151223.gitfa8646d.1-2+b2) ... Selecting previously unselected package libssh2-1:armhf. Preparing to unpack .../32-libssh2-1_1.9.0-2_armhf.deb ... Unpacking libssh2-1:armhf (1.9.0-2) ... Selecting previously unselected package libcurl4:armhf. Preparing to unpack .../33-libcurl4_7.74.0-1.3+b1_armhf.deb ... Unpacking libcurl4:armhf (7.74.0-1.3+b1) ... Selecting previously unselected package libexpat1:armhf. Preparing to unpack .../34-libexpat1_2.2.10-2_armhf.deb ... Unpacking libexpat1:armhf (2.2.10-2) ... Selecting previously unselected package libjsoncpp24:armhf. Preparing to unpack .../35-libjsoncpp24_1.9.4-4_armhf.deb ... Unpacking libjsoncpp24:armhf (1.9.4-4) ... Selecting previously unselected package librhash0:armhf. Preparing to unpack .../36-librhash0_1.4.1-2_armhf.deb ... Unpacking librhash0:armhf (1.4.1-2) ... Selecting previously unselected package libuv1:armhf. Preparing to unpack .../37-libuv1_1.40.0-2_armhf.deb ... Unpacking libuv1:armhf (1.40.0-2) ... Selecting previously unselected package cmake. Preparing to unpack .../38-cmake_3.18.4-2_armhf.deb ... Unpacking cmake (3.18.4-2) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../39-libdebhelper-perl_13.3.4_all.deb ... Unpacking libdebhelper-perl (13.3.4) ... Selecting previously unselected package libtool. Preparing to unpack .../40-libtool_2.4.6-15_all.deb ... Unpacking libtool (2.4.6-15) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../41-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../42-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libsub-override-perl. Preparing to unpack .../43-libsub-override-perl_0.09-2_all.deb ... Unpacking libsub-override-perl (0.09-2) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../44-libfile-stripnondeterminism-perl_1.11.0-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.11.0-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../45-dh-strip-nondeterminism_1.11.0-1_all.deb ... Unpacking dh-strip-nondeterminism (1.11.0-1) ... Selecting previously unselected package libelf1:armhf. Preparing to unpack .../46-libelf1_0.183-1_armhf.deb ... Unpacking libelf1:armhf (0.183-1) ... Selecting previously unselected package dwz. Preparing to unpack .../47-dwz_0.13+20210201-1_armhf.deb ... Unpacking dwz (0.13+20210201-1) ... Selecting previously unselected package gettext. Preparing to unpack .../48-gettext_0.21-4_armhf.deb ... Unpacking gettext (0.21-4) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../49-intltool-debian_0.35.0+20060710.5_all.deb ... Unpacking intltool-debian (0.35.0+20060710.5) ... Selecting previously unselected package po-debconf. Preparing to unpack .../50-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../51-debhelper_13.3.4_all.deb ... Unpacking debhelper (13.3.4) ... Setting up libexpat1:armhf (2.2.10-2) ... Setting up libpipeline1:armhf (1.5.3-1) ... Setting up libpsl5:armhf (0.21.0-1.2) ... Setting up bsdextrautils (2.36.1-7) ... update-alternatives: using /usr/bin/write.ul to provide /usr/bin/write (write) in auto mode Setting up libicu67:armhf (67.1-7) ... Setting up libmagic-mgc (1:5.39-3) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libdebhelper-perl (13.3.4) ... Setting up libbrotli1:armhf (1.0.9-2+b2) ... Setting up libnghttp2-14:armhf (1.43.0-1) ... Setting up libmagic1:armhf (1:5.39-3) ... Setting up gettext-base (0.21-4) ... Setting up file (1:5.39-3) ... Setting up libsasl2-modules-db:armhf (2.1.27+dfsg-2.1) ... Setting up autotools-dev (20180224.1+nmu1) ... Setting up libuv1:armhf (1.40.0-2) ... Setting up librtmp1:armhf (2.4+20151223.gitfa8646d.1-2+b2) ... Setting up libncurses6:armhf (6.2+20201114-2) ... Setting up libsigsegv2:armhf (2.13-1) ... Setting up autopoint (0.21-4) ... Setting up libsasl2-2:armhf (2.1.27+dfsg-2.1) ... Setting up libjsoncpp24:armhf (1.9.4-4) ... Setting up sensible-utils (0.0.14) ... Setting up librhash0:armhf (1.4.1-2) ... Setting up libuchardet0:armhf (0.0.7-1) ... Setting up libsub-override-perl (0.09-2) ... Setting up libssh2-1:armhf (1.9.0-2) ... Setting up cmake-data (3.18.4-2) ... Setting up libelf1:armhf (0.183-1) ... Setting up libxml2:armhf (2.9.10+dfsg-6.7) ... Setting up libprocps8:armhf (2:3.3.17-5) ... Setting up libfile-stripnondeterminism-perl (1.11.0-1) ... Setting up gettext (0.21-4) ... Setting up libtool (2.4.6-15) ... Setting up libarchive13:armhf (3.4.3-2+b1) ... Setting up libldap-2.4-2:armhf (2.4.57+dfsg-3) ... Setting up m4 (1.4.18-5) ... Setting up intltool-debian (0.35.0+20060710.5) ... Setting up autoconf (2.69-14) ... Setting up dh-strip-nondeterminism (1.11.0-1) ... Setting up dwz (0.13+20210201-1) ... Setting up groff-base (1.22.4-6) ... Setting up procps (2:3.3.17-5) ... Setting up bison (2:3.7.5+dfsg-1) ... update-alternatives: using /usr/bin/bison.yacc to provide /usr/bin/yacc (yacc) in auto mode Setting up libcurl4:armhf (7.74.0-1.3+b1) ... Setting up automake (1:1.16.3-2) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up flex (2.6.4-8) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up man-db (2.9.4-2) ... Not building database; man-db/auto-update is not 'true'. Setting up dh-autoreconf (20) ... Setting up cmake (3.18.4-2) ... Setting up debhelper (13.3.4) ... Processing triggers for libc-bin (2.31-12) ... Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps I: Building the package I: Running cd /build/dawg-1.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../dawg_1.2-3_source.changes dpkg-buildpackage: info: source package dawg dpkg-buildpackage: info: source version 1.2-3 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Andreas Tille dpkg-source --before-build . dpkg-buildpackage: info: host architecture armhf debian/rules clean dh clean dh_clean debian/rules binary dh binary dh_update_autotools_config dh_autoreconf debian/rules override_dh_auto_configure make[1]: Entering directory '/build/dawg-1.2' dh_auto_configure -- \ -DCMAKE_LIBRARY_PATH=arm-linux-gnueabihf \ -DCMAKE_DATA_DIR=/usr/share/doc/dawg cd obj-arm-linux-gnueabihf && cmake -DCMAKE_INSTALL_PREFIX=/usr -DCMAKE_BUILD_TYPE=None -DCMAKE_INSTALL_SYSCONFDIR=/etc -DCMAKE_INSTALL_LOCALSTATEDIR=/var -DCMAKE_EXPORT_NO_PACKAGE_REGISTRY=ON -DCMAKE_FIND_PACKAGE_NO_PACKAGE_REGISTRY=ON -DCMAKE_INSTALL_RUNSTATEDIR=/run -DCMAKE_SKIP_INSTALL_ALL_DEPENDENCY=ON "-GUnix Makefiles" -DCMAKE_VERBOSE_MAKEFILE=ON -DCMAKE_INSTALL_LIBDIR=lib/arm-linux-gnueabihf -DCMAKE_LIBRARY_PATH=arm-linux-gnueabihf -DCMAKE_DATA_DIR=/usr/share/doc/dawg .. -- The C compiler identification is GNU 10.2.1 -- The CXX compiler identification is GNU 10.2.1 -- Detecting C compiler ABI info -- Detecting C compiler ABI info - done -- Check for working C compiler: /usr/bin/cc - skipped -- Detecting C compile features -- Detecting C compile features - done -- Detecting CXX compiler ABI info -- Detecting CXX compiler ABI info - done -- Check for working CXX compiler: /usr/bin/c++ - skipped -- Detecting CXX compile features -- Detecting CXX compile features - done -- Looking for bison -- Looking for bison -- /usr/bin/bison -- Looking for flex -- Looking for flex -- /usr/bin/flex -- Looking for unistd.h -- Looking for unistd.h - found -- Looking for process.h -- Looking for process.h - not found -- Looking for io.h -- Looking for io.h - not found -- Looking for getopt.h -- Looking for getopt.h - found -- Looking for stdint.h -- Looking for stdint.h - found -- Looking for sys/types.h -- Looking for sys/types.h - found -- Looking for getpid -- Looking for getpid - found -- Looking for _getpid -- Looking for _getpid - not found -- Looking for copysign -- Looking for copysign - found -- Looking for _copysign -- Looking for _copysign - not found -- Looking for snprintf -- Looking for snprintf - found -- Looking for _snprintf -- Looking for _snprintf - not found -- Configuring done -- Generating done CMake Warning: Manually-specified variables were not used by the project: CMAKE_EXPORT_NO_PACKAGE_REGISTRY CMAKE_FIND_PACKAGE_NO_PACKAGE_REGISTRY CMAKE_INSTALL_LIBDIR CMAKE_INSTALL_LOCALSTATEDIR CMAKE_INSTALL_RUNSTATEDIR CMAKE_INSTALL_SYSCONFDIR CMAKE_LIBRARY_PATH -- Build files have been written to: /build/dawg-1.2/obj-arm-linux-gnueabihf make[1]: Leaving directory '/build/dawg-1.2' dh_auto_build cd obj-arm-linux-gnueabihf && make -j3 "INSTALL=install --strip-program=true" VERBOSE=1 make[1]: Entering directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' /usr/bin/cmake -S/build/dawg-1.2 -B/build/dawg-1.2/obj-arm-linux-gnueabihf --check-build-system CMakeFiles/Makefile.cmake 0 /usr/bin/cmake -E cmake_progress_start /build/dawg-1.2/obj-arm-linux-gnueabihf/CMakeFiles /build/dawg-1.2/obj-arm-linux-gnueabihf//CMakeFiles/progress.marks make -f CMakeFiles/Makefile2 all make[2]: Entering directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' make -f src/CMakeFiles/dawg.dir/build.make src/CMakeFiles/dawg.dir/depend make[3]: Entering directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' [ 7%] Generating lex.parser.cpp [ 15%] Generating parser.tab.cpp, parser.tab.hpp cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/bison --name-prefix=parser --defines --output-file=/build/dawg-1.2/obj-arm-linux-gnueabihf/src/parser.tab.cpp /build/dawg-1.2/src/parser.ypp cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/flex -Pparser -o/build/dawg-1.2/obj-arm-linux-gnueabihf/src/lex.parser.cpp /build/dawg-1.2/src/parser.lpp cd /build/dawg-1.2/obj-arm-linux-gnueabihf && /usr/bin/cmake -E cmake_depends "Unix Makefiles" /build/dawg-1.2 /build/dawg-1.2/src /build/dawg-1.2/obj-arm-linux-gnueabihf /build/dawg-1.2/obj-arm-linux-gnueabihf/src /build/dawg-1.2/obj-arm-linux-gnueabihf/src/CMakeFiles/dawg.dir/DependInfo.cmake --color= Dependee "/build/dawg-1.2/obj-arm-linux-gnueabihf/src/CMakeFiles/dawg.dir/DependInfo.cmake" is newer than depender "/build/dawg-1.2/obj-arm-linux-gnueabihf/src/CMakeFiles/dawg.dir/depend.internal". Dependee "/build/dawg-1.2/obj-arm-linux-gnueabihf/src/CMakeFiles/CMakeDirectoryInformation.cmake" is newer than depender "/build/dawg-1.2/obj-arm-linux-gnueabihf/src/CMakeFiles/dawg.dir/depend.internal". Scanning dependencies of target dawg make[3]: Leaving directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' make -f src/CMakeFiles/dawg.dir/build.make src/CMakeFiles/dawg.dir/build make[3]: Entering directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' [ 23%] Building CXX object src/CMakeFiles/dawg.dir/dawg.cpp.o [ 30%] Building CXX object src/CMakeFiles/dawg.dir/indel.cpp.o [ 38%] Building CXX object src/CMakeFiles/dawg.dir/eigen.cpp.o cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/dawg.cpp.o -c /build/dawg-1.2/src/dawg.cpp cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/indel.cpp.o -c /build/dawg-1.2/src/indel.cpp cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/eigen.cpp.o -c /build/dawg-1.2/src/eigen.cpp In file included from /build/dawg-1.2/src/dawg.cpp:20: /build/dawg-1.2/src/tree.h:17:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/dawg.cpp:19: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/dawg.cpp:20: /build/dawg-1.2/src/tree.h:18:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/dawg.cpp:19: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/dawg.cpp:20: /build/dawg-1.2/src/tree.h:199:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/dawg.cpp:19: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/dawg.cpp:20: /build/dawg-1.2/src/tree.h:200:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/dawg.cpp:19: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /usr/include/c++/10/vector:72, from /build/dawg-1.2/src/dawg.h:42, from /build/dawg-1.2/src/indel.cpp:3: /usr/include/c++/10/bits/vector.tcc: In member function 'void std::vector<_Tp, _Alloc>::_M_realloc_insert(std::vector<_Tp, _Alloc>::iterator, _Args&& ...) [with _Args = {const double&}; _Tp = double; _Alloc = std::allocator]': /usr/include/c++/10/bits/vector.tcc:426:7: note: parameter passing for argument of type 'std::vector::iterator' changed in GCC 7.1 426 | vector<_Tp, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/10/vector:67, from /build/dawg-1.2/src/dawg.h:42, from /build/dawg-1.2/src/indel.cpp:3: /usr/include/c++/10/bits/stl_vector.h: In constructor 'UserModel::UserModel(const std::vector&)': /usr/include/c++/10/bits/stl_vector.h:1198:21: note: parameter passing for argument of type '__gnu_cxx::__normal_iterator >' changed in GCC 7.1 1198 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ [ 46%] Building CXX object src/CMakeFiles/dawg.dir/matrix.cpp.o cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/matrix.cpp.o -c /build/dawg-1.2/src/matrix.cpp [ 53%] Building CXX object src/CMakeFiles/dawg.dir/output.cpp.o cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/output.cpp.o -c /build/dawg-1.2/src/output.cpp In file included from /usr/include/c++/10/vector:72, from /build/dawg-1.2/src/dawg.h:42, from /build/dawg-1.2/src/dawg.cpp:19: /usr/include/c++/10/bits/vector.tcc: In member function 'void std::vector<_Tp, _Alloc>::_M_fill_insert(std::vector<_Tp, _Alloc>::iterator, std::vector<_Tp, _Alloc>::size_type, const value_type&) [with _Tp = double; _Alloc = std::allocator]': /usr/include/c++/10/bits/vector.tcc:509:5: note: parameter passing for argument of type 'std::vector::iterator' changed in GCC 7.1 509 | vector<_Tp, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~ /usr/include/c++/10/bits/vector.tcc: In member function 'void std::vector<_Tp, _Alloc>::_M_realloc_insert(std::vector<_Tp, _Alloc>::iterator, _Args&& ...) [with _Args = {double}; _Tp = double; _Alloc = std::allocator]': /usr/include/c++/10/bits/vector.tcc:426:7: note: parameter passing for argument of type 'std::vector::iterator' changed in GCC 7.1 426 | vector<_Tp, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/output.cpp:4: /build/dawg-1.2/src/tree.h:17:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/output.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/output.cpp:4: /build/dawg-1.2/src/tree.h:18:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/output.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/output.cpp:4: /build/dawg-1.2/src/tree.h:199:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/output.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/output.cpp:4: /build/dawg-1.2/src/tree.h:200:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/output.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ /usr/include/c++/10/bits/vector.tcc: In member function 'void std::vector<_Tp, _Alloc>::_M_realloc_insert(std::vector<_Tp, _Alloc>::iterator, _Args&& ...) [with _Args = {const double&}; _Tp = double; _Alloc = std::allocator]': /usr/include/c++/10/bits/vector.tcc:426:7: note: parameter passing for argument of type 'std::vector::iterator' changed in GCC 7.1 In file included from /usr/include/c++/10/vector:67, from /build/dawg-1.2/src/dawg.h:42, from /build/dawg-1.2/src/dawg.cpp:19: /usr/include/c++/10/bits/stl_vector.h: In member function 'bool DawgVar::GetVector(std::vector&) [with T = double]': /usr/include/c++/10/bits/stl_vector.h:1198:21: note: parameter passing for argument of type '__gnu_cxx::__normal_iterator >' changed in GCC 7.1 1198 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ [ 61%] Building CXX object src/CMakeFiles/dawg.dir/rand.cpp.o cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/rand.cpp.o -c /build/dawg-1.2/src/rand.cpp [ 69%] Building CXX object src/CMakeFiles/dawg.dir/tree.cpp.o cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/tree.cpp.o -c /build/dawg-1.2/src/tree.cpp In file included from /usr/include/c++/10/vector:72, from /build/dawg-1.2/src/dawg.h:42, from /build/dawg-1.2/src/dawg.cpp:19: /usr/include/c++/10/bits/vector.tcc: In function 'bool Execute()': /usr/include/c++/10/bits/vector.tcc:121:21: note: parameter passing for argument of type '__gnu_cxx::__normal_iterator >' changed in GCC 7.1 121 | _M_realloc_insert(end(), std::forward<_Args>(__args)...); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /usr/include/c++/10/bits/vector.tcc:121:21: note: parameter passing for argument of type '__gnu_cxx::__normal_iterator >' changed in GCC 7.1 121 | _M_realloc_insert(end(), std::forward<_Args>(__args)...); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/10/vector:67, from /build/dawg-1.2/src/dawg.h:42, from /build/dawg-1.2/src/dawg.cpp:19: /usr/include/c++/10/bits/stl_vector.h:960:18: note: parameter passing for argument of type '__gnu_cxx::__normal_iterator >' changed in GCC 7.1 960 | _M_fill_insert(end(), __new_size - size(), __x); | ~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /usr/include/c++/10/bits/stl_vector.h:960:18: note: parameter passing for argument of type '__gnu_cxx::__normal_iterator >' changed in GCC 7.1 960 | _M_fill_insert(end(), __new_size - size(), __x); | ~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /usr/include/c++/10/bits/stl_vector.h:960:18: note: parameter passing for argument of type '__gnu_cxx::__normal_iterator >' changed in GCC 7.1 960 | _M_fill_insert(end(), __new_size - size(), __x); | ~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /usr/include/c++/10/bits/stl_vector.h:1198:21: note: parameter passing for argument of type '__gnu_cxx::__normal_iterator >' changed in GCC 7.1 1198 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ /usr/include/c++/10/bits/stl_vector.h:1198:21: note: parameter passing for argument of type '__gnu_cxx::__normal_iterator >' changed in GCC 7.1 1198 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ /usr/include/c++/10/bits/stl_vector.h:1198:21: note: parameter passing for argument of type '__gnu_cxx::__normal_iterator >' changed in GCC 7.1 1198 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ /usr/include/c++/10/bits/stl_vector.h:1198:21: note: parameter passing for argument of type '__gnu_cxx::__normal_iterator >' changed in GCC 7.1 1198 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ In file included from /build/dawg-1.2/src/tree.cpp:4: /build/dawg-1.2/src/tree.h:17:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/tree.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/tree.cpp:4: /build/dawg-1.2/src/tree.h:18:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/tree.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/tree.cpp:4: /build/dawg-1.2/src/tree.h:199:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/tree.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/tree.cpp:4: /build/dawg-1.2/src/tree.h:200:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/tree.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ [ 76%] Building CXX object src/CMakeFiles/dawg.dir/var.cpp.o cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/var.cpp.o -c /build/dawg-1.2/src/var.cpp In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/var.cpp:4: /build/dawg-1.2/src/tree.h:17:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/var.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/var.cpp:4: /build/dawg-1.2/src/tree.h:18:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/var.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/var.cpp:4: /build/dawg-1.2/src/tree.h:199:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/var.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/var.cpp:4: /build/dawg-1.2/src/tree.h:200:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/var.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ [ 84%] Building CXX object src/CMakeFiles/dawg.dir/lex.parser.cpp.o cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -I "/build/dawg-1.2/src" -o CMakeFiles/dawg.dir/lex.parser.cpp.o -c /build/dawg-1.2/obj-arm-linux-gnueabihf/src/lex.parser.cpp [ 92%] Building CXX object src/CMakeFiles/dawg.dir/parser.tab.cpp.o cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -I "/build/dawg-1.2/src" -o CMakeFiles/dawg.dir/parser.tab.cpp.o -c /build/dawg-1.2/obj-arm-linux-gnueabihf/src/parser.tab.cpp In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.lpp:5: /build/dawg-1.2/src/tree.h:17:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.lpp:4: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.lpp:5: /build/dawg-1.2/src/tree.h:18:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.lpp:4: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.lpp:5: /build/dawg-1.2/src/tree.h:199:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.lpp:4: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.lpp:5: /build/dawg-1.2/src/tree.h:200:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.lpp:4: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.ypp:5: /build/dawg-1.2/src/tree.h:17:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.ypp:4: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.ypp:5: /build/dawg-1.2/src/tree.h:18:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.ypp:4: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.ypp:5: /build/dawg-1.2/src/tree.h:199:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.ypp:4: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.ypp:5: /build/dawg-1.2/src/tree.h:200:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.ypp:4: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ [100%] Linking CXX executable dawg cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/cmake -E cmake_link_script CMakeFiles/dawg.dir/link.txt --verbose=1 /usr/bin/c++ -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -Wl,-z,relro -Wl,-z,now -rdynamic CMakeFiles/dawg.dir/dawg.cpp.o CMakeFiles/dawg.dir/eigen.cpp.o CMakeFiles/dawg.dir/indel.cpp.o CMakeFiles/dawg.dir/matrix.cpp.o CMakeFiles/dawg.dir/output.cpp.o CMakeFiles/dawg.dir/rand.cpp.o CMakeFiles/dawg.dir/tree.cpp.o CMakeFiles/dawg.dir/var.cpp.o CMakeFiles/dawg.dir/lex.parser.cpp.o CMakeFiles/dawg.dir/parser.tab.cpp.o -o dawg make[3]: Leaving directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' [100%] Built target dawg make[2]: Leaving directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' /usr/bin/cmake -E cmake_progress_start /build/dawg-1.2/obj-arm-linux-gnueabihf/CMakeFiles 0 make[1]: Leaving directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' debian/rules override_dh_auto_test make[1]: Entering directory '/build/dawg-1.2' # FIXME: This test fails - but let the build pass anyway for the moment cd tests && PATH=$PATH:/build/dawg-1.2/obj-arm-linux-gnueabihf/src sh test0.sh || true 2,3c2,3 < TCCTTGACCAGTTAGCAAGACGATATGCATCAAGTGCACTGGC---GTAAGTCTTTTTAC < GCTGATCATA--TAGTCCGTATAGTCACTGAACGCCGTCCTCTCG --- > AGGAACTGGTCACGTTCTGCTATACGTAGTTCACGTGACCGCATTCAGAAAAATGCGACT > AGTATTGTGATCAGGCATATCAGTGACTTGCGGCAGGAGAGC 6,7c6,7 < TCGTTGGACAGT--GCAAGACGCTATGCATCAAGTGCACTGGCTAGGTAAGTGCGTTTAT < GATGAGCACAACAGGTCCGGATAGTCCCTGAACGCTATACTCCCG --- > AGCAACTTGTCACGTTCTGCGATACGTAGTTCACGTGACCGCATTCACGCAAACACTACT > TGTGCT--GACCATGCATATCAGGGACTTGCGACATGTGGGC 10,11c10,11 < TCGA-CCCCAAA--TTAATACGTTAGTCATCAAGTGCACTGAC---GTAATAGCGTTTAT < GATGATGAGTACTAGCCCGTGGAAACCCTAAAAGCGTTACCCCCG --- > AGCATGGTGTCAAGTTCTGCGTTCAGTAGTTAACCAGACGGCATTAACGCTAATACATC- > -GTGTT--GACCTACCAACGTACGGACTTGCGTAATGTGGTC 14,15c14,15 < TCGTTGAACAGT--GCAAGACGCTATGCATCAAGTGCACTGGC---GTAAGTGCGTTTAT < GATGAACACAACTGGTCCGTATAGTCCCTGAACGCTGTACTCCCG --- > AGCAACTTGTCACGTTCTGCGATACGTAGTTCACGTGACCGCATTCACGCAAATACTACT > TGTGTT--GACCAGGCATATCAGGGACTTGCGACATGAGGGC 18,19c18,19 < TCGTACCACAGT--TCAAGACGCTAGGCATCAAGTGCACTGGC---GTAATTGCGTTTAT < GATGGACACAACTAGTCCGTTGAATCCCTGAACGCTTTACCCCCG --- > AGCATGGTGTCAAGTTCTGCGATCCGTAGTTCACGTGACCGCATTAACGCAAATACTACC > TGTGTT--GATCAGGCAACTTAGGGACTTGCGAAATGGGGGC make[1]: Leaving directory '/build/dawg-1.2' create-stamp debian/debhelper-build-stamp dh_prep dh_auto_install cd obj-arm-linux-gnueabihf && make -j3 install DESTDIR=/build/dawg-1.2/debian/dawg AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[1]: Entering directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' /usr/bin/cmake -S/build/dawg-1.2 -B/build/dawg-1.2/obj-arm-linux-gnueabihf --check-build-system CMakeFiles/Makefile.cmake 0 make -f CMakeFiles/Makefile2 preinstall make[2]: Entering directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' make[2]: Nothing to be done for 'preinstall'. make[2]: Leaving directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' Install the project... /usr/bin/cmake -P cmake_install.cmake -- Install configuration: "None" -- Installing: /build/dawg-1.2/debian/dawg/usr/bin/dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/applications/dawg.desktop -- Installing: /build/dawg-1.2/debian/dawg/usr/share/pixmaps/dawg.png -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example0.dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example1.dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example2.dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example3.dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example4.dawg make[1]: Leaving directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' dh_install dh_installdocs dh_installchangelogs dh_installman dh_perl dh_link dh_strip_nondeterminism dh_compress debian/rules override_dh_fixperms make[1]: Entering directory '/build/dawg-1.2' dh_fixperms chmod -x debian/dawg/usr/share/doc/dawg/examples/* make[1]: Leaving directory '/build/dawg-1.2' dh_missing dh_dwz -a dh_strip -a dh_makeshlibs -a dh_shlibdeps -a dpkg-shlibdeps: warning: debian/dawg/usr/bin/dawg contains an unresolvable reference to symbol __aeabi_atexit@CXXABI_ARM_1.3.3: it's probably a plugin dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'dawg' in '../dawg_1.2-3_armhf.deb'. dpkg-deb: building package 'dawg-dbgsym' in '../dawg-dbgsym_1.2-3_armhf.deb'. dpkg-genbuildinfo --build=binary dpkg-genchanges --build=binary >../dawg_1.2-3_armhf.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/31703 and its subdirectories I: Current time: Sun Jul 18 14:19:12 -12 2021 I: pbuilder-time-stamp: 1626661152