I: pbuilder: network access will be disabled during build I: Current time: Thu Jan 5 08:51:35 -12 2023 I: pbuilder-time-stamp: 1672951895 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/bullseye-reproducible-base.tgz] I: copying local configuration W: --override-config is not set; not updating apt.conf Read the manpage for details. I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: Copying source file I: copying [bowtie_1.3.0+dfsg1-1.dsc] I: copying [./bowtie_1.3.0+dfsg1.orig.tar.xz] I: copying [./bowtie_1.3.0+dfsg1-1.debian.tar.xz] I: Extracting source gpgv: unknown type of key resource 'trustedkeys.kbx' gpgv: keyblock resource '/tmp/dpkg-verify-sig.RZW0Mtfs/trustedkeys.kbx': General error gpgv: Signature made Tue Oct 13 00:02:00 2020 -12 gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 gpgv: issuer "tille@debian.org" gpgv: Can't check signature: No public key dpkg-source: warning: failed to verify signature on ./bowtie_1.3.0+dfsg1-1.dsc dpkg-source: info: extracting bowtie in bowtie-1.3.0+dfsg1 dpkg-source: info: unpacking bowtie_1.3.0+dfsg1.orig.tar.xz dpkg-source: info: unpacking bowtie_1.3.0+dfsg1-1.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying strip_html5shiv.patch dpkg-source: info: applying spelling.patch dpkg-source: info: applying no_hash_style_both_for_mips.patch dpkg-source: info: applying use-dpkg-buildflags.patch dpkg-source: info: applying reproducible.patch dpkg-source: info: applying build-as-Cpp03.patch dpkg-source: info: applying simple-test dpkg-source: info: applying popcnt_capability.patch I: Not using root during the build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/1934300/tmp/hooks/D02_print_environment starting I: set BUILDDIR='/build' BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' BUILDUSERNAME='pbuilder1' BUILD_ARCH='amd64' DEBIAN_FRONTEND='noninteractive' DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all,-fixfilepath parallel=15' DISTRIBUTION='bullseye' HOME='/root' HOST_ARCH='amd64' IFS=' ' INVOCATION_ID='8fc03ebcd3eb4c7b98e7bb1e77d444fe' LANG='C' LANGUAGE='en_US:en' LC_ALL='C' MAIL='/var/mail/root' OPTIND='1' PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' PBCURRENTCOMMANDLINEOPERATION='build' PBUILDER_OPERATION='build' PBUILDER_PKGDATADIR='/usr/share/pbuilder' PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' PBUILDER_SYSCONFDIR='/etc' PPID='1934300' PS1='# ' PS2='> ' PS4='+ ' PWD='/' SHELL='/bin/bash' SHLVL='2' SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.r6Vyn1aU/pbuilderrc_lu0K --distribution bullseye --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/bullseye-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.r6Vyn1aU/b1 --logfile b1/build.log bowtie_1.3.0+dfsg1-1.dsc' SUDO_GID='111' SUDO_UID='106' SUDO_USER='jenkins' TERM='unknown' TZ='/usr/share/zoneinfo/Etc/GMT+12' USER='root' _='/usr/bin/systemd-run' http_proxy='http://78.137.99.97:3128' I: uname -a Linux ionos11-amd64 5.10.0-20-amd64 #1 SMP Debian 5.10.158-2 (2022-12-13) x86_64 GNU/Linux I: ls -l /bin total 5476 -rwxr-xr-x 1 root root 1234376 Mar 27 2022 bash -rwxr-xr-x 3 root root 38984 Jul 20 2020 bunzip2 -rwxr-xr-x 3 root root 38984 Jul 20 2020 bzcat lrwxrwxrwx 1 root root 6 Jul 20 2020 bzcmp -> bzdiff -rwxr-xr-x 1 root root 2225 Jul 20 2020 bzdiff lrwxrwxrwx 1 root root 6 Jul 20 2020 bzegrep -> bzgrep -rwxr-xr-x 1 root root 4877 Sep 4 2019 bzexe lrwxrwxrwx 1 root root 6 Jul 20 2020 bzfgrep -> bzgrep -rwxr-xr-x 1 root root 3775 Jul 20 2020 bzgrep -rwxr-xr-x 3 root root 38984 Jul 20 2020 bzip2 -rwxr-xr-x 1 root root 18424 Jul 20 2020 bzip2recover lrwxrwxrwx 1 root root 6 Jul 20 2020 bzless -> bzmore -rwxr-xr-x 1 root root 1297 Jul 20 2020 bzmore -rwxr-xr-x 1 root root 43936 Sep 23 2020 cat -rwxr-xr-x 1 root root 72672 Sep 23 2020 chgrp -rwxr-xr-x 1 root root 64448 Sep 23 2020 chmod -rwxr-xr-x 1 root root 72672 Sep 23 2020 chown -rwxr-xr-x 1 root root 151168 Sep 23 2020 cp -rwxr-xr-x 1 root root 125560 Dec 10 2020 dash -rwxr-xr-x 1 root root 113664 Sep 23 2020 date -rwxr-xr-x 1 root root 80968 Sep 23 2020 dd -rwxr-xr-x 1 root root 93936 Sep 23 2020 df -rwxr-xr-x 1 root root 147176 Sep 23 2020 dir -rwxr-xr-x 1 root root 84440 Jan 20 2022 dmesg lrwxrwxrwx 1 root root 8 Nov 6 2019 dnsdomainname -> hostname lrwxrwxrwx 1 root root 8 Nov 6 2019 domainname -> hostname -rwxr-xr-x 1 root root 39712 Sep 23 2020 echo -rwxr-xr-x 1 root root 28 Nov 9 2020 egrep -rwxr-xr-x 1 root root 39680 Sep 23 2020 false -rwxr-xr-x 1 root root 28 Nov 9 2020 fgrep -rwxr-xr-x 1 root root 69032 Jan 20 2022 findmnt -rwsr-xr-x 1 root root 34896 Feb 26 2021 fusermount -rwxr-xr-x 1 root root 203072 Nov 9 2020 grep -rwxr-xr-x 2 root root 2346 Apr 9 2022 gunzip -rwxr-xr-x 1 root root 6447 Apr 9 2022 gzexe -rwxr-xr-x 1 root root 98048 Apr 9 2022 gzip -rwxr-xr-x 1 root root 22600 Nov 6 2019 hostname -rwxr-xr-x 1 root root 72840 Sep 23 2020 ln -rwxr-xr-x 1 root root 56952 Feb 7 2020 login -rwxr-xr-x 1 root root 147176 Sep 23 2020 ls -rwxr-xr-x 1 root root 149736 Jan 20 2022 lsblk -rwxr-xr-x 1 root root 85184 Sep 23 2020 mkdir -rwxr-xr-x 1 root root 76896 Sep 23 2020 mknod -rwxr-xr-x 1 root root 48064 Sep 23 2020 mktemp -rwxr-xr-x 1 root root 59632 Jan 20 2022 more -rwsr-xr-x 1 root root 55528 Jan 20 2022 mount -rwxr-xr-x 1 root root 18664 Jan 20 2022 mountpoint -rwxr-xr-x 1 root root 147080 Sep 23 2020 mv lrwxrwxrwx 1 root root 8 Nov 6 2019 nisdomainname -> hostname lrwxrwxrwx 1 root root 14 Dec 16 2021 pidof -> /sbin/killall5 -rwxr-xr-x 1 root root 43872 Sep 23 2020 pwd lrwxrwxrwx 1 root root 4 Mar 27 2022 rbash -> bash -rwxr-xr-x 1 root root 52032 Sep 23 2020 readlink -rwxr-xr-x 1 root root 72704 Sep 23 2020 rm -rwxr-xr-x 1 root root 52032 Sep 23 2020 rmdir -rwxr-xr-x 1 root root 27472 Sep 27 2020 run-parts -rwxr-xr-x 1 root root 122224 Dec 22 2018 sed lrwxrwxrwx 1 root root 4 Dec 20 21:25 sh -> dash -rwxr-xr-x 1 root root 43808 Sep 23 2020 sleep -rwxr-xr-x 1 root root 84928 Sep 23 2020 stty -rwsr-xr-x 1 root root 71912 Jan 20 2022 su -rwxr-xr-x 1 root root 39744 Sep 23 2020 sync -rwxr-xr-x 1 root root 531928 Feb 16 2021 tar -rwxr-xr-x 1 root root 14456 Sep 27 2020 tempfile -rwxr-xr-x 1 root root 101408 Sep 23 2020 touch -rwxr-xr-x 1 root root 39680 Sep 23 2020 true -rwxr-xr-x 1 root root 14328 Feb 26 2021 ulockmgr_server -rwsr-xr-x 1 root root 35040 Jan 20 2022 umount -rwxr-xr-x 1 root root 39744 Sep 23 2020 uname -rwxr-xr-x 2 root root 2346 Apr 9 2022 uncompress -rwxr-xr-x 1 root root 147176 Sep 23 2020 vdir -rwxr-xr-x 1 root root 63744 Jan 20 2022 wdctl lrwxrwxrwx 1 root root 8 Nov 6 2019 ypdomainname -> hostname -rwxr-xr-x 1 root root 1984 Apr 9 2022 zcat -rwxr-xr-x 1 root root 1678 Apr 9 2022 zcmp -rwxr-xr-x 1 root root 5898 Apr 9 2022 zdiff -rwxr-xr-x 1 root root 29 Apr 9 2022 zegrep -rwxr-xr-x 1 root root 29 Apr 9 2022 zfgrep -rwxr-xr-x 1 root root 2081 Apr 9 2022 zforce -rwxr-xr-x 1 root root 8049 Apr 9 2022 zgrep -rwxr-xr-x 1 root root 2206 Apr 9 2022 zless -rwxr-xr-x 1 root root 1842 Apr 9 2022 zmore -rwxr-xr-x 1 root root 4577 Apr 9 2022 znew I: user script /srv/workspace/pbuilder/1934300/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: amd64 Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 13), help2man, libtbb-dev, python3, zlib1g-dev, libclone-perl, libtest-deep-perl, libsys-info-perl dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19704 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 13); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on help2man; however: Package help2man is not installed. pbuilder-satisfydepends-dummy depends on libtbb-dev; however: Package libtbb-dev is not installed. pbuilder-satisfydepends-dummy depends on python3; however: Package python3 is not installed. pbuilder-satisfydepends-dummy depends on zlib1g-dev; however: Package zlib1g-dev is not installed. pbuilder-satisfydepends-dummy depends on libclone-perl; however: Package libclone-perl is not installed. pbuilder-satisfydepends-dummy depends on libtest-deep-perl; however: Package libtest-deep-perl is not installed. pbuilder-satisfydepends-dummy depends on libsys-info-perl; however: Package libsys-info-perl is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} automake{a} autopoint{a} autotools-dev{a} bsdextrautils{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} gettext{a} gettext-base{a} groff-base{a} help2man{a} intltool-debian{a} libarchive-zip-perl{a} libclone-perl{a} libconfig-general-perl{a} libdebhelper-perl{a} libelf1{a} libexpat1{a} libfile-stripnondeterminism-perl{a} libicu67{a} liblocale-gettext-perl{a} libmagic-mgc{a} libmagic1{a} libmpdec3{a} libpipeline1{a} libpython3-stdlib{a} libpython3.9-minimal{a} libpython3.9-stdlib{a} libreadline8{a} libsigsegv2{a} libsub-override-perl{a} libsys-info-base-perl{a} libsys-info-driver-linux-perl{a} libsys-info-perl{a} libtbb-dev{a} libtbb2{a} libtest-deep-perl{a} libtool{a} libuchardet0{a} libunix-processors-perl{a} libxml2{a} m4{a} man-db{a} media-types{a} po-debconf{a} python3{a} python3-minimal{a} python3.9{a} python3.9-minimal{a} readline-common{a} sensible-utils{a} zlib1g-dev{a} The following packages are RECOMMENDED but will NOT be installed: ca-certificates curl libarchive-cpio-perl libltdl-dev libmail-sendmail-perl lynx wget 0 packages upgraded, 55 newly installed, 0 to remove and 0 not upgraded. Need to get 24.9 MB of archives. After unpacking 93.0 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian bullseye/main amd64 bsdextrautils amd64 2.36.1-8+deb11u1 [145 kB] Get: 2 http://deb.debian.org/debian bullseye/main amd64 libuchardet0 amd64 0.0.7-1 [67.8 kB] Get: 3 http://deb.debian.org/debian bullseye/main amd64 groff-base amd64 1.22.4-6 [936 kB] Get: 4 http://deb.debian.org/debian bullseye/main amd64 libpipeline1 amd64 1.5.3-1 [34.3 kB] Get: 5 http://deb.debian.org/debian bullseye/main amd64 man-db amd64 2.9.4-2 [1354 kB] Get: 6 http://deb.debian.org/debian bullseye/main amd64 liblocale-gettext-perl amd64 1.07-4+b1 [19.0 kB] Get: 7 http://deb.debian.org/debian bullseye/main amd64 libpython3.9-minimal amd64 3.9.2-1 [801 kB] Get: 8 http://deb.debian.org/debian bullseye/main amd64 libexpat1 amd64 2.2.10-2+deb11u5 [98.2 kB] Get: 9 http://deb.debian.org/debian bullseye/main amd64 python3.9-minimal amd64 3.9.2-1 [1955 kB] Get: 10 http://deb.debian.org/debian bullseye/main amd64 python3-minimal amd64 3.9.2-3 [38.2 kB] Get: 11 http://deb.debian.org/debian bullseye/main amd64 media-types all 4.0.0 [30.3 kB] Get: 12 http://deb.debian.org/debian bullseye/main amd64 libmpdec3 amd64 2.5.1-1 [87.7 kB] Get: 13 http://deb.debian.org/debian bullseye/main amd64 readline-common all 8.1-1 [73.7 kB] Get: 14 http://deb.debian.org/debian bullseye/main amd64 libreadline8 amd64 8.1-1 [169 kB] Get: 15 http://deb.debian.org/debian bullseye/main amd64 libpython3.9-stdlib amd64 3.9.2-1 [1684 kB] Get: 16 http://deb.debian.org/debian bullseye/main amd64 python3.9 amd64 3.9.2-1 [466 kB] Get: 17 http://deb.debian.org/debian bullseye/main amd64 libpython3-stdlib amd64 3.9.2-3 [21.4 kB] Get: 18 http://deb.debian.org/debian bullseye/main amd64 python3 amd64 3.9.2-3 [37.9 kB] Get: 19 http://deb.debian.org/debian bullseye/main amd64 sensible-utils all 0.0.14 [14.8 kB] Get: 20 http://deb.debian.org/debian bullseye/main amd64 libmagic-mgc amd64 1:5.39-3 [273 kB] Get: 21 http://deb.debian.org/debian bullseye/main amd64 libmagic1 amd64 1:5.39-3 [126 kB] Get: 22 http://deb.debian.org/debian bullseye/main amd64 file amd64 1:5.39-3 [69.1 kB] Get: 23 http://deb.debian.org/debian bullseye/main amd64 gettext-base amd64 0.21-4 [175 kB] Get: 24 http://deb.debian.org/debian bullseye/main amd64 libsigsegv2 amd64 2.13-1 [34.8 kB] Get: 25 http://deb.debian.org/debian bullseye/main amd64 m4 amd64 1.4.18-5 [204 kB] Get: 26 http://deb.debian.org/debian bullseye/main amd64 autoconf all 2.69-14 [313 kB] Get: 27 http://deb.debian.org/debian bullseye/main amd64 autotools-dev all 20180224.1+nmu1 [77.1 kB] Get: 28 http://deb.debian.org/debian bullseye/main amd64 automake all 1:1.16.3-2 [814 kB] Get: 29 http://deb.debian.org/debian bullseye/main amd64 autopoint all 0.21-4 [510 kB] Get: 30 http://deb.debian.org/debian bullseye/main amd64 libdebhelper-perl all 13.3.4 [189 kB] Get: 31 http://deb.debian.org/debian bullseye/main amd64 libtool all 2.4.6-15 [513 kB] Get: 32 http://deb.debian.org/debian bullseye/main amd64 dh-autoreconf all 20 [17.1 kB] Get: 33 http://deb.debian.org/debian bullseye/main amd64 libarchive-zip-perl all 1.68-1 [104 kB] Get: 34 http://deb.debian.org/debian bullseye/main amd64 libsub-override-perl all 0.09-2 [10.2 kB] Get: 35 http://deb.debian.org/debian bullseye/main amd64 libfile-stripnondeterminism-perl all 1.12.0-1 [26.3 kB] Get: 36 http://deb.debian.org/debian bullseye/main amd64 dh-strip-nondeterminism all 1.12.0-1 [15.4 kB] Get: 37 http://deb.debian.org/debian bullseye/main amd64 libelf1 amd64 0.183-1 [165 kB] Get: 38 http://deb.debian.org/debian bullseye/main amd64 dwz amd64 0.13+20210201-1 [175 kB] Get: 39 http://deb.debian.org/debian bullseye/main amd64 libicu67 amd64 67.1-7 [8622 kB] Get: 40 http://deb.debian.org/debian bullseye/main amd64 libxml2 amd64 2.9.10+dfsg-6.7+deb11u3 [693 kB] Get: 41 http://deb.debian.org/debian bullseye/main amd64 gettext amd64 0.21-4 [1311 kB] Get: 42 http://deb.debian.org/debian bullseye/main amd64 intltool-debian all 0.35.0+20060710.5 [26.8 kB] Get: 43 http://deb.debian.org/debian bullseye/main amd64 po-debconf all 1.0.21+nmu1 [248 kB] Get: 44 http://deb.debian.org/debian bullseye/main amd64 debhelper all 13.3.4 [1049 kB] Get: 45 http://deb.debian.org/debian bullseye/main amd64 help2man amd64 1.48.1 [190 kB] Get: 46 http://deb.debian.org/debian bullseye/main amd64 libclone-perl amd64 0.45-1+b1 [15.4 kB] Get: 47 http://deb.debian.org/debian bullseye/main amd64 libconfig-general-perl all 2.63-1 [70.5 kB] Get: 48 http://deb.debian.org/debian bullseye/main amd64 libsys-info-base-perl all 0.7807-3 [28.3 kB] Get: 49 http://deb.debian.org/debian bullseye/main amd64 libunix-processors-perl amd64 2.046-2+b1 [16.9 kB] Get: 50 http://deb.debian.org/debian bullseye/main amd64 libsys-info-driver-linux-perl all 0.7905-2 [24.4 kB] Get: 51 http://deb.debian.org/debian bullseye/main amd64 libsys-info-perl all 0.7811-2 [8532 B] Get: 52 http://deb.debian.org/debian bullseye/main amd64 libtbb2 amd64 2020.3-1 [161 kB] Get: 53 http://deb.debian.org/debian bullseye/main amd64 libtbb-dev amd64 2020.3-1 [313 kB] Get: 54 http://deb.debian.org/debian bullseye/main amd64 libtest-deep-perl all 1.130-1 [49.3 kB] Get: 55 http://deb.debian.org/debian bullseye/main amd64 zlib1g-dev amd64 1:1.2.11.dfsg-2+deb11u2 [191 kB] Fetched 24.9 MB in 12s (2143 kB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package bsdextrautils. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19704 files and directories currently installed.) Preparing to unpack .../0-bsdextrautils_2.36.1-8+deb11u1_amd64.deb ... Unpacking bsdextrautils (2.36.1-8+deb11u1) ... Selecting previously unselected package libuchardet0:amd64. Preparing to unpack .../1-libuchardet0_0.0.7-1_amd64.deb ... Unpacking libuchardet0:amd64 (0.0.7-1) ... Selecting previously unselected package groff-base. Preparing to unpack .../2-groff-base_1.22.4-6_amd64.deb ... Unpacking groff-base (1.22.4-6) ... Selecting previously unselected package libpipeline1:amd64. Preparing to unpack .../3-libpipeline1_1.5.3-1_amd64.deb ... Unpacking libpipeline1:amd64 (1.5.3-1) ... Selecting previously unselected package man-db. Preparing to unpack .../4-man-db_2.9.4-2_amd64.deb ... Unpacking man-db (2.9.4-2) ... Selecting previously unselected package liblocale-gettext-perl. Preparing to unpack .../5-liblocale-gettext-perl_1.07-4+b1_amd64.deb ... Unpacking liblocale-gettext-perl (1.07-4+b1) ... Selecting previously unselected package libpython3.9-minimal:amd64. Preparing to unpack .../6-libpython3.9-minimal_3.9.2-1_amd64.deb ... Unpacking libpython3.9-minimal:amd64 (3.9.2-1) ... Selecting previously unselected package libexpat1:amd64. Preparing to unpack .../7-libexpat1_2.2.10-2+deb11u5_amd64.deb ... Unpacking libexpat1:amd64 (2.2.10-2+deb11u5) ... Selecting previously unselected package python3.9-minimal. Preparing to unpack .../8-python3.9-minimal_3.9.2-1_amd64.deb ... Unpacking python3.9-minimal (3.9.2-1) ... Setting up libpython3.9-minimal:amd64 (3.9.2-1) ... Setting up libexpat1:amd64 (2.2.10-2+deb11u5) ... Setting up python3.9-minimal (3.9.2-1) ... Selecting previously unselected package python3-minimal. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20586 files and directories currently installed.) Preparing to unpack .../0-python3-minimal_3.9.2-3_amd64.deb ... Unpacking python3-minimal (3.9.2-3) ... Selecting previously unselected package media-types. Preparing to unpack .../1-media-types_4.0.0_all.deb ... Unpacking media-types (4.0.0) ... Selecting previously unselected package libmpdec3:amd64. Preparing to unpack .../2-libmpdec3_2.5.1-1_amd64.deb ... Unpacking libmpdec3:amd64 (2.5.1-1) ... Selecting previously unselected package readline-common. Preparing to unpack .../3-readline-common_8.1-1_all.deb ... Unpacking readline-common (8.1-1) ... Selecting previously unselected package libreadline8:amd64. Preparing to unpack .../4-libreadline8_8.1-1_amd64.deb ... Unpacking libreadline8:amd64 (8.1-1) ... Selecting previously unselected package libpython3.9-stdlib:amd64. Preparing to unpack .../5-libpython3.9-stdlib_3.9.2-1_amd64.deb ... Unpacking libpython3.9-stdlib:amd64 (3.9.2-1) ... Selecting previously unselected package python3.9. Preparing to unpack .../6-python3.9_3.9.2-1_amd64.deb ... Unpacking python3.9 (3.9.2-1) ... Selecting previously unselected package libpython3-stdlib:amd64. Preparing to unpack .../7-libpython3-stdlib_3.9.2-3_amd64.deb ... Unpacking libpython3-stdlib:amd64 (3.9.2-3) ... Setting up python3-minimal (3.9.2-3) ... Selecting previously unselected package python3. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 21007 files and directories currently installed.) Preparing to unpack .../00-python3_3.9.2-3_amd64.deb ... Unpacking python3 (3.9.2-3) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../01-sensible-utils_0.0.14_all.deb ... Unpacking sensible-utils (0.0.14) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../02-libmagic-mgc_1%3a5.39-3_amd64.deb ... Unpacking libmagic-mgc (1:5.39-3) ... Selecting previously unselected package libmagic1:amd64. Preparing to unpack .../03-libmagic1_1%3a5.39-3_amd64.deb ... Unpacking libmagic1:amd64 (1:5.39-3) ... Selecting previously unselected package file. Preparing to unpack .../04-file_1%3a5.39-3_amd64.deb ... Unpacking file (1:5.39-3) ... Selecting previously unselected package gettext-base. Preparing to unpack .../05-gettext-base_0.21-4_amd64.deb ... Unpacking gettext-base (0.21-4) ... Selecting previously unselected package libsigsegv2:amd64. Preparing to unpack .../06-libsigsegv2_2.13-1_amd64.deb ... Unpacking libsigsegv2:amd64 (2.13-1) ... Selecting previously unselected package m4. Preparing to unpack .../07-m4_1.4.18-5_amd64.deb ... Unpacking m4 (1.4.18-5) ... Selecting previously unselected package autoconf. Preparing to unpack .../08-autoconf_2.69-14_all.deb ... Unpacking autoconf (2.69-14) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../09-autotools-dev_20180224.1+nmu1_all.deb ... Unpacking autotools-dev (20180224.1+nmu1) ... Selecting previously unselected package automake. Preparing to unpack .../10-automake_1%3a1.16.3-2_all.deb ... Unpacking automake (1:1.16.3-2) ... Selecting previously unselected package autopoint. Preparing to unpack .../11-autopoint_0.21-4_all.deb ... Unpacking autopoint (0.21-4) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../12-libdebhelper-perl_13.3.4_all.deb ... Unpacking libdebhelper-perl (13.3.4) ... Selecting previously unselected package libtool. Preparing to unpack .../13-libtool_2.4.6-15_all.deb ... Unpacking libtool (2.4.6-15) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../14-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../15-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libsub-override-perl. Preparing to unpack .../16-libsub-override-perl_0.09-2_all.deb ... Unpacking libsub-override-perl (0.09-2) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../17-libfile-stripnondeterminism-perl_1.12.0-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.12.0-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../18-dh-strip-nondeterminism_1.12.0-1_all.deb ... Unpacking dh-strip-nondeterminism (1.12.0-1) ... Selecting previously unselected package libelf1:amd64. Preparing to unpack .../19-libelf1_0.183-1_amd64.deb ... Unpacking libelf1:amd64 (0.183-1) ... Selecting previously unselected package dwz. Preparing to unpack .../20-dwz_0.13+20210201-1_amd64.deb ... Unpacking dwz (0.13+20210201-1) ... Selecting previously unselected package libicu67:amd64. Preparing to unpack .../21-libicu67_67.1-7_amd64.deb ... Unpacking libicu67:amd64 (67.1-7) ... Selecting previously unselected package libxml2:amd64. Preparing to unpack .../22-libxml2_2.9.10+dfsg-6.7+deb11u3_amd64.deb ... Unpacking libxml2:amd64 (2.9.10+dfsg-6.7+deb11u3) ... Selecting previously unselected package gettext. Preparing to unpack .../23-gettext_0.21-4_amd64.deb ... Unpacking gettext (0.21-4) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../24-intltool-debian_0.35.0+20060710.5_all.deb ... Unpacking intltool-debian (0.35.0+20060710.5) ... Selecting previously unselected package po-debconf. Preparing to unpack .../25-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../26-debhelper_13.3.4_all.deb ... Unpacking debhelper (13.3.4) ... Selecting previously unselected package help2man. Preparing to unpack .../27-help2man_1.48.1_amd64.deb ... Unpacking help2man (1.48.1) ... Selecting previously unselected package libclone-perl. Preparing to unpack .../28-libclone-perl_0.45-1+b1_amd64.deb ... Unpacking libclone-perl (0.45-1+b1) ... Selecting previously unselected package libconfig-general-perl. Preparing to unpack .../29-libconfig-general-perl_2.63-1_all.deb ... Unpacking libconfig-general-perl (2.63-1) ... Selecting previously unselected package libsys-info-base-perl. Preparing to unpack .../30-libsys-info-base-perl_0.7807-3_all.deb ... Unpacking libsys-info-base-perl (0.7807-3) ... Selecting previously unselected package libunix-processors-perl. Preparing to unpack .../31-libunix-processors-perl_2.046-2+b1_amd64.deb ... Unpacking libunix-processors-perl (2.046-2+b1) ... Selecting previously unselected package libsys-info-driver-linux-perl. Preparing to unpack .../32-libsys-info-driver-linux-perl_0.7905-2_all.deb ... Unpacking libsys-info-driver-linux-perl (0.7905-2) ... Selecting previously unselected package libsys-info-perl. Preparing to unpack .../33-libsys-info-perl_0.7811-2_all.deb ... Unpacking libsys-info-perl (0.7811-2) ... Selecting previously unselected package libtbb2:amd64. Preparing to unpack .../34-libtbb2_2020.3-1_amd64.deb ... Unpacking libtbb2:amd64 (2020.3-1) ... Selecting previously unselected package libtbb-dev:amd64. Preparing to unpack .../35-libtbb-dev_2020.3-1_amd64.deb ... Unpacking libtbb-dev:amd64 (2020.3-1) ... Selecting previously unselected package libtest-deep-perl. Preparing to unpack .../36-libtest-deep-perl_1.130-1_all.deb ... Unpacking libtest-deep-perl (1.130-1) ... Selecting previously unselected package zlib1g-dev:amd64. Preparing to unpack .../37-zlib1g-dev_1%3a1.2.11.dfsg-2+deb11u2_amd64.deb ... Unpacking zlib1g-dev:amd64 (1:1.2.11.dfsg-2+deb11u2) ... Setting up media-types (4.0.0) ... Setting up libpipeline1:amd64 (1.5.3-1) ... Setting up libconfig-general-perl (2.63-1) ... Setting up bsdextrautils (2.36.1-8+deb11u1) ... update-alternatives: using /usr/bin/write.ul to provide /usr/bin/write (write) in auto mode Setting up libicu67:amd64 (67.1-7) ... Setting up libtest-deep-perl (1.130-1) ... Setting up libmagic-mgc (1:5.39-3) ... Setting up libclone-perl (0.45-1+b1) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libdebhelper-perl (13.3.4) ... Setting up libtbb2:amd64 (2020.3-1) ... Setting up libmagic1:amd64 (1:5.39-3) ... Setting up gettext-base (0.21-4) ... Setting up file (1:5.39-3) ... Setting up autotools-dev (20180224.1+nmu1) ... Setting up libsigsegv2:amd64 (2.13-1) ... Setting up libunix-processors-perl (2.046-2+b1) ... Setting up autopoint (0.21-4) ... Setting up zlib1g-dev:amd64 (1:1.2.11.dfsg-2+deb11u2) ... Setting up sensible-utils (0.0.14) ... Setting up libuchardet0:amd64 (0.0.7-1) ... Setting up libmpdec3:amd64 (2.5.1-1) ... Setting up libsub-override-perl (0.09-2) ... Setting up libtbb-dev:amd64 (2020.3-1) ... Setting up libsys-info-base-perl (0.7807-3) ... Setting up libelf1:amd64 (0.183-1) ... Setting up readline-common (8.1-1) ... Setting up libxml2:amd64 (2.9.10+dfsg-6.7+deb11u3) ... Setting up liblocale-gettext-perl (1.07-4+b1) ... Setting up libfile-stripnondeterminism-perl (1.12.0-1) ... Setting up gettext (0.21-4) ... Setting up libsys-info-driver-linux-perl (0.7905-2) ... Setting up libtool (2.4.6-15) ... Setting up libreadline8:amd64 (8.1-1) ... Setting up m4 (1.4.18-5) ... Setting up intltool-debian (0.35.0+20060710.5) ... Setting up help2man (1.48.1) ... Setting up autoconf (2.69-14) ... Setting up dh-strip-nondeterminism (1.12.0-1) ... Setting up dwz (0.13+20210201-1) ... Setting up groff-base (1.22.4-6) ... Setting up libpython3.9-stdlib:amd64 (3.9.2-1) ... Setting up libpython3-stdlib:amd64 (3.9.2-3) ... Setting up automake (1:1.16.3-2) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up libsys-info-perl (0.7811-2) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up man-db (2.9.4-2) ... Not building database; man-db/auto-update is not 'true'. Setting up dh-autoreconf (20) ... Setting up python3.9 (3.9.2-1) ... Setting up debhelper (13.3.4) ... Setting up python3 (3.9.2-3) ... Processing triggers for libc-bin (2.31-13+deb11u5) ... Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps I: Building the package I: Running cd /build/bowtie-1.3.0+dfsg1/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../bowtie_1.3.0+dfsg1-1_source.changes dpkg-buildpackage: info: source package bowtie dpkg-buildpackage: info: source version 1.3.0+dfsg1-1 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Andreas Tille dpkg-source --before-build . dpkg-buildpackage: info: host architecture amd64 debian/rules clean dh clean debian/rules override_dh_auto_clean make[1]: Entering directory '/build/bowtie-1.3.0+dfsg1' rm -f .bowtie* dh_auto_clean make -j15 clean make[2]: Entering directory '/build/bowtie-1.3.0+dfsg1' rm -f bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-build-s-debug bowtie-build-l-debug bowtie-align-s-debug bowtie-align-l-debug bowtie-inspect-s-debug bowtie-inspect-l-debug \ bowtie_prof \ bowtie-build-s.exe bowtie-build-l.exe bowtie-align-s.exe bowtie-align-l.exe bowtie-inspect-s.exe bowtie-inspect-l.exe bowtie-build-s-debug.exe bowtie-build-l-debug.exe bowtie-align-s-debug.exe bowtie-align-l-debug.exe bowtie-inspect-s-debug.exe bowtie-inspect-l-debug.exe bowtie_prof.exe \ bowtie-src.zip bowtie-bin.zip rm -f *.core rm -f bowtie-align-s-master* bowtie-align-s-no-io* rm -rf .lib .include make[2]: Leaving directory '/build/bowtie-1.3.0+dfsg1' make[1]: Leaving directory '/build/bowtie-1.3.0+dfsg1' dh_clean debian/rules binary dh binary dh_update_autotools_config dh_autoreconf dh_auto_configure debian/rules override_dh_auto_build make[1]: Entering directory '/build/bowtie-1.3.0+dfsg1' /usr/bin/make allall make[2]: Entering directory '/build/bowtie-1.3.0+dfsg1' g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -Wl,--hash-style=both -DPOPCNT_CAPABILITY -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -DPOPCNT_CAPABILITY -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I third_party \ -o bowtie-build-s ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -Wl,--hash-style=both -DPOPCNT_CAPABILITY -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -DPOPCNT_CAPABILITY -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I third_party \ -o bowtie-build-l ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -Wl,--hash-style=both -DPOPCNT_CAPABILITY -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -DPOPCNT_CAPABILITY -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I third_party \ -o bowtie-align-s ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -Wl,--hash-style=both -DPOPCNT_CAPABILITY -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -DPOPCNT_CAPABILITY -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I third_party \ -o bowtie-align-l ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -Wl,--hash-style=both -DPOPCNT_CAPABILITY -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -DPOPCNT_CAPABILITY -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I third_party -I . \ -o bowtie-inspect-s bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -Wl,--hash-style=both -DPOPCNT_CAPABILITY -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -DPOPCNT_CAPABILITY -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I third_party -I . \ -o bowtie-inspect-l bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -Wl,--hash-style=both -DPOPCNT_CAPABILITY -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -DPOPCNT_CAPABILITY -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I third_party \ -o bowtie-build-s-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -Wl,--hash-style=both -DPOPCNT_CAPABILITY -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -DPOPCNT_CAPABILITY -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I third_party \ -o bowtie-build-l-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -Wl,--hash-style=both -DPOPCNT_CAPABILITY -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -DPOPCNT_CAPABILITY -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I third_party \ -o bowtie-align-s-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -Wl,--hash-style=both -DPOPCNT_CAPABILITY -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -DPOPCNT_CAPABILITY -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I third_party \ -o bowtie-align-l-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -Wl,--hash-style=both -DPOPCNT_CAPABILITY -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -DPOPCNT_CAPABILITY -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I third_party -I . \ -o bowtie-inspect-s-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -Wl,--hash-style=both -DPOPCNT_CAPABILITY -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -DPOPCNT_CAPABILITY -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I third_party -I . \ -o bowtie-inspect-l-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,-z,now -lz -lpthread make[2]: Leaving directory '/build/bowtie-1.3.0+dfsg1' make[1]: Leaving directory '/build/bowtie-1.3.0+dfsg1' debian/rules override_dh_auto_test make[1]: Entering directory '/build/bowtie-1.3.0+dfsg1' unset LD_PRELOAD && make simple-test make[2]: Entering directory '/build/bowtie-1.3.0+dfsg1' ./scripts/test/simple_tests.pl --bowtie=./bowtie --bowtie-build=./bowtie-build FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 0.00%) # reads that failed to align: 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0@HD VN:1.0 SO:unsorted (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%)@HD VN:1.0 SO:unsorted Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 PASSED make[2]: Leaving directory '/build/bowtie-1.3.0+dfsg1' ln -s debian/tests unset LD_PRELOAD && sh debian/tests/run-unit-test test_at_build_time Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 5 alignments example1 OK Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments example2 OK Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 5 alignments example3 OK Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments example4 OK Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 5 alignments example5 OK example7 OK Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 5 alignments example8 OK Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments rm -f tests examples[0-9].out make[1]: Leaving directory '/build/bowtie-1.3.0+dfsg1' create-stamp debian/debhelper-build-stamp dh_prep dh_installdirs debian/rules override_dh_auto_install-arch make[1]: Entering directory '/build/bowtie-1.3.0+dfsg1' # remove strange byte-compyled Python code bowtie-buildc (no idea how and why it was created) find . -name bowtie-buildc -delete find . -name .cvsignore -delete make[1]: Leaving directory '/build/bowtie-1.3.0+dfsg1' dh_auto_install -Nbowtie make -j15 install DESTDIR=/build/bowtie-1.3.0\+dfsg1/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[1]: Entering directory '/build/bowtie-1.3.0+dfsg1' mkdir -p /build/bowtie-1.3.0+dfsg1/debian/tmp/usr/local/bin for file in bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-inspect bowtie-build bowtie ; do \ cp -f $file /build/bowtie-1.3.0+dfsg1/debian/tmp/usr/local/bin ; \ done make[1]: Leaving directory '/build/bowtie-1.3.0+dfsg1' debian/rules override_dh_install make[1]: Entering directory '/build/bowtie-1.3.0+dfsg1' dh_install if [ -d debian/tmp/usr/local/bin ] ; then \ dh_install -a usr/local/bin usr ; \ fi make[1]: Leaving directory '/build/bowtie-1.3.0+dfsg1' dh_installdocs dh_installchangelogs debian/rules override_dh_installman-arch make[1]: Entering directory '/build/bowtie-1.3.0+dfsg1' help2man --name="ultrafast memory-efficient short read aligner" --no-info \ /build/bowtie-1.3.0+dfsg1/bowtie > /build/bowtie-1.3.0+dfsg1/debian/bowtie/usr/share/man/man1/bowtie.1 help2man --name="building a colorspace index for bowtie" --no-info \ /build/bowtie-1.3.0+dfsg1/bowtie-build > /build/bowtie-1.3.0+dfsg1/debian/bowtie/usr/share/man/man1/bowtie-build.1 help2man --name="extracts information from a bowtie index" --no-info \ /build/bowtie-1.3.0+dfsg1/bowtie-inspect > /build/bowtie-1.3.0+dfsg1/debian/bowtie/usr/share/man/man1/bowtie-inspect.1 make[1]: Leaving directory '/build/bowtie-1.3.0+dfsg1' dh_lintian dh_perl dh_link dh_strip_nondeterminism debian/rules override_dh_compress make[1]: Entering directory '/build/bowtie-1.3.0+dfsg1' dh_compress -X.ebwt make[1]: Leaving directory '/build/bowtie-1.3.0+dfsg1' debian/rules override_dh_fixperms-indep make[1]: Entering directory '/build/bowtie-1.3.0+dfsg1' dh_fixperms chmod 644 debian/bowtie-examples/usr/share/doc/bowtie/examples/indexes/* make[1]: Leaving directory '/build/bowtie-1.3.0+dfsg1' dh_fixperms -Nbowtie-examples debian/rules override_dh_missing-indep make[1]: Entering directory '/build/bowtie-1.3.0+dfsg1' dh_missing -i --list-missing make[1]: Leaving directory '/build/bowtie-1.3.0+dfsg1' dh_missing -Nbowtie-examples dh_dwz -a dh_strip -a dh_makeshlibs -a dh_shlibdeps -a dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'bowtie-dbgsym' in '../bowtie-dbgsym_1.3.0+dfsg1-1_amd64.deb'. dpkg-deb: building package 'bowtie' in '../bowtie_1.3.0+dfsg1-1_amd64.deb'. dpkg-deb: building package 'bowtie-examples' in '../bowtie-examples_1.3.0+dfsg1-1_all.deb'. dpkg-genbuildinfo --build=binary dpkg-genchanges --build=binary >../bowtie_1.3.0+dfsg1-1_amd64.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: including full source code in upload I: copying local configuration I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/1934300 and its subdirectories I: Current time: Thu Jan 5 09:02:21 -12 2023 I: pbuilder-time-stamp: 1672952541