I: pbuilder: network access will be disabled during build I: Current time: Wed Jun 7 22:19:24 +14 2023 I: pbuilder-time-stamp: 1686125964 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/bookworm-reproducible-base.tgz] I: copying local configuration W: --override-config is not set; not updating apt.conf Read the manpage for details. I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: Copying source file I: copying [dawg_1.2-4.dsc] I: copying [./dawg_1.2.orig.tar.gz] I: copying [./dawg_1.2-4.debian.tar.xz] I: Extracting source gpgv: Signature made Tue Nov 9 09:58:37 2021 +14 gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 gpgv: issuer "tille@debian.org" gpgv: Can't check signature: No public key dpkg-source: warning: cannot verify inline signature for ./dawg_1.2-4.dsc: no acceptable signature found dpkg-source: info: extracting dawg in dawg-1.2 dpkg-source: info: unpacking dawg_1.2.orig.tar.gz dpkg-source: info: unpacking dawg_1.2-4.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying 0001-Add-missing-include-of-cstring.patch dpkg-source: info: applying 0003-Don-t-override-install-directories.patch dpkg-source: info: applying 0004-Fix-typo-in-help-text.patch dpkg-source: info: applying 0005-Remove-Encoding-add-Keywords-to-dawg.desktop.patch dpkg-source: info: applying 0006-relative-path-in-test-script.patch I: Not using root during the build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/9745/tmp/hooks/D01_modify_environment starting debug: Running on virt32b. I: Changing host+domainname to test build reproducibility I: Adding a custom variable just for the fun of it... I: Changing /bin/sh to bash '/bin/sh' -> '/bin/bash' lrwxrwxrwx 1 root root 9 Jun 7 22:19 /bin/sh -> /bin/bash I: Setting pbuilder2's login shell to /bin/bash I: Setting pbuilder2's GECOS to second user,second room,second work-phone,second home-phone,second other I: user script /srv/workspace/pbuilder/9745/tmp/hooks/D01_modify_environment finished I: user script /srv/workspace/pbuilder/9745/tmp/hooks/D02_print_environment starting I: set BASH=/bin/sh BASHOPTS=checkwinsize:cmdhist:complete_fullquote:extquote:force_fignore:globasciiranges:globskipdots:hostcomplete:interactive_comments:patsub_replacement:progcomp:promptvars:sourcepath BASH_ALIASES=() BASH_ARGC=() BASH_ARGV=() BASH_CMDS=() BASH_LINENO=([0]="12" [1]="0") BASH_LOADABLES_PATH=/usr/local/lib/bash:/usr/lib/bash:/opt/local/lib/bash:/usr/pkg/lib/bash:/opt/pkg/lib/bash:. BASH_SOURCE=([0]="/tmp/hooks/D02_print_environment" [1]="/tmp/hooks/D02_print_environment") BASH_VERSINFO=([0]="5" [1]="2" [2]="15" [3]="1" [4]="release" [5]="arm-unknown-linux-gnueabihf") BASH_VERSION='5.2.15(1)-release' BUILDDIR=/build BUILDUSERGECOS='second user,second room,second work-phone,second home-phone,second other' BUILDUSERNAME=pbuilder2 BUILD_ARCH=armhf DEBIAN_FRONTEND=noninteractive DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=4 ' DIRSTACK=() DISTRIBUTION=bookworm EUID=0 FUNCNAME=([0]="Echo" [1]="main") GROUPS=() HOME=/root HOSTNAME=i-capture-the-hostname HOSTTYPE=arm HOST_ARCH=armhf IFS=' ' INVOCATION_ID=916cc0fb9786459d9061272e28611892 LANG=C LANGUAGE=it_CH:it LC_ALL=C MACHTYPE=arm-unknown-linux-gnueabihf MAIL=/var/mail/root OPTERR=1 OPTIND=1 OSTYPE=linux-gnueabihf PATH=/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path PBCURRENTCOMMANDLINEOPERATION=build PBUILDER_OPERATION=build PBUILDER_PKGDATADIR=/usr/share/pbuilder PBUILDER_PKGLIBDIR=/usr/lib/pbuilder PBUILDER_SYSCONFDIR=/etc PIPESTATUS=([0]="0") POSIXLY_CORRECT=y PPID=9745 PS4='+ ' PWD=/ SHELL=/bin/bash SHELLOPTS=braceexpand:errexit:hashall:interactive-comments:posix SHLVL=3 SUDO_COMMAND='/usr/bin/timeout -k 24.1h 24h /usr/bin/ionice -c 3 /usr/bin/nice -n 11 /usr/bin/unshare --uts -- /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.lOoT0Nya/pbuilderrc_16bU --distribution bookworm --hookdir /etc/pbuilder/rebuild-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/bookworm-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.lOoT0Nya/b2 --logfile b2/build.log --extrapackages usrmerge dawg_1.2-4.dsc' SUDO_GID=112 SUDO_UID=106 SUDO_USER=jenkins TERM=unknown TZ=/usr/share/zoneinfo/Etc/GMT-14 UID=0 USER=root _='I: set' http_proxy=http://10.0.0.15:3142/ I: uname -a Linux i-capture-the-hostname 5.10.0-23-armmp-lpae #1 SMP Debian 5.10.179-1 (2023-05-12) armv7l GNU/Linux I: ls -l /bin total 5072 -rwxr-xr-x 1 root root 838488 Apr 24 11:24 bash -rwxr-xr-x 3 root root 67144 Sep 19 2022 bunzip2 -rwxr-xr-x 3 root root 67144 Sep 19 2022 bzcat lrwxrwxrwx 1 root root 6 Sep 19 2022 bzcmp -> bzdiff -rwxr-xr-x 1 root root 2225 Sep 19 2022 bzdiff lrwxrwxrwx 1 root root 6 Sep 19 2022 bzegrep -> bzgrep -rwxr-xr-x 1 root root 4893 Nov 28 2021 bzexe lrwxrwxrwx 1 root root 6 Sep 19 2022 bzfgrep -> bzgrep -rwxr-xr-x 1 root root 3775 Sep 19 2022 bzgrep -rwxr-xr-x 3 root root 67144 Sep 19 2022 bzip2 -rwxr-xr-x 1 root root 67112 Sep 19 2022 bzip2recover lrwxrwxrwx 1 root root 6 Sep 19 2022 bzless -> bzmore -rwxr-xr-x 1 root root 1297 Sep 19 2022 bzmore -rwxr-xr-x 1 root root 67632 Sep 21 2022 cat -rwxr-xr-x 1 root root 67676 Sep 21 2022 chgrp -rwxr-xr-x 1 root root 67644 Sep 21 2022 chmod -rwxr-xr-x 1 root root 67684 Sep 21 2022 chown -rwxr-xr-x 1 root root 133532 Sep 21 2022 cp -rwxr-xr-x 1 root root 132868 Jan 6 03:20 dash -rwxr-xr-x 1 root root 133220 Sep 21 2022 date -rwxr-xr-x 1 root root 67732 Sep 21 2022 dd -rwxr-xr-x 1 root root 68104 Sep 21 2022 df -rwxr-xr-x 1 root root 133632 Sep 21 2022 dir -rwxr-xr-x 1 root root 59128 Mar 23 23:02 dmesg lrwxrwxrwx 1 root root 8 Dec 20 03:33 dnsdomainname -> hostname lrwxrwxrwx 1 root root 8 Dec 20 03:33 domainname -> hostname -rwxr-xr-x 1 root root 67560 Sep 21 2022 echo -rwxr-xr-x 1 root root 41 Jan 25 04:43 egrep -rwxr-xr-x 1 root root 67548 Sep 21 2022 false -rwxr-xr-x 1 root root 41 Jan 25 04:43 fgrep -rwxr-xr-x 1 root root 55748 Mar 23 23:02 findmnt -rwsr-xr-x 1 root root 26208 Mar 23 22:15 fusermount -rwxr-xr-x 1 root root 128608 Jan 25 04:43 grep -rwxr-xr-x 2 root root 2346 Apr 10 2022 gunzip -rwxr-xr-x 1 root root 6447 Apr 10 2022 gzexe -rwxr-xr-x 1 root root 64220 Apr 10 2022 gzip -rwxr-xr-x 1 root root 67032 Dec 20 03:33 hostname -rwxr-xr-x 1 root root 67720 Sep 21 2022 ln -rwxr-xr-x 1 root root 35132 Mar 23 23:51 login -rwxr-xr-x 1 root root 133632 Sep 21 2022 ls -rwxr-xr-x 1 root root 136808 Mar 23 23:02 lsblk -rwxr-xr-x 1 root root 67800 Sep 21 2022 mkdir -rwxr-xr-x 1 root root 67764 Sep 21 2022 mknod -rwxr-xr-x 1 root root 67596 Sep 21 2022 mktemp -rwxr-xr-x 1 root root 38504 Mar 23 23:02 more -rwsr-xr-x 1 root root 38496 Mar 23 23:02 mount -rwxr-xr-x 1 root root 9824 Mar 23 23:02 mountpoint -rwxr-xr-x 1 root root 133532 Sep 21 2022 mv lrwxrwxrwx 1 root root 8 Dec 20 03:33 nisdomainname -> hostname lrwxrwxrwx 1 root root 14 Apr 3 20:25 pidof -> /sbin/killall5 -rwxr-xr-x 1 root root 67608 Sep 21 2022 pwd lrwxrwxrwx 1 root root 4 Apr 24 11:24 rbash -> bash -rwxr-xr-x 1 root root 67600 Sep 21 2022 readlink -rwxr-xr-x 1 root root 67672 Sep 21 2022 rm -rwxr-xr-x 1 root root 67600 Sep 21 2022 rmdir -rwxr-xr-x 1 root root 67400 Nov 3 2022 run-parts -rwxr-xr-x 1 root root 133372 Jan 6 09:55 sed lrwxrwxrwx 1 root root 9 Jun 7 22:19 sh -> /bin/bash -rwxr-xr-x 1 root root 67584 Sep 21 2022 sleep -rwxr-xr-x 1 root root 67644 Sep 21 2022 stty -rwsr-xr-x 1 root root 50800 Mar 23 23:02 su -rwxr-xr-x 1 root root 67584 Sep 21 2022 sync -rwxr-xr-x 1 root root 336764 Apr 7 04:25 tar -rwxr-xr-x 1 root root 67144 Nov 3 2022 tempfile -rwxr-xr-x 1 root root 133224 Sep 21 2022 touch -rwxr-xr-x 1 root root 67548 Sep 21 2022 true -rwxr-xr-x 1 root root 9768 Mar 23 22:15 ulockmgr_server -rwsr-xr-x 1 root root 22108 Mar 23 23:02 umount -rwxr-xr-x 1 root root 67572 Sep 21 2022 uname -rwxr-xr-x 2 root root 2346 Apr 10 2022 uncompress -rwxr-xr-x 1 root root 133632 Sep 21 2022 vdir -rwxr-xr-x 1 root root 42608 Mar 23 23:02 wdctl lrwxrwxrwx 1 root root 8 Dec 20 03:33 ypdomainname -> hostname -rwxr-xr-x 1 root root 1984 Apr 10 2022 zcat -rwxr-xr-x 1 root root 1678 Apr 10 2022 zcmp -rwxr-xr-x 1 root root 6460 Apr 10 2022 zdiff -rwxr-xr-x 1 root root 29 Apr 10 2022 zegrep -rwxr-xr-x 1 root root 29 Apr 10 2022 zfgrep -rwxr-xr-x 1 root root 2081 Apr 10 2022 zforce -rwxr-xr-x 1 root root 8103 Apr 10 2022 zgrep -rwxr-xr-x 1 root root 2206 Apr 10 2022 zless -rwxr-xr-x 1 root root 1842 Apr 10 2022 zmore -rwxr-xr-x 1 root root 4577 Apr 10 2022 znew I: user script /srv/workspace/pbuilder/9745/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: armhf Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 13), cmake, bison, flex dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19324 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 13); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on cmake; however: Package cmake is not installed. pbuilder-satisfydepends-dummy depends on bison; however: Package bison is not installed. pbuilder-satisfydepends-dummy depends on flex; however: Package flex is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} automake{a} autopoint{a} autotools-dev{a} bison{a} bsdextrautils{a} cmake{a} cmake-data{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} flex{a} gettext{a} gettext-base{a} groff-base{a} intltool-debian{a} libarchive-zip-perl{a} libarchive13{a} libbrotli1{a} libcurl4{a} libdebhelper-perl{a} libelf1{a} libexpat1{a} libfile-stripnondeterminism-perl{a} libicu72{a} libjsoncpp25{a} libldap-2.5-0{a} libmagic-mgc{a} libmagic1{a} libnghttp2-14{a} libpipeline1{a} libproc2-0{a} libpsl5{a} librhash0{a} librtmp1{a} libsasl2-2{a} libsasl2-modules-db{a} libssh2-1{a} libsub-override-perl{a} libtool{a} libuchardet0{a} libuv1{a} libxml2{a} m4{a} man-db{a} po-debconf{a} procps{a} sensible-utils{a} The following packages are RECOMMENDED but will NOT be installed: ca-certificates curl libarchive-cpio-perl libfl-dev libldap-common libltdl-dev libmail-sendmail-perl libsasl2-modules lynx psmisc publicsuffix wget 0 packages upgraded, 50 newly installed, 0 to remove and 0 not upgraded. Need to get 28.5 MB of archives. After unpacking 107 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian bookworm/main armhf m4 armhf 1.4.19-3 [265 kB] Get: 2 http://deb.debian.org/debian bookworm/main armhf flex armhf 2.6.4-8.2 [405 kB] Get: 3 http://deb.debian.org/debian bookworm/main armhf libproc2-0 armhf 2:4.0.2-3 [54.2 kB] Get: 4 http://deb.debian.org/debian bookworm/main armhf procps armhf 2:4.0.2-3 [695 kB] Get: 5 http://deb.debian.org/debian bookworm/main armhf sensible-utils all 0.0.17+nmu1 [19.0 kB] Get: 6 http://deb.debian.org/debian bookworm/main armhf libmagic-mgc armhf 1:5.44-3 [305 kB] Get: 7 http://deb.debian.org/debian bookworm/main armhf libmagic1 armhf 1:5.44-3 [96.5 kB] Get: 8 http://deb.debian.org/debian bookworm/main armhf file armhf 1:5.44-3 [41.6 kB] Get: 9 http://deb.debian.org/debian bookworm/main armhf gettext-base armhf 0.21-12 [157 kB] Get: 10 http://deb.debian.org/debian bookworm/main armhf libuchardet0 armhf 0.0.7-1 [65.0 kB] Get: 11 http://deb.debian.org/debian bookworm/main armhf groff-base armhf 1.22.4-10 [825 kB] Get: 12 http://deb.debian.org/debian bookworm/main armhf bsdextrautils armhf 2.38.1-5+b1 [78.6 kB] Get: 13 http://deb.debian.org/debian bookworm/main armhf libpipeline1 armhf 1.5.7-1 [33.6 kB] Get: 14 http://deb.debian.org/debian bookworm/main armhf man-db armhf 2.11.2-2 [1351 kB] Get: 15 http://deb.debian.org/debian bookworm/main armhf autoconf all 2.71-3 [332 kB] Get: 16 http://deb.debian.org/debian bookworm/main armhf autotools-dev all 20220109.1 [51.6 kB] Get: 17 http://deb.debian.org/debian bookworm/main armhf automake all 1:1.16.5-1.3 [823 kB] Get: 18 http://deb.debian.org/debian bookworm/main armhf autopoint all 0.21-12 [495 kB] Get: 19 http://deb.debian.org/debian bookworm/main armhf bison armhf 2:3.8.2+dfsg-1+b1 [1142 kB] Get: 20 http://deb.debian.org/debian bookworm/main armhf libicu72 armhf 72.1-3 [9048 kB] Get: 21 http://deb.debian.org/debian bookworm/main armhf libxml2 armhf 2.9.14+dfsg-1.2 [591 kB] Get: 22 http://deb.debian.org/debian bookworm/main armhf libarchive13 armhf 3.6.2-1 [299 kB] Get: 23 http://deb.debian.org/debian bookworm/main armhf libbrotli1 armhf 1.0.9-2+b6 [271 kB] Get: 24 http://deb.debian.org/debian bookworm/main armhf libsasl2-modules-db armhf 2.1.28+dfsg-10 [19.0 kB] Get: 25 http://deb.debian.org/debian bookworm/main armhf libsasl2-2 armhf 2.1.28+dfsg-10 [52.3 kB] Get: 26 http://deb.debian.org/debian bookworm/main armhf libldap-2.5-0 armhf 2.5.13+dfsg-5 [158 kB] Get: 27 http://deb.debian.org/debian bookworm/main armhf libnghttp2-14 armhf 1.52.0-1 [60.8 kB] Get: 28 http://deb.debian.org/debian bookworm/main armhf libpsl5 armhf 0.21.2-1 [57.5 kB] Get: 29 http://deb.debian.org/debian bookworm/main armhf librtmp1 armhf 2.4+20151223.gitfa8646d.1-2+b2 [55.2 kB] Get: 30 http://deb.debian.org/debian bookworm/main armhf libssh2-1 armhf 1.10.0-3+b1 [163 kB] Get: 31 http://deb.debian.org/debian bookworm/main armhf libcurl4 armhf 7.88.1-10 [347 kB] Get: 32 http://deb.debian.org/debian bookworm/main armhf libexpat1 armhf 2.5.0-1 [79.9 kB] Get: 33 http://deb.debian.org/debian bookworm/main armhf libjsoncpp25 armhf 1.9.5-4 [68.6 kB] Get: 34 http://deb.debian.org/debian bookworm/main armhf librhash0 armhf 1.4.3-3 [146 kB] Get: 35 http://deb.debian.org/debian bookworm/main armhf libuv1 armhf 1.44.2-1 [126 kB] Get: 36 http://deb.debian.org/debian bookworm/main armhf cmake-data all 3.25.1-1 [2026 kB] Get: 37 http://deb.debian.org/debian bookworm/main armhf cmake armhf 3.25.1-1 [4263 kB] Get: 38 http://deb.debian.org/debian bookworm/main armhf libdebhelper-perl all 13.11.4 [81.2 kB] Get: 39 http://deb.debian.org/debian bookworm/main armhf libtool all 2.4.7-5 [517 kB] Get: 40 http://deb.debian.org/debian bookworm/main armhf dh-autoreconf all 20 [17.1 kB] Get: 41 http://deb.debian.org/debian bookworm/main armhf libarchive-zip-perl all 1.68-1 [104 kB] Get: 42 http://deb.debian.org/debian bookworm/main armhf libsub-override-perl all 0.09-4 [9304 B] Get: 43 http://deb.debian.org/debian bookworm/main armhf libfile-stripnondeterminism-perl all 1.13.1-1 [19.4 kB] Get: 44 http://deb.debian.org/debian bookworm/main armhf dh-strip-nondeterminism all 1.13.1-1 [8620 B] Get: 45 http://deb.debian.org/debian bookworm/main armhf libelf1 armhf 0.188-2.1 [170 kB] Get: 46 http://deb.debian.org/debian bookworm/main armhf dwz armhf 0.15-1 [101 kB] Get: 47 http://deb.debian.org/debian bookworm/main armhf gettext armhf 0.21-12 [1229 kB] Get: 48 http://deb.debian.org/debian bookworm/main armhf intltool-debian all 0.35.0+20060710.6 [22.9 kB] Get: 49 http://deb.debian.org/debian bookworm/main armhf po-debconf all 1.0.21+nmu1 [248 kB] Get: 50 http://deb.debian.org/debian bookworm/main armhf debhelper all 13.11.4 [942 kB] Fetched 28.5 MB in 3s (10.8 MB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package m4. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19324 files and directories currently installed.) Preparing to unpack .../00-m4_1.4.19-3_armhf.deb ... Unpacking m4 (1.4.19-3) ... Selecting previously unselected package flex. Preparing to unpack .../01-flex_2.6.4-8.2_armhf.deb ... Unpacking flex (2.6.4-8.2) ... Selecting previously unselected package libproc2-0:armhf. Preparing to unpack .../02-libproc2-0_2%3a4.0.2-3_armhf.deb ... Unpacking libproc2-0:armhf (2:4.0.2-3) ... Selecting previously unselected package procps. Preparing to unpack .../03-procps_2%3a4.0.2-3_armhf.deb ... Unpacking procps (2:4.0.2-3) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../04-sensible-utils_0.0.17+nmu1_all.deb ... Unpacking sensible-utils (0.0.17+nmu1) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../05-libmagic-mgc_1%3a5.44-3_armhf.deb ... Unpacking libmagic-mgc (1:5.44-3) ... Selecting previously unselected package libmagic1:armhf. Preparing to unpack .../06-libmagic1_1%3a5.44-3_armhf.deb ... Unpacking libmagic1:armhf (1:5.44-3) ... Selecting previously unselected package file. Preparing to unpack .../07-file_1%3a5.44-3_armhf.deb ... Unpacking file (1:5.44-3) ... Selecting previously unselected package gettext-base. Preparing to unpack .../08-gettext-base_0.21-12_armhf.deb ... Unpacking gettext-base (0.21-12) ... Selecting previously unselected package libuchardet0:armhf. Preparing to unpack .../09-libuchardet0_0.0.7-1_armhf.deb ... Unpacking libuchardet0:armhf (0.0.7-1) ... Selecting previously unselected package groff-base. Preparing to unpack .../10-groff-base_1.22.4-10_armhf.deb ... Unpacking groff-base (1.22.4-10) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../11-bsdextrautils_2.38.1-5+b1_armhf.deb ... Unpacking bsdextrautils (2.38.1-5+b1) ... Selecting previously unselected package libpipeline1:armhf. Preparing to unpack .../12-libpipeline1_1.5.7-1_armhf.deb ... Unpacking libpipeline1:armhf (1.5.7-1) ... Selecting previously unselected package man-db. Preparing to unpack .../13-man-db_2.11.2-2_armhf.deb ... Unpacking man-db (2.11.2-2) ... Selecting previously unselected package autoconf. Preparing to unpack .../14-autoconf_2.71-3_all.deb ... Unpacking autoconf (2.71-3) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../15-autotools-dev_20220109.1_all.deb ... Unpacking autotools-dev (20220109.1) ... Selecting previously unselected package automake. Preparing to unpack .../16-automake_1%3a1.16.5-1.3_all.deb ... Unpacking automake (1:1.16.5-1.3) ... Selecting previously unselected package autopoint. Preparing to unpack .../17-autopoint_0.21-12_all.deb ... Unpacking autopoint (0.21-12) ... Selecting previously unselected package bison. Preparing to unpack .../18-bison_2%3a3.8.2+dfsg-1+b1_armhf.deb ... Unpacking bison (2:3.8.2+dfsg-1+b1) ... Selecting previously unselected package libicu72:armhf. Preparing to unpack .../19-libicu72_72.1-3_armhf.deb ... Unpacking libicu72:armhf (72.1-3) ... Selecting previously unselected package libxml2:armhf. Preparing to unpack .../20-libxml2_2.9.14+dfsg-1.2_armhf.deb ... Unpacking libxml2:armhf (2.9.14+dfsg-1.2) ... Selecting previously unselected package libarchive13:armhf. Preparing to unpack .../21-libarchive13_3.6.2-1_armhf.deb ... Unpacking libarchive13:armhf (3.6.2-1) ... Selecting previously unselected package libbrotli1:armhf. Preparing to unpack .../22-libbrotli1_1.0.9-2+b6_armhf.deb ... Unpacking libbrotli1:armhf (1.0.9-2+b6) ... Selecting previously unselected package libsasl2-modules-db:armhf. Preparing to unpack .../23-libsasl2-modules-db_2.1.28+dfsg-10_armhf.deb ... Unpacking libsasl2-modules-db:armhf (2.1.28+dfsg-10) ... Selecting previously unselected package libsasl2-2:armhf. Preparing to unpack .../24-libsasl2-2_2.1.28+dfsg-10_armhf.deb ... Unpacking libsasl2-2:armhf (2.1.28+dfsg-10) ... Selecting previously unselected package libldap-2.5-0:armhf. Preparing to unpack .../25-libldap-2.5-0_2.5.13+dfsg-5_armhf.deb ... Unpacking libldap-2.5-0:armhf (2.5.13+dfsg-5) ... Selecting previously unselected package libnghttp2-14:armhf. Preparing to unpack .../26-libnghttp2-14_1.52.0-1_armhf.deb ... Unpacking libnghttp2-14:armhf (1.52.0-1) ... Selecting previously unselected package libpsl5:armhf. Preparing to unpack .../27-libpsl5_0.21.2-1_armhf.deb ... Unpacking libpsl5:armhf (0.21.2-1) ... Selecting previously unselected package librtmp1:armhf. Preparing to unpack .../28-librtmp1_2.4+20151223.gitfa8646d.1-2+b2_armhf.deb ... Unpacking librtmp1:armhf (2.4+20151223.gitfa8646d.1-2+b2) ... Selecting previously unselected package libssh2-1:armhf. Preparing to unpack .../29-libssh2-1_1.10.0-3+b1_armhf.deb ... Unpacking libssh2-1:armhf (1.10.0-3+b1) ... Selecting previously unselected package libcurl4:armhf. Preparing to unpack .../30-libcurl4_7.88.1-10_armhf.deb ... Unpacking libcurl4:armhf (7.88.1-10) ... Selecting previously unselected package libexpat1:armhf. Preparing to unpack .../31-libexpat1_2.5.0-1_armhf.deb ... Unpacking libexpat1:armhf (2.5.0-1) ... Selecting previously unselected package libjsoncpp25:armhf. Preparing to unpack .../32-libjsoncpp25_1.9.5-4_armhf.deb ... Unpacking libjsoncpp25:armhf (1.9.5-4) ... Selecting previously unselected package librhash0:armhf. Preparing to unpack .../33-librhash0_1.4.3-3_armhf.deb ... Unpacking librhash0:armhf (1.4.3-3) ... Selecting previously unselected package libuv1:armhf. Preparing to unpack .../34-libuv1_1.44.2-1_armhf.deb ... Unpacking libuv1:armhf (1.44.2-1) ... Selecting previously unselected package cmake-data. Preparing to unpack .../35-cmake-data_3.25.1-1_all.deb ... Unpacking cmake-data (3.25.1-1) ... Selecting previously unselected package cmake. Preparing to unpack .../36-cmake_3.25.1-1_armhf.deb ... Unpacking cmake (3.25.1-1) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../37-libdebhelper-perl_13.11.4_all.deb ... Unpacking libdebhelper-perl (13.11.4) ... Selecting previously unselected package libtool. Preparing to unpack .../38-libtool_2.4.7-5_all.deb ... Unpacking libtool (2.4.7-5) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../39-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../40-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libsub-override-perl. Preparing to unpack .../41-libsub-override-perl_0.09-4_all.deb ... Unpacking libsub-override-perl (0.09-4) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../42-libfile-stripnondeterminism-perl_1.13.1-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.13.1-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../43-dh-strip-nondeterminism_1.13.1-1_all.deb ... Unpacking dh-strip-nondeterminism (1.13.1-1) ... Selecting previously unselected package libelf1:armhf. Preparing to unpack .../44-libelf1_0.188-2.1_armhf.deb ... Unpacking libelf1:armhf (0.188-2.1) ... Selecting previously unselected package dwz. Preparing to unpack .../45-dwz_0.15-1_armhf.deb ... Unpacking dwz (0.15-1) ... Selecting previously unselected package gettext. Preparing to unpack .../46-gettext_0.21-12_armhf.deb ... Unpacking gettext (0.21-12) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../47-intltool-debian_0.35.0+20060710.6_all.deb ... Unpacking intltool-debian (0.35.0+20060710.6) ... Selecting previously unselected package po-debconf. Preparing to unpack .../48-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../49-debhelper_13.11.4_all.deb ... Unpacking debhelper (13.11.4) ... Setting up libexpat1:armhf (2.5.0-1) ... Setting up libpipeline1:armhf (1.5.7-1) ... Setting up libpsl5:armhf (0.21.2-1) ... Setting up libicu72:armhf (72.1-3) ... Setting up bsdextrautils (2.38.1-5+b1) ... Setting up libmagic-mgc (1:5.44-3) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libdebhelper-perl (13.11.4) ... Setting up libbrotli1:armhf (1.0.9-2+b6) ... Setting up libnghttp2-14:armhf (1.52.0-1) ... Setting up libmagic1:armhf (1:5.44-3) ... Setting up gettext-base (0.21-12) ... Setting up m4 (1.4.19-3) ... Setting up file (1:5.44-3) ... Setting up libsasl2-modules-db:armhf (2.1.28+dfsg-10) ... Setting up autotools-dev (20220109.1) ... Setting up libuv1:armhf (1.44.2-1) ... Setting up librtmp1:armhf (2.4+20151223.gitfa8646d.1-2+b2) ... Setting up libproc2-0:armhf (2:4.0.2-3) ... Setting up autopoint (0.21-12) ... Setting up libjsoncpp25:armhf (1.9.5-4) ... Setting up libsasl2-2:armhf (2.1.28+dfsg-10) ... Setting up autoconf (2.71-3) ... Setting up sensible-utils (0.0.17+nmu1) ... Setting up librhash0:armhf (1.4.3-3) ... Setting up libuchardet0:armhf (0.0.7-1) ... Setting up procps (2:4.0.2-3) ... Setting up bison (2:3.8.2+dfsg-1+b1) ... update-alternatives: using /usr/bin/bison.yacc to provide /usr/bin/yacc (yacc) in auto mode Setting up libsub-override-perl (0.09-4) ... Setting up libssh2-1:armhf (1.10.0-3+b1) ... Setting up cmake-data (3.25.1-1) ... Setting up libelf1:armhf (0.188-2.1) ... Setting up libxml2:armhf (2.9.14+dfsg-1.2) ... Setting up automake (1:1.16.5-1.3) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up libfile-stripnondeterminism-perl (1.13.1-1) ... Setting up flex (2.6.4-8.2) ... Setting up gettext (0.21-12) ... Setting up libtool (2.4.7-5) ... Setting up libarchive13:armhf (3.6.2-1) ... Setting up libldap-2.5-0:armhf (2.5.13+dfsg-5) ... Setting up intltool-debian (0.35.0+20060710.6) ... Setting up dh-autoreconf (20) ... Setting up dh-strip-nondeterminism (1.13.1-1) ... Setting up dwz (0.15-1) ... Setting up groff-base (1.22.4-10) ... Setting up libcurl4:armhf (7.88.1-10) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up man-db (2.11.2-2) ... Not building database; man-db/auto-update is not 'true'. Setting up cmake (3.25.1-1) ... Setting up debhelper (13.11.4) ... Processing triggers for libc-bin (2.36-9) ... Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps Reading package lists... Building dependency tree... Reading state information... usrmerge is already the newest version (35). 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. I: Building the package I: user script /srv/workspace/pbuilder/9745/tmp/hooks/A99_set_merged_usr starting Re-configuring usrmerge... removed '/etc/unsupported-skip-usrmerge-conversion' The system has been successfully converted. I: user script /srv/workspace/pbuilder/9745/tmp/hooks/A99_set_merged_usr finished hostname: Name or service not known I: Running cd /build/dawg-1.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-genchanges -S > ../dawg_1.2-4_source.changes dpkg-buildpackage: info: source package dawg dpkg-buildpackage: info: source version 1.2-4 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Andreas Tille dpkg-source --before-build . dpkg-buildpackage: info: host architecture armhf debian/rules clean dh clean dh_clean debian/rules binary dh binary dh_update_autotools_config dh_autoreconf debian/rules override_dh_auto_configure make[1]: Entering directory '/build/dawg-1.2' dh_auto_configure -- \ -DCMAKE_LIBRARY_PATH=arm-linux-gnueabihf \ -DCMAKE_DATA_DIR=/usr/share/doc/dawg cd obj-arm-linux-gnueabihf && cmake -DCMAKE_INSTALL_PREFIX=/usr -DCMAKE_BUILD_TYPE=None -DCMAKE_INSTALL_SYSCONFDIR=/etc -DCMAKE_INSTALL_LOCALSTATEDIR=/var -DCMAKE_EXPORT_NO_PACKAGE_REGISTRY=ON -DCMAKE_FIND_USE_PACKAGE_REGISTRY=OFF -DCMAKE_FIND_PACKAGE_NO_PACKAGE_REGISTRY=ON -DFETCHCONTENT_FULLY_DISCONNECTED=ON -DCMAKE_INSTALL_RUNSTATEDIR=/run -DCMAKE_SKIP_INSTALL_ALL_DEPENDENCY=ON "-GUnix Makefiles" -DCMAKE_VERBOSE_MAKEFILE=ON -DCMAKE_INSTALL_LIBDIR=lib/arm-linux-gnueabihf -DCMAKE_LIBRARY_PATH=arm-linux-gnueabihf -DCMAKE_DATA_DIR=/usr/share/doc/dawg .. CMake Deprecation Warning at CMakeLists.txt:5 (CMAKE_MINIMUM_REQUIRED): Compatibility with CMake < 2.8.12 will be removed from a future version of CMake. Update the VERSION argument value or use a ... suffix to tell CMake that the project does not need compatibility with older versions. -- The C compiler identification is GNU 12.2.0 -- The CXX compiler identification is GNU 12.2.0 -- Detecting C compiler ABI info -- Detecting C compiler ABI info - done -- Check for working C compiler: /usr/bin/cc - skipped -- Detecting C compile features -- Detecting C compile features - done -- Detecting CXX compiler ABI info -- Detecting CXX compiler ABI info - done -- Check for working CXX compiler: /usr/bin/c++ - skipped -- Detecting CXX compile features -- Detecting CXX compile features - done -- Looking for bison -- Looking for bison -- /usr/bin/bison -- Looking for flex -- Looking for flex -- /usr/bin/flex -- Looking for unistd.h -- Looking for unistd.h - found -- Looking for process.h -- Looking for process.h - not found -- Looking for io.h -- Looking for io.h - not found -- Looking for getopt.h -- Looking for getopt.h - found -- Looking for stdint.h -- Looking for stdint.h - found -- Looking for sys/types.h -- Looking for sys/types.h - found -- Looking for getpid -- Looking for getpid - found -- Looking for _getpid -- Looking for _getpid - not found -- Looking for copysign -- Looking for copysign - found -- Looking for _copysign -- Looking for _copysign - not found -- Looking for snprintf -- Looking for snprintf - found -- Looking for _snprintf -- Looking for _snprintf - not found -- Configuring done -- Generating done CMake Warning: Manually-specified variables were not used by the project: CMAKE_EXPORT_NO_PACKAGE_REGISTRY CMAKE_FIND_PACKAGE_NO_PACKAGE_REGISTRY CMAKE_FIND_USE_PACKAGE_REGISTRY CMAKE_INSTALL_LIBDIR CMAKE_INSTALL_LOCALSTATEDIR CMAKE_INSTALL_RUNSTATEDIR CMAKE_INSTALL_SYSCONFDIR CMAKE_LIBRARY_PATH FETCHCONTENT_FULLY_DISCONNECTED -- Build files have been written to: /build/dawg-1.2/obj-arm-linux-gnueabihf make[1]: Leaving directory '/build/dawg-1.2' dh_auto_build cd obj-arm-linux-gnueabihf && make -j4 "INSTALL=install --strip-program=true" VERBOSE=1 make[1]: Entering directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' /usr/bin/cmake -S/build/dawg-1.2 -B/build/dawg-1.2/obj-arm-linux-gnueabihf --check-build-system CMakeFiles/Makefile.cmake 0 /usr/bin/cmake -E cmake_progress_start /build/dawg-1.2/obj-arm-linux-gnueabihf/CMakeFiles /build/dawg-1.2/obj-arm-linux-gnueabihf//CMakeFiles/progress.marks make -f CMakeFiles/Makefile2 all make[2]: Entering directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' make -f src/CMakeFiles/dawg.dir/build.make src/CMakeFiles/dawg.dir/depend make[3]: Entering directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' [ 15%] Generating lex.parser.cpp [ 15%] Generating parser.tab.cpp, parser.tab.hpp cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/bison --name-prefix=parser --defines --output-file=/build/dawg-1.2/obj-arm-linux-gnueabihf/src/parser.tab.cpp /build/dawg-1.2/src/parser.ypp cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/flex -Pparser -o/build/dawg-1.2/obj-arm-linux-gnueabihf/src/lex.parser.cpp /build/dawg-1.2/src/parser.lpp cd /build/dawg-1.2/obj-arm-linux-gnueabihf && /usr/bin/cmake -E cmake_depends "Unix Makefiles" /build/dawg-1.2 /build/dawg-1.2/src /build/dawg-1.2/obj-arm-linux-gnueabihf /build/dawg-1.2/obj-arm-linux-gnueabihf/src /build/dawg-1.2/obj-arm-linux-gnueabihf/src/CMakeFiles/dawg.dir/DependInfo.cmake --color= make[3]: Leaving directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' make -f src/CMakeFiles/dawg.dir/build.make src/CMakeFiles/dawg.dir/build make[3]: Entering directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' [ 46%] Building CXX object src/CMakeFiles/dawg.dir/indel.cpp.o [ 46%] Building CXX object src/CMakeFiles/dawg.dir/matrix.cpp.o [ 46%] Building CXX object src/CMakeFiles/dawg.dir/eigen.cpp.o [ 46%] Building CXX object src/CMakeFiles/dawg.dir/dawg.cpp.o cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -MD -MT src/CMakeFiles/dawg.dir/indel.cpp.o -MF CMakeFiles/dawg.dir/indel.cpp.o.d -o CMakeFiles/dawg.dir/indel.cpp.o -c /build/dawg-1.2/src/indel.cpp cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -MD -MT src/CMakeFiles/dawg.dir/dawg.cpp.o -MF CMakeFiles/dawg.dir/dawg.cpp.o.d -o CMakeFiles/dawg.dir/dawg.cpp.o -c /build/dawg-1.2/src/dawg.cpp cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -MD -MT src/CMakeFiles/dawg.dir/eigen.cpp.o -MF CMakeFiles/dawg.dir/eigen.cpp.o.d -o CMakeFiles/dawg.dir/eigen.cpp.o -c /build/dawg-1.2/src/eigen.cpp cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -MD -MT src/CMakeFiles/dawg.dir/matrix.cpp.o -MF CMakeFiles/dawg.dir/matrix.cpp.o.d -o CMakeFiles/dawg.dir/matrix.cpp.o -c /build/dawg-1.2/src/matrix.cpp In file included from /build/dawg-1.2/src/tree.h:7, from /build/dawg-1.2/src/dawg.cpp:20: /build/dawg-1.2/src/indel.h:72:32: warning: 'template struct std::unary_function' is deprecated [-Wdeprecated-declarations] 72 | class LinearFunc : public std::unary_function | ^~~~~~~~~~~~~~ In file included from /usr/include/c++/12/bits/refwrap.h:39, from /usr/include/c++/12/vector:66, from /build/dawg-1.2/src/dawg.h:42, from /build/dawg-1.2/src/dawg.cpp:19: /usr/include/c++/12/bits/stl_function.h:117:12: note: declared here 117 | struct unary_function | ^~~~~~~~~~~~~~ /build/dawg-1.2/src/tree.h:17:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/12/memory:76, from /build/dawg-1.2/src/dawg.h:48: /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:18:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:199:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:200:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/indel.cpp:4: /build/dawg-1.2/src/indel.h:72:32: warning: 'template struct std::unary_function' is deprecated [-Wdeprecated-declarations] 72 | class LinearFunc : public std::unary_function | ^~~~~~~~~~~~~~ In file included from /usr/include/c++/12/bits/refwrap.h:39, from /usr/include/c++/12/vector:66, from /build/dawg-1.2/src/dawg.h:42, from /build/dawg-1.2/src/indel.cpp:3: /usr/include/c++/12/bits/stl_function.h:117:12: note: declared here 117 | struct unary_function | ^~~~~~~~~~~~~~ [ 53%] Building CXX object src/CMakeFiles/dawg.dir/output.cpp.o cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -MD -MT src/CMakeFiles/dawg.dir/output.cpp.o -MF CMakeFiles/dawg.dir/output.cpp.o.d -o CMakeFiles/dawg.dir/output.cpp.o -c /build/dawg-1.2/src/output.cpp [ 61%] Building CXX object src/CMakeFiles/dawg.dir/rand.cpp.o cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -MD -MT src/CMakeFiles/dawg.dir/rand.cpp.o -MF CMakeFiles/dawg.dir/rand.cpp.o.d -o CMakeFiles/dawg.dir/rand.cpp.o -c /build/dawg-1.2/src/rand.cpp In file included from /usr/include/c++/12/vector:70: /usr/include/c++/12/bits/vector.tcc: In member function 'void std::vector<_Tp, _Alloc>::_M_realloc_insert(iterator, _Args&& ...) [with _Args = {const double&}; _Tp = double; _Alloc = std::allocator]': /usr/include/c++/12/bits/vector.tcc:439:7: note: parameter passing for argument of type 'std::vector::iterator' changed in GCC 7.1 439 | vector<_Tp, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/vector:64: In member function 'void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = double; _Alloc = std::allocator]', inlined from 'UserModel::UserModel(const std::vector&)' at /build/dawg-1.2/src/indel.cpp:51:24: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type '__gnu_cxx::__normal_iterator >' changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ [ 69%] Building CXX object src/CMakeFiles/dawg.dir/tree.cpp.o cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -MD -MT src/CMakeFiles/dawg.dir/tree.cpp.o -MF CMakeFiles/dawg.dir/tree.cpp.o.d -o CMakeFiles/dawg.dir/tree.cpp.o -c /build/dawg-1.2/src/tree.cpp [ 76%] Building CXX object src/CMakeFiles/dawg.dir/var.cpp.o cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -MD -MT src/CMakeFiles/dawg.dir/var.cpp.o -MF CMakeFiles/dawg.dir/var.cpp.o.d -o CMakeFiles/dawg.dir/var.cpp.o -c /build/dawg-1.2/src/var.cpp In file included from /usr/include/c++/12/vector:70: /usr/include/c++/12/bits/vector.tcc: In member function 'void std::vector<_Tp, _Alloc>::_M_fill_insert(iterator, size_type, const value_type&) [with _Tp = double; _Alloc = std::allocator]': /usr/include/c++/12/bits/vector.tcc:523:5: note: parameter passing for argument of type 'std::vector::iterator' changed in GCC 7.1 523 | vector<_Tp, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~ In file included from /build/dawg-1.2/src/tree.h:7, from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/output.cpp:4: /build/dawg-1.2/src/indel.h:72:32: warning: 'template struct std::unary_function' is deprecated [-Wdeprecated-declarations] 72 | class LinearFunc : public std::unary_function | ^~~~~~~~~~~~~~ In file included from /usr/include/c++/12/bits/refwrap.h:39, from /usr/include/c++/12/vector:66, from /build/dawg-1.2/src/dawg.h:42, from /build/dawg-1.2/src/output.cpp:3: /usr/include/c++/12/bits/stl_function.h:117:12: note: declared here 117 | struct unary_function | ^~~~~~~~~~~~~~ /build/dawg-1.2/src/tree.h:17:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/12/memory:76, from /build/dawg-1.2/src/dawg.h:48: /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:18:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:199:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:200:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ In file included from /usr/include/c++/12/vector:64: In member function 'void std::vector<_Tp, _Alloc>::resize(size_type, const value_type&) [with _Tp = double; _Alloc = std::allocator]', inlined from 'bool Execute()' at /build/dawg-1.2/src/dawg.cpp:262:16: /usr/include/c++/12/bits/stl_vector.h:1032:25: note: parameter passing for argument of type '__gnu_cxx::__normal_iterator >' changed in GCC 7.1 1032 | _M_fill_insert(end(), __new_size - size(), __x); | ~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In member function 'void std::vector<_Tp, _Alloc>::resize(size_type, const value_type&) [with _Tp = double; _Alloc = std::allocator]', inlined from 'bool Execute()' at /build/dawg-1.2/src/dawg.cpp:263:15: /usr/include/c++/12/bits/stl_vector.h:1032:25: note: parameter passing for argument of type '__gnu_cxx::__normal_iterator >' changed in GCC 7.1 1032 | _M_fill_insert(end(), __new_size - size(), __x); | ~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In member function 'void std::vector<_Tp, _Alloc>::resize(size_type, const value_type&) [with _Tp = double; _Alloc = std::allocator]', inlined from 'bool Execute()' at /build/dawg-1.2/src/dawg.cpp:264:16: /usr/include/c++/12/bits/stl_vector.h:1032:25: note: parameter passing for argument of type '__gnu_cxx::__normal_iterator >' changed in GCC 7.1 1032 | _M_fill_insert(end(), __new_size - size(), __x); | ~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /build/dawg-1.2/src/tree.h:7, from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/var.cpp:4: /build/dawg-1.2/src/indel.h:72:32: warning: 'template struct std::unary_function' is deprecated [-Wdeprecated-declarations] 72 | class LinearFunc : public std::unary_function | ^~~~~~~~~~~~~~ In file included from /usr/include/c++/12/bits/refwrap.h:39, from /usr/include/c++/12/vector:66, from /build/dawg-1.2/src/dawg.h:42, from /build/dawg-1.2/src/var.cpp:3: /usr/include/c++/12/bits/stl_function.h:117:12: note: declared here 117 | struct unary_function | ^~~~~~~~~~~~~~ /build/dawg-1.2/src/tree.h:17:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/12/memory:76, from /build/dawg-1.2/src/dawg.h:48: /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:18:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/tree.h:7, from /build/dawg-1.2/src/tree.cpp:4: /build/dawg-1.2/src/indel.h:72:32: warning: 'template struct std::unary_function' is deprecated [-Wdeprecated-declarations] 72 | class LinearFunc : public std::unary_function | ^~~~~~~~~~~~~~ In file included from /usr/include/c++/12/bits/refwrap.h:39, from /usr/include/c++/12/vector:66, from /build/dawg-1.2/src/dawg.h:42, from /build/dawg-1.2/src/tree.cpp:3: /usr/include/c++/12/bits/stl_function.h:117:12: note: declared here 117 | struct unary_function | ^~~~~~~~~~~~~~ /build/dawg-1.2/src/tree.h:17:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/12/memory:76, from /build/dawg-1.2/src/dawg.h:48: /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:18:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:199:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:200:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:199:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:200:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ [ 84%] Building CXX object src/CMakeFiles/dawg.dir/lex.parser.cpp.o cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -I "/build/dawg-1.2/src" -MD -MT src/CMakeFiles/dawg.dir/lex.parser.cpp.o -MF CMakeFiles/dawg.dir/lex.parser.cpp.o.d -o CMakeFiles/dawg.dir/lex.parser.cpp.o -c /build/dawg-1.2/obj-arm-linux-gnueabihf/src/lex.parser.cpp [ 92%] Building CXX object src/CMakeFiles/dawg.dir/parser.tab.cpp.o cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -I "/build/dawg-1.2/src" -MD -MT src/CMakeFiles/dawg.dir/parser.tab.cpp.o -MF CMakeFiles/dawg.dir/parser.tab.cpp.o.d -o CMakeFiles/dawg.dir/parser.tab.cpp.o -c /build/dawg-1.2/obj-arm-linux-gnueabihf/src/parser.tab.cpp In file included from /build/dawg-1.2/src/tree.h:7, from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.lpp:5: /build/dawg-1.2/src/indel.h:72:32: warning: 'template struct std::unary_function' is deprecated [-Wdeprecated-declarations] 72 | class LinearFunc : public std::unary_function | ^~~~~~~~~~~~~~ In file included from /usr/include/c++/12/bits/refwrap.h:39, from /usr/include/c++/12/vector:66, from /build/dawg-1.2/src/dawg.h:42, from /build/dawg-1.2/src/parser.lpp:4: /usr/include/c++/12/bits/stl_function.h:117:12: note: declared here 117 | struct unary_function | ^~~~~~~~~~~~~~ /build/dawg-1.2/src/tree.h:17:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/12/memory:76, from /build/dawg-1.2/src/dawg.h:48: /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:18:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:199:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:200:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/tree.h:7, from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.ypp:5: /build/dawg-1.2/src/indel.h:72:32: warning: 'template struct std::unary_function' is deprecated [-Wdeprecated-declarations] 72 | class LinearFunc : public std::unary_function | ^~~~~~~~~~~~~~ In file included from /usr/include/c++/12/bits/refwrap.h:39, from /usr/include/c++/12/vector:66, from /build/dawg-1.2/src/dawg.h:42, from /build/dawg-1.2/src/parser.ypp:4: /usr/include/c++/12/bits/stl_function.h:117:12: note: declared here 117 | struct unary_function | ^~~~~~~~~~~~~~ /build/dawg-1.2/src/tree.h:17:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/12/memory:76, from /build/dawg-1.2/src/dawg.h:48: /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:18:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:199:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:200:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ In file included from /usr/include/c++/12/map:60, from /build/dawg-1.2/src/dawg.h:49: /usr/include/c++/12/bits/stl_tree.h: In function 'std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::iterator std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_emplace_hint_unique(const_iterator, _Args&& ...) [with _Args = {const std::piecewise_construct_t&, std::tuple, std::allocator >&>, std::tuple<>}; _Key = std::__cxx11::basic_string; _Val = std::pair, double>; _KeyOfValue = std::_Select1st, double> >; _Compare = std::less >; _Alloc = std::allocator, double> >]': /usr/include/c++/12/bits/stl_tree.h:2457:7: note: parameter passing for argument of type 'std::_Rb_tree, std::pair, double>, std::_Select1st, double> >, std::less >, std::allocator, double> > >::const_iterator' changed in GCC 7.1 2457 | _Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/map:61: In member function 'std::map<_Key, _Tp, _Compare, _Alloc>::mapped_type& std::map<_Key, _Tp, _Compare, _Alloc>::operator[](const key_type&) [with _Key = std::__cxx11::basic_string; _Tp = double; _Compare = std::less >; _Alloc = std::allocator, double> >]', inlined from 'void Tree::Evolve(Node&)' at /build/dawg-1.2/src/tree.cpp:294:61: /usr/include/c++/12/bits/stl_map.h:511:44: note: parameter passing for argument of type 'std::_Rb_tree, std::pair, double>, std::_Select1st, double> >, std::less >, std::allocator, double> > >::const_iterator' changed in GCC 7.1 511 | __i = _M_t._M_emplace_hint_unique(__i, std::piecewise_construct, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 512 | std::tuple(__k), | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 513 | std::tuple<>()); | ~~~~~~~~~~~~~~~ In member function 'std::map<_Key, _Tp, _Compare, _Alloc>::mapped_type& std::map<_Key, _Tp, _Compare, _Alloc>::operator[](const key_type&) [with _Key = std::__cxx11::basic_string; _Tp = double; _Compare = std::less >; _Alloc = std::allocator, double> >]', inlined from 'void Tree::ProcessNewickNode(NewickNode*, const std::string&)' at /build/dawg-1.2/src/tree.cpp:222:26: /usr/include/c++/12/bits/stl_map.h:511:44: note: parameter passing for argument of type 'std::_Rb_tree, std::pair, double>, std::_Select1st, double> >, std::less >, std::allocator, double> > >::const_iterator' changed in GCC 7.1 511 | __i = _M_t._M_emplace_hint_unique(__i, std::piecewise_construct, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 512 | std::tuple(__k), | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 513 | std::tuple<>()); | ~~~~~~~~~~~~~~~ [100%] Linking CXX executable dawg cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/cmake -E cmake_link_script CMakeFiles/dawg.dir/link.txt --verbose=1 /usr/bin/c++ -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -Wl,-z,relro -Wl,-z,now -rdynamic CMakeFiles/dawg.dir/dawg.cpp.o CMakeFiles/dawg.dir/eigen.cpp.o CMakeFiles/dawg.dir/indel.cpp.o CMakeFiles/dawg.dir/matrix.cpp.o CMakeFiles/dawg.dir/output.cpp.o CMakeFiles/dawg.dir/rand.cpp.o CMakeFiles/dawg.dir/tree.cpp.o CMakeFiles/dawg.dir/var.cpp.o CMakeFiles/dawg.dir/lex.parser.cpp.o CMakeFiles/dawg.dir/parser.tab.cpp.o -o dawg make[3]: Leaving directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' [100%] Built target dawg make[2]: Leaving directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' /usr/bin/cmake -E cmake_progress_start /build/dawg-1.2/obj-arm-linux-gnueabihf/CMakeFiles 0 make[1]: Leaving directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' debian/rules override_dh_auto_test make[1]: Entering directory '/build/dawg-1.2' # FIXME: This test fails - but let the build pass anyway for the moment # see https://github.com/reedacartwright/dawg/issues/56 cd tests && PATH=$PATH:/build/dawg-1.2/obj-arm-linux-gnueabihf/src sh test0.sh || true 2,3c2,3 < TCCTTGACCAGTTAGCAAGACGATATGCATCAAGTGCACTGGC---GTAAGTCTTTTTAC < GCTGATCATA--TAGTCCGTATAGTCACTGAACGCCGTCCTCTCG --- > AGGAACTGGTCACGTTCTGCTATACGTAGTTCACGTGACCGCATTCAGAAAAATGCGACT > AGTATTGTGATCAGGCATATCAGTGACTTGCGGCAGGAGAGC 6,7c6,7 < TCGTTGGACAGT--GCAAGACGCTATGCATCAAGTGCACTGGCTAGGTAAGTGCGTTTAT < GATGAGCACAACAGGTCCGGATAGTCCCTGAACGCTATACTCCCG --- > AGCAACTTGTCACGTTCTGCGATACGTAGTTCACGTGACCGCATTCACGCAAACACTACT > TGTGCT--GACCATGCATATCAGGGACTTGCGACATGTGGGC 10,11c10,11 < TCGA-CCCCAAA--TTAATACGTTAGTCATCAAGTGCACTGAC---GTAATAGCGTTTAT < GATGATGAGTACTAGCCCGTGGAAACCCTAAAAGCGTTACCCCCG --- > AGCATGGTGTCAAGTTCTGCGTTCAGTAGTTAACCAGACGGCATTAACGCTAATACATC- > -GTGTT--GACCTACCAACGTACGGACTTGCGTAATGTGGTC 14,15c14,15 < TCGTTGAACAGT--GCAAGACGCTATGCATCAAGTGCACTGGC---GTAAGTGCGTTTAT < GATGAACACAACTGGTCCGTATAGTCCCTGAACGCTGTACTCCCG --- > AGCAACTTGTCACGTTCTGCGATACGTAGTTCACGTGACCGCATTCACGCAAATACTACT > TGTGTT--GACCAGGCATATCAGGGACTTGCGACATGAGGGC 18,19c18,19 < TCGTACCACAGT--TCAAGACGCTAGGCATCAAGTGCACTGGC---GTAATTGCGTTTAT < GATGGACACAACTAGTCCGTTGAATCCCTGAACGCTTTACCCCCG --- > AGCATGGTGTCAAGTTCTGCGATCCGTAGTTCACGTGACCGCATTAACGCAAATACTACC > TGTGTT--GATCAGGCAACTTAGGGACTTGCGAAATGGGGGC make[1]: Leaving directory '/build/dawg-1.2' create-stamp debian/debhelper-build-stamp dh_prep dh_auto_install --destdir=debian/dawg/ cd obj-arm-linux-gnueabihf && make -j4 install DESTDIR=/build/dawg-1.2/debian/dawg AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[1]: Entering directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' /usr/bin/cmake -S/build/dawg-1.2 -B/build/dawg-1.2/obj-arm-linux-gnueabihf --check-build-system CMakeFiles/Makefile.cmake 0 make -f CMakeFiles/Makefile2 preinstall make[2]: Entering directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' make[2]: Nothing to be done for 'preinstall'. make[2]: Leaving directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' Install the project... /usr/bin/cmake -P cmake_install.cmake -- Install configuration: "None" -- Installing: /build/dawg-1.2/debian/dawg/usr/bin/dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/applications/dawg.desktop -- Installing: /build/dawg-1.2/debian/dawg/usr/share/pixmaps/dawg.png -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example0.dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example1.dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example2.dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example3.dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example4.dawg make[1]: Leaving directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' dh_install dh_installdocs dh_installchangelogs dh_installman dh_perl dh_link dh_strip_nondeterminism dh_compress debian/rules override_dh_fixperms make[1]: Entering directory '/build/dawg-1.2' dh_fixperms chmod -x debian/dawg/usr/share/doc/dawg/examples/* make[1]: Leaving directory '/build/dawg-1.2' dh_missing dh_dwz -a dh_strip -a dh_makeshlibs -a dh_shlibdeps -a dpkg-shlibdeps: warning: debian/dawg/usr/bin/dawg contains an unresolvable reference to symbol __aeabi_atexit@CXXABI_ARM_1.3.3: it's probably a plugin dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'dawg' in '../dawg_1.2-4_armhf.deb'. dpkg-deb: building package 'dawg-dbgsym' in '../dawg-dbgsym_1.2-4_armhf.deb'. dpkg-genbuildinfo --build=binary -O../dawg_1.2-4_armhf.buildinfo dpkg-genchanges --build=binary -O../dawg_1.2-4_armhf.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration I: user script /srv/workspace/pbuilder/9745/tmp/hooks/B01_cleanup starting I: user script /srv/workspace/pbuilder/9745/tmp/hooks/B01_cleanup finished I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/9745 and its subdirectories I: Current time: Wed Jun 7 22:21:28 +14 2023 I: pbuilder-time-stamp: 1686126088