Diff of the two buildlogs: -- --- b1/build.log 2024-05-17 20:31:44.186448715 +0000 +++ b2/build.log 2024-05-17 20:52:22.573765362 +0000 @@ -1,6 +1,6 @@ I: pbuilder: network access will be disabled during build -I: Current time: Fri May 17 07:56:08 -12 2024 -I: pbuilder-time-stamp: 1715975768 +I: Current time: Sat May 18 10:31:55 +14 2024 +I: pbuilder-time-stamp: 1715977915 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/unstable-reproducible-base.tgz] I: copying local configuration @@ -30,52 +30,84 @@ dpkg-source: info: applying flaky_test.patch I: Not using root during the build. I: Installing the build-deps -I: user script /srv/workspace/pbuilder/31058/tmp/hooks/D02_print_environment starting +I: user script /srv/workspace/pbuilder/22285/tmp/hooks/D01_modify_environment starting +debug: Running on virt32b. +I: Changing host+domainname to test build reproducibility +I: Adding a custom variable just for the fun of it... +I: Changing /bin/sh to bash +'/bin/sh' -> '/bin/bash' +lrwxrwxrwx 1 root root 9 May 17 20:33 /bin/sh -> /bin/bash +I: Setting pbuilder2's login shell to /bin/bash +I: Setting pbuilder2's GECOS to second user,second room,second work-phone,second home-phone,second other +I: user script /srv/workspace/pbuilder/22285/tmp/hooks/D01_modify_environment finished +I: user script /srv/workspace/pbuilder/22285/tmp/hooks/D02_print_environment starting I: set - BUILDDIR='/build/reproducible-path' - BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' - BUILDUSERNAME='pbuilder1' - BUILD_ARCH='armhf' - DEBIAN_FRONTEND='noninteractive' - DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=5 ' - DISTRIBUTION='unstable' - HOME='/root' - HOST_ARCH='armhf' + BASH=/bin/sh + BASHOPTS=checkwinsize:cmdhist:complete_fullquote:extquote:force_fignore:globasciiranges:globskipdots:hostcomplete:interactive_comments:patsub_replacement:progcomp:promptvars:sourcepath + BASH_ALIASES=() + BASH_ARGC=() + BASH_ARGV=() + BASH_CMDS=() + BASH_LINENO=([0]="12" [1]="0") + BASH_LOADABLES_PATH=/usr/local/lib/bash:/usr/lib/bash:/opt/local/lib/bash:/usr/pkg/lib/bash:/opt/pkg/lib/bash:. + BASH_SOURCE=([0]="/tmp/hooks/D02_print_environment" [1]="/tmp/hooks/D02_print_environment") + BASH_VERSINFO=([0]="5" [1]="2" [2]="21" [3]="1" [4]="release" [5]="arm-unknown-linux-gnueabihf") + BASH_VERSION='5.2.21(1)-release' + BUILDDIR=/build/reproducible-path + BUILDUSERGECOS='second user,second room,second work-phone,second home-phone,second other' + BUILDUSERNAME=pbuilder2 + BUILD_ARCH=armhf + DEBIAN_FRONTEND=noninteractive + DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=4 ' + DIRSTACK=() + DISTRIBUTION=unstable + EUID=0 + FUNCNAME=([0]="Echo" [1]="main") + GROUPS=() + HOME=/root + HOSTNAME=i-capture-the-hostname + HOSTTYPE=arm + HOST_ARCH=armhf IFS=' ' - INVOCATION_ID='479bc79ca9774295bc6c521af405ed08' - LANG='C' - LANGUAGE='en_US:en' - LC_ALL='C' - MAIL='/var/mail/root' - OPTIND='1' - PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' - PBCURRENTCOMMANDLINEOPERATION='build' - PBUILDER_OPERATION='build' - PBUILDER_PKGDATADIR='/usr/share/pbuilder' - PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' - PBUILDER_SYSCONFDIR='/etc' - PPID='31058' - PS1='# ' - PS2='> ' + INVOCATION_ID=5ed1f337754847068a345df79dc0031a + LANG=C + LANGUAGE=it_CH:it + LC_ALL=C + MACHTYPE=arm-unknown-linux-gnueabihf + MAIL=/var/mail/root + OPTERR=1 + OPTIND=1 + OSTYPE=linux-gnueabihf + PATH=/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path + PBCURRENTCOMMANDLINEOPERATION=build + PBUILDER_OPERATION=build + PBUILDER_PKGDATADIR=/usr/share/pbuilder + PBUILDER_PKGLIBDIR=/usr/lib/pbuilder + PBUILDER_SYSCONFDIR=/etc + PIPESTATUS=([0]="0") + POSIXLY_CORRECT=y + PPID=22285 PS4='+ ' - PWD='/' - SHELL='/bin/bash' - SHLVL='2' - SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.mp6MxaNR/pbuilderrc_lS8X --distribution unstable --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/unstable-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.mp6MxaNR/b1 --logfile b1/build.log milib_2.2.0+dfsg-1.dsc' - SUDO_GID='114' - SUDO_UID='109' - SUDO_USER='jenkins' - TERM='unknown' - TZ='/usr/share/zoneinfo/Etc/GMT+12' - USER='root' - _='/usr/bin/systemd-run' - http_proxy='http://10.0.0.15:3142/' + PWD=/ + SHELL=/bin/bash + SHELLOPTS=braceexpand:errexit:hashall:interactive-comments:posix + SHLVL=3 + SUDO_COMMAND='/usr/bin/timeout -k 24.1h 24h /usr/bin/ionice -c 3 /usr/bin/nice -n 11 /usr/bin/unshare --uts -- /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.mp6MxaNR/pbuilderrc_dgV0 --distribution unstable --hookdir /etc/pbuilder/rebuild-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/unstable-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.mp6MxaNR/b2 --logfile b2/build.log milib_2.2.0+dfsg-1.dsc' + SUDO_GID=112 + SUDO_UID=106 + SUDO_USER=jenkins + TERM=unknown + TZ=/usr/share/zoneinfo/Etc/GMT-14 + UID=0 + USER=root + _='I: set' + http_proxy=http://10.0.0.15:3142/ I: uname -a - Linux ff64a 6.1.0-21-arm64 #1 SMP Debian 6.1.90-1 (2024-05-03) aarch64 GNU/Linux + Linux i-capture-the-hostname 6.1.0-21-armmp-lpae #1 SMP Debian 6.1.90-1 (2024-05-03) armv7l GNU/Linux I: ls -l /bin - lrwxrwxrwx 1 root root 7 May 16 07:45 /bin -> usr/bin -I: user script /srv/workspace/pbuilder/31058/tmp/hooks/D02_print_environment finished + lrwxrwxrwx 1 root root 7 May 17 07:43 /bin -> usr/bin +I: user script /srv/workspace/pbuilder/22285/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy @@ -491,7 +523,7 @@ Get: 344 http://deb.debian.org/debian unstable/main armhf libmockito-java all 2.23.0-2 [479 kB] Get: 345 http://deb.debian.org/debian unstable/main armhf libredberry-pipe-java all 1.0.0~alpha0-3 [62.7 kB] Get: 346 http://deb.debian.org/debian unstable/main armhf libtrove3-java all 3.0.3-5 [2146 kB] -Fetched 286 MB in 8s (37.2 MB/s) +Fetched 286 MB in 23s (12.7 MB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package libpipeline1:armhf. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19464 files and directories currently installed.) @@ -1620,8 +1652,8 @@ Setting up tzdata (2024a-4) ... Current default time zone: 'Etc/UTC' -Local time is now: Fri May 17 20:00:00 UTC 2024. -Universal Time is now: Fri May 17 20:00:00 UTC 2024. +Local time is now: Fri May 17 20:37:28 UTC 2024. +Universal Time is now: Fri May 17 20:37:28 UTC 2024. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up libgeronimo-annotation-1.3-spec-java (1.3-1) ... @@ -2104,7 +2136,11 @@ Building tag database... -> Finished parsing the build-deps I: Building the package -I: Running cd /build/reproducible-path/milib-2.2.0+dfsg/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../milib_2.2.0+dfsg-1_source.changes +I: user script /srv/workspace/pbuilder/22285/tmp/hooks/A99_set_merged_usr starting +Not re-configuring usrmerge for unstable +I: user script /srv/workspace/pbuilder/22285/tmp/hooks/A99_set_merged_usr finished +hostname: Name or service not known +I: Running cd /build/reproducible-path/milib-2.2.0+dfsg/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-genchanges -S > ../milib_2.2.0+dfsg-1_source.changes dpkg-buildpackage: info: source package milib dpkg-buildpackage: info: source version 2.2.0+dfsg-1 dpkg-buildpackage: info: source distribution unstable @@ -2138,7 +2174,7 @@ dh_auto_build mkdir -p .gradle/init.d cp /usr/share/gradle-debian-helper/init.gradle .gradle/init.d/ - gradle --info --console plain --offline --stacktrace --no-daemon --refresh-dependencies --gradle-user-home .gradle -Duser.home=. -Duser.name=debian -Ddebian.package=milib -Dfile.encoding=UTF-8 --parallel --max-workers=5 jar + gradle --info --console plain --offline --stacktrace --no-daemon --refresh-dependencies --gradle-user-home .gradle -Duser.home=. -Duser.name=debian -Ddebian.package=milib -Dfile.encoding=UTF-8 --parallel --max-workers=4 jar openjdk version "17.0.11" 2024-04-16 OpenJDK Runtime Environment (build 17.0.11+9-Debian-1) OpenJDK Server VM (build 17.0.11+9-Debian-1, mixed mode, sharing) @@ -2146,18 +2182,18 @@ To honour the JVM settings for this build a new JVM will be forked. Please consider using the daemon: https://docs.gradle.org/4.4.1/userguide/gradle_daemon.html. Starting process 'Gradle build daemon'. Working directory: /build/reproducible-path/milib-2.2.0+dfsg/.gradle/daemon/4.4.1 Command: /usr/lib/jvm/java-17-openjdk-armhf/bin/java --add-opens java.base/java.lang=ALL-UNNAMED -Xbootclasspath/a:/usr/share/java/gradle-helper-hook.jar:/usr/share/java/maven-repo-helper.jar -Dfile.encoding=UTF-8 -Duser.country=US -Duser.language=en -Duser.variant -cp /usr/share/gradle/lib/gradle-launcher-4.4.1.jar org.gradle.launcher.daemon.bootstrap.GradleDaemon 4.4.1 Successfully started process 'Gradle build daemon' -An attempt to start the daemon took 9.143 secs. -The client will now receive all logging from the daemon (pid: 15719). The daemon log file: /build/reproducible-path/milib-2.2.0+dfsg/.gradle/daemon/4.4.1/daemon-15719.out.log +An attempt to start the daemon took 3.487 secs. +The client will now receive all logging from the daemon (pid: 5993). The daemon log file: /build/reproducible-path/milib-2.2.0+dfsg/.gradle/daemon/4.4.1/daemon-5993.out.log Daemon will be stopped at the end of the build stopping after processing Closing daemon's stdin at end of input. The daemon will no longer process any standard input. -Using 5 worker leases. -Creating new cache for fileHashes, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/4.4.1/fileHashes/fileHashes.bin, access org.gradle.cache.internal.DefaultCacheAccess@10fa1cb -Creating new cache for resourceHashesCache, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/4.4.1/fileHashes/resourceHashesCache.bin, access org.gradle.cache.internal.DefaultCacheAccess@10fa1cb -Creating new cache for fileHashes, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/fileHashes/fileHashes.bin, access org.gradle.cache.internal.DefaultCacheAccess@4f5b18 +Using 4 worker leases. +Creating new cache for fileHashes, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/4.4.1/fileHashes/fileHashes.bin, access org.gradle.cache.internal.DefaultCacheAccess@1e91c2e +Creating new cache for resourceHashesCache, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/4.4.1/fileHashes/resourceHashesCache.bin, access org.gradle.cache.internal.DefaultCacheAccess@1e91c2e +Creating new cache for fileHashes, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/fileHashes/fileHashes.bin, access org.gradle.cache.internal.DefaultCacheAccess@cd426f Starting Build Compiling initialization script '/build/reproducible-path/milib-2.2.0+dfsg/.gradle/init.d/init.gradle' using SubsetScriptTransformer. -Creating new cache for metadata-1.1/results, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/transforms-1/metadata-1.1/results.bin, access org.gradle.cache.internal.DefaultCacheAccess@c42d94 +Creating new cache for metadata-1.1/results, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/transforms-1/metadata-1.1/results.bin, access org.gradle.cache.internal.DefaultCacheAccess@ae7286 Compiling initialization script '/build/reproducible-path/milib-2.2.0+dfsg/.gradle/init.d/init.gradle' using BuildScriptTransformer. Settings evaluated using settings file '/build/reproducible-path/milib-2.2.0+dfsg/settings.gradle'. Settings file not found (/build/reproducible-path/milib-2.2.0+dfsg/settings.gradle) @@ -2174,15 +2210,15 @@ Linking the generated javadoc to the system JDK API documentation All projects evaluated. Selected primary task 'jar' from project : -Creating new cache for annotation-processors, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/fileContent/annotation-processors.bin, access org.gradle.cache.internal.DefaultCacheAccess@690555 +Creating new cache for annotation-processors, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/fileContent/annotation-processors.bin, access org.gradle.cache.internal.DefaultCacheAccess@a4b8f4 Tasks to be executed: [task ':compileJava', task ':processResources', task ':classes', task ':debianMavenPom', task ':jar'] -Creating new cache for resourceHashesCache, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/fileHashes/resourceHashesCache.bin, access org.gradle.cache.internal.DefaultCacheAccess@4f5b18 -Creating new cache for taskHistory, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/taskHistory/taskHistory.bin, access org.gradle.cache.internal.DefaultCacheAccess@6f6a4f -Creating new cache for outputFiles, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/buildOutputCleanup/outputFiles.bin, access org.gradle.cache.internal.DefaultCacheAccess@451c61 +Creating new cache for resourceHashesCache, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/fileHashes/resourceHashesCache.bin, access org.gradle.cache.internal.DefaultCacheAccess@cd426f +Creating new cache for taskHistory, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/taskHistory/taskHistory.bin, access org.gradle.cache.internal.DefaultCacheAccess@142c9af +Creating new cache for outputFiles, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/buildOutputCleanup/outputFiles.bin, access org.gradle.cache.internal.DefaultCacheAccess@1e015f2 :compileJava (Thread[Task worker for ':',5,main]) started. :compileJava -Putting task artifact state for task ':compileJava' into context took 0.043 secs. -Creating new cache for metadata-2.36/module-metadata, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/modules-2/metadata-2.36/module-metadata.bin, access org.gradle.cache.internal.DefaultCacheAccess@f95ca7 +Putting task artifact state for task ':compileJava' into context took 0.04 secs. +Creating new cache for metadata-2.36/module-metadata, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/modules-2/metadata-2.36/module-metadata.bin, access org.gradle.cache.internal.DefaultCacheAccess@1b4404e Loading the Maven rules... Replacing org.apache.commons:commons-math3:jar:3.6.1 -> org.apache.commons:commons-math3:jar:debian Replacing cc.redberry:pipe:jar:1.3.0 -> cc.redberry:pipe:jar:1.0.0-alpha0 @@ -2254,7 +2290,7 @@ at java.base/java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:635) at org.gradle.internal.concurrent.ThreadFactoryImpl$ManagedThreadRunnable.run(ThreadFactoryImpl.java:55) at java.base/java.lang.Thread.run(Thread.java:840) -Up-to-date check for task ':compileJava' took 39.355 secs. It is not up-to-date because: +Up-to-date check for task ':compileJava' took 15.228 secs. It is not up-to-date because: No history is available. All input files are considered out-of-date for incremental task ':compileJava'. Compiling with JDK Java compiler API. @@ -2262,37 +2298,37 @@ Note: Recompile with -Xlint:deprecation for details. Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. -:compileJava (Thread[Task worker for ':',5,main]) completed. Took 2 mins 37.299 secs. +:compileJava (Thread[Task worker for ':',5,main]) completed. Took 46.897 secs. :processResources (Thread[Task worker for ':',5,main]) started. :processResources Putting task artifact state for task ':processResources' into context took 0.0 secs. -Up-to-date check for task ':processResources' took 0.127 secs. It is not up-to-date because: +Up-to-date check for task ':processResources' took 0.037 secs. It is not up-to-date because: No history is available. -:processResources (Thread[Task worker for ':',5,main]) completed. Took 0.38 secs. +:processResources (Thread[Task worker for ':',5,main]) completed. Took 0.125 secs. :classes (Thread[Task worker for ':',5,main]) started. :classes Skipping task ':classes' as it has no actions. -:classes (Thread[Task worker for ':',5,main]) completed. Took 0.007 secs. +:classes (Thread[Task worker for ':',5,main]) completed. Took 0.002 secs. :debianMavenPom (Thread[Task worker for ':',5,main]) started. :debianMavenPom Putting task artifact state for task ':debianMavenPom' into context took 0.0 secs. -Up-to-date check for task ':debianMavenPom' took 0.01 secs. It is not up-to-date because: +Up-to-date check for task ':debianMavenPom' took 0.003 secs. It is not up-to-date because: No history is available. Generating pom file /build/reproducible-path/milib-2.2.0+dfsg/build/debian/milib.pom -:debianMavenPom (Thread[Task worker for ':',5,main]) completed. Took 0.638 secs. +:debianMavenPom (Thread[Task worker for ':',5,main]) completed. Took 0.311 secs. :jar (Thread[Task worker for ':',5,main]) started. :jar Putting task artifact state for task ':jar' into context took 0.0 secs. -Up-to-date check for task ':jar' took 0.223 secs. It is not up-to-date because: +Up-to-date check for task ':jar' took 0.122 secs. It is not up-to-date because: No history is available. -:jar (Thread[Task worker for ':',5,main]) completed. Took 2.364 secs. +:jar (Thread[Task worker for ':',5,main]) completed. Took 0.826 secs. -BUILD SUCCESSFUL in 3m 56s +BUILD SUCCESSFUL in 1m 14s 4 actionable tasks: 4 executed dh_auto_test mkdir -p .gradle/init.d cp /usr/share/gradle-debian-helper/init.gradle .gradle/init.d/ - gradle --info --console plain --offline --stacktrace --no-daemon --refresh-dependencies --gradle-user-home .gradle -Duser.home=. -Duser.name=debian -Ddebian.package=milib -Dfile.encoding=UTF-8 --parallel --max-workers=5 test + gradle --info --console plain --offline --stacktrace --no-daemon --refresh-dependencies --gradle-user-home .gradle -Duser.home=. -Duser.name=debian -Ddebian.package=milib -Dfile.encoding=UTF-8 --parallel --max-workers=4 test openjdk version "17.0.11" 2024-04-16 OpenJDK Runtime Environment (build 17.0.11+9-Debian-1) OpenJDK Server VM (build 17.0.11+9-Debian-1, mixed mode, sharing) @@ -2300,17 +2336,17 @@ To honour the JVM settings for this build a new JVM will be forked. Please consider using the daemon: https://docs.gradle.org/4.4.1/userguide/gradle_daemon.html. Starting process 'Gradle build daemon'. Working directory: /build/reproducible-path/milib-2.2.0+dfsg/.gradle/daemon/4.4.1 Command: /usr/lib/jvm/java-17-openjdk-armhf/bin/java --add-opens java.base/java.lang=ALL-UNNAMED -Xbootclasspath/a:/usr/share/java/gradle-helper-hook.jar:/usr/share/java/maven-repo-helper.jar -Dfile.encoding=UTF-8 -Duser.country=US -Duser.language=en -Duser.variant -cp /usr/share/gradle/lib/gradle-launcher-4.4.1.jar org.gradle.launcher.daemon.bootstrap.GradleDaemon 4.4.1 Successfully started process 'Gradle build daemon' -An attempt to start the daemon took 8.333 secs. -The client will now receive all logging from the daemon (pid: 22174). The daemon log file: /build/reproducible-path/milib-2.2.0+dfsg/.gradle/daemon/4.4.1/daemon-22174.out.log +An attempt to start the daemon took 3.42 secs. +The client will now receive all logging from the daemon (pid: 7411). The daemon log file: /build/reproducible-path/milib-2.2.0+dfsg/.gradle/daemon/4.4.1/daemon-7411.out.log Daemon will be stopped at the end of the build stopping after processing Closing daemon's stdin at end of input. The daemon will no longer process any standard input. -Using 5 worker leases. -Creating new cache for fileHashes, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/4.4.1/fileHashes/fileHashes.bin, access org.gradle.cache.internal.DefaultCacheAccess@15e5a47 -Creating new cache for resourceHashesCache, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/4.4.1/fileHashes/resourceHashesCache.bin, access org.gradle.cache.internal.DefaultCacheAccess@15e5a47 -Creating new cache for fileHashes, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/fileHashes/fileHashes.bin, access org.gradle.cache.internal.DefaultCacheAccess@38a3d1 +Using 4 worker leases. +Creating new cache for fileHashes, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/4.4.1/fileHashes/fileHashes.bin, access org.gradle.cache.internal.DefaultCacheAccess@1e3eb3d +Creating new cache for resourceHashesCache, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/4.4.1/fileHashes/resourceHashesCache.bin, access org.gradle.cache.internal.DefaultCacheAccess@1e3eb3d +Creating new cache for fileHashes, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/fileHashes/fileHashes.bin, access org.gradle.cache.internal.DefaultCacheAccess@33a711 Starting Build -Creating new cache for metadata-1.1/results, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/transforms-1/metadata-1.1/results.bin, access org.gradle.cache.internal.DefaultCacheAccess@cbc92e +Creating new cache for metadata-1.1/results, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/transforms-1/metadata-1.1/results.bin, access org.gradle.cache.internal.DefaultCacheAccess@1ca1bd9 Settings evaluated using settings file '/build/reproducible-path/milib-2.2.0+dfsg/settings.gradle'. Settings file not found (/build/reproducible-path/milib-2.2.0+dfsg/settings.gradle) Root project name not defined in settings.gradle, defaulting to 'milib' instead of the name of the root directory 'milib-2.2.0+dfsg' @@ -2324,15 +2360,15 @@ Linking the generated javadoc to the system JDK API documentation All projects evaluated. Selected primary task 'test' from project : -Creating new cache for annotation-processors, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/fileContent/annotation-processors.bin, access org.gradle.cache.internal.DefaultCacheAccess@1596257 +Creating new cache for annotation-processors, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/fileContent/annotation-processors.bin, access org.gradle.cache.internal.DefaultCacheAccess@11bb583 Tasks to be executed: [task ':compileJava', task ':processResources', task ':classes', task ':compileTestJava', task ':processTestResources', task ':testClasses', task ':test'] -Creating new cache for resourceHashesCache, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/fileHashes/resourceHashesCache.bin, access org.gradle.cache.internal.DefaultCacheAccess@38a3d1 -Creating new cache for taskHistory, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/taskHistory/taskHistory.bin, access org.gradle.cache.internal.DefaultCacheAccess@750b4e -Creating new cache for outputFiles, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/buildOutputCleanup/outputFiles.bin, access org.gradle.cache.internal.DefaultCacheAccess@12ba3df +Creating new cache for resourceHashesCache, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/fileHashes/resourceHashesCache.bin, access org.gradle.cache.internal.DefaultCacheAccess@33a711 +Creating new cache for taskHistory, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/taskHistory/taskHistory.bin, access org.gradle.cache.internal.DefaultCacheAccess@618871 +Creating new cache for outputFiles, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/buildOutputCleanup/outputFiles.bin, access org.gradle.cache.internal.DefaultCacheAccess@b50e54 :compileJava (Thread[Task worker for ':',5,main]) started. :compileJava -Putting task artifact state for task ':compileJava' into context took 0.043 secs. -Creating new cache for metadata-2.36/module-metadata, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/modules-2/metadata-2.36/module-metadata.bin, access org.gradle.cache.internal.DefaultCacheAccess@17d0a6a +Putting task artifact state for task ':compileJava' into context took 0.014 secs. +Creating new cache for metadata-2.36/module-metadata, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/modules-2/metadata-2.36/module-metadata.bin, access org.gradle.cache.internal.DefaultCacheAccess@29ede3 Loading the Maven rules... Replacing org.apache.commons:commons-math3:jar:3.6.1 -> org.apache.commons:commons-math3:jar:debian Replacing cc.redberry:pipe:jar:1.3.0 -> cc.redberry:pipe:jar:1.0.0-alpha0 @@ -2356,20 +2392,20 @@ Passing through org.jsr-305:jsr305:jar:0.x Passing through com.google.errorprone:error_prone_annotations:jar:debian Passing through com.google.errorprone:error_prone_parent:jar:debian -Skipping task ':compileJava' as it is up-to-date (took 9.249 secs). +Skipping task ':compileJava' as it is up-to-date (took 3.012 secs). :compileJava UP-TO-DATE -:compileJava (Thread[Task worker for ':',5,main]) completed. Took 9.544 secs. +:compileJava (Thread[Task worker for ':',5,main]) completed. Took 3.133 secs. :processResources (Thread[Task worker for ':',5,main]) started. :processResources Putting task artifact state for task ':processResources' into context took 0.0 secs. -Skipping task ':processResources' as it is up-to-date (took 0.115 secs). +Skipping task ':processResources' as it is up-to-date (took 0.034 secs). :processResources UP-TO-DATE -:processResources (Thread[Task worker for ':',5,main]) completed. Took 0.148 secs. +:processResources (Thread[Task worker for ':',5,main]) completed. Took 0.047 secs. :classes (Thread[Task worker for ':',5,main]) started. :classes Skipping task ':classes' as it has no actions. :classes UP-TO-DATE -:classes (Thread[Task worker for ':',5,main]) completed. Took 0.009 secs. +:classes (Thread[Task worker for ':',5,main]) completed. Took 0.004 secs. :compileTestJava (Thread[Task worker for ':',5,main]) started. :compileTestJava Putting task artifact state for task ':compileTestJava' into context took 0.0 secs. @@ -2386,7 +2422,7 @@ Passing through net.bytebuddy:byte-buddy-dep:jar:debian Passing through org.ow2.asm:asm:jar:debian Passing through org.ow2.asm:asm-commons:jar:debian -Up-to-date check for task ':compileTestJava' took 32.504 secs. It is not up-to-date because: +Up-to-date check for task ':compileTestJava' took 8.901 secs. It is not up-to-date because: No history is available. All input files are considered out-of-date for incremental task ':compileTestJava'. Compiling with JDK Java compiler API. @@ -2394,1879 +2430,61 @@ Note: Recompile with -Xlint:deprecation for details. Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. -:compileTestJava (Thread[Task worker for ':',5,main]) completed. Took 1 mins 19.656 secs. +:compileTestJava (Thread[Task worker for ':',5,main]) completed. Took 30.729 secs. :processTestResources (Thread[Task worker for ':',5,main]) started. :processTestResources Putting task artifact state for task ':processTestResources' into context took 0.0 secs. -Up-to-date check for task ':processTestResources' took 0.172 secs. It is not up-to-date because: +Up-to-date check for task ':processTestResources' took 0.112 secs. It is not up-to-date because: No history is available. -:processTestResources (Thread[Task worker for ':',5,main]) completed. Took 0.432 secs. +:processTestResources (Thread[Task worker for ':',5,main]) completed. Took 0.24 secs. :testClasses (Thread[Task worker for ':',5,main]) started. :testClasses Skipping task ':testClasses' as it has no actions. -:testClasses (Thread[Task worker for ':',5,main]) completed. Took 0.006 secs. +:testClasses (Thread[Task worker for ':',5,main]) completed. Took 0.003 secs. :test (Thread[Task worker for ':',5,main]) started. :test Putting task artifact state for task ':test' into context took 0.0 secs. -Up-to-date check for task ':test' took 7.541 secs. It is not up-to-date because: +Up-to-date check for task ':test' took 2.637 secs. It is not up-to-date because: No history is available. -Starting process 'Gradle Test Executor 1'. Working directory: /build/reproducible-path/milib-2.2.0+dfsg Command: /usr/lib/jvm/java-17-openjdk-armhf/bin/java -Dorg.gradle.native=false @/tmp/gradle-worker-classpath14842924770810497216txt -Xms1024m -Xmx2048m -Dfile.encoding=UTF-8 -Duser.country=US -Duser.language=en -Duser.variant -ea worker.org.gradle.process.internal.worker.GradleWorkerMain 'Gradle Test Executor 1' +Starting process 'Gradle Test Executor 1'. Working directory: /build/reproducible-path/milib-2.2.0+dfsg Command: /usr/lib/jvm/java-17-openjdk-armhf/bin/java -Dorg.gradle.native=false @/tmp/gradle-worker-classpath13941588248635593784txt -Xms1024m -Xmx2048m -Dfile.encoding=UTF-8 -Duser.country=US -Duser.language=en -Duser.variant -ea worker.org.gradle.process.internal.worker.GradleWorkerMain 'Gradle Test Executor 1' Successfully started process 'Gradle Test Executor 1' Gradle Test Executor 1 started executing tests. -com.milaboratory.primitivio.blocks.PrimitivOBlocksTest > benchmark1 SKIPPED - -com.milaboratory.primitivio.blocks.PrimitivOBlocksTest > test1 STANDARD_OUT - Pending / IO / Serde: 1 / 0 / 3 - Pending / IO / Serde: 1 / 0 / 3 - - ================== - High compression: false - Concurrency: 4 - File size: 6799510 - Write time: 3.96s - - O. Stats: - Wall clock time: 3.98s - Total CPU time: 8.72s - User wait time: 3.28s - Serialization time: 7.17s (82.24%) - Checksum calculation time: 954.87ms (10.95%) - Compression time: 487.76ms (5.59%) - Total IO delay: 411.21ms - Concurrency overhead: 282.18ms - Uncompressed size: 18.44MiB (~2.08KiB per object) - Output size: 6.48MiB (~748B per object; compression = 35.17%) - IO speed: 15.78MiB/s - Concurrency adjusted uncompressed speed: 7.19MiB/s - Actual uncompressed speed: 4.64MiB/s - Actual speed: 1.63MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 748B - Blocks: 62 (~107.1KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - Pending / IO / Serde: 0 / 0 / 0 - Pending / IO / Serde: 0 / 0 / 0 - - I. Stats 1: - Wall clock time: 2.33s - Total CPU time: 3.7s - Serialization time: 2.85s (77.03%) - Checksum calculation time: 260.27ms (7.03%) - Compression time: 577.28ms (15.58%) - Total IO delay: 224.41ms - Input size: 6.48MiB - Decompressed size: 18.44MiB (compression = 35.17%) - IO speed: 28.95MiB/s - Concurrency adjusted uncompressed speed: 18.77MiB/s - Actual uncompressed speed: 7.9MiB/s - Actual speed: 2.78MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 748B - Blocks: 62 (~107.1KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - Pending / IO / Serde: 0 / 0 / 0 - - I. Stats 2: - Wall clock time: 3.91s - Total CPU time: 5.14s - Serialization time: 3.48s (67.61%) - Checksum calculation time: 543.12ms (10.56%) - Compression time: 1.1s (21.3%) - Total IO delay: 465.73ms - Input size: 12.97MiB - Decompressed size: 36.87MiB (compression = 35.17%) - IO speed: 27.89MiB/s - Concurrency adjusted uncompressed speed: 26.32MiB/s - Actual uncompressed speed: 9.44MiB/s - Actual speed: 3.32MiB/s - Objects: 18158 - Average object size uncompressed: 2.08KiB - Average object size compressed: 748B - Blocks: 124 (~107.1KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - Pending / IO / Serde: 0 / 0 / 0 - - ================== - High compression: false - Concurrency: 4 - File size: 6791878 - Write time: 1.38s - - O. Stats: - Wall clock time: 1.38s - Total CPU time: 1.89s - User wait time: 1.09s - Serialization time: 1.13s (60.03%) - Checksum calculation time: 231.53ms (12.27%) - Compression time: 492.17ms (26.09%) - Total IO delay: 158.52ms - Concurrency overhead: 93.91ms - Uncompressed size: 18.44MiB (~2.08KiB per object) - Output size: 6.48MiB (~748B per object; compression = 35.13%) - IO speed: 41MiB/s - Concurrency adjusted uncompressed speed: 30.47MiB/s - Actual uncompressed speed: 13.32MiB/s - Actual speed: 4.68MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 748B - Blocks: 20 (~331.63KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - - I. Stats 1: - Wall clock time: 1.32s - Total CPU time: 1.7s - Serialization time: 787.64ms (46.31%) - Checksum calculation time: 312.25ms (18.36%) - Compression time: 597.92ms (35.15%) - Total IO delay: 98.65ms - Input size: 6.48MiB - Decompressed size: 18.44MiB (compression = 35.13%) - IO speed: 66.09MiB/s - Concurrency adjusted uncompressed speed: 41.06MiB/s - Actual uncompressed speed: 13.97MiB/s - Actual speed: 4.91MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 748B - Blocks: 20 (~331.63KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - Pending / IO / Serde: 0 / 0 / 0 - - I. Stats 2: - Wall clock time: 3.08s - Total CPU time: 3.54s - Serialization time: 1.7s (47.94%) - Checksum calculation time: 574.25ms (16.23%) - Compression time: 1.25s (35.41%) - Total IO delay: 214.11ms - Input size: 12.95MiB - Decompressed size: 36.87MiB (compression = 35.13%) - IO speed: 60.53MiB/s - Concurrency adjusted uncompressed speed: 39.31MiB/s - Actual uncompressed speed: 11.99MiB/s - Actual speed: 4.21MiB/s - Objects: 18158 - Average object size uncompressed: 2.08KiB - Average object size compressed: 748B - Blocks: 40 (~331.63KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - - ================== - High compression: false - Concurrency: 1 - File size: 6799510 - Write time: 1.36s - - O. Stats: - Wall clock time: 1.37s - Total CPU time: 1.04s - User wait time: 1.24s - Serialization time: 459.6ms (44.2%) - Checksum calculation time: 142.29ms (13.69%) - Compression time: 371.82ms (35.76%) - Total IO delay: 150.07ms - Concurrency overhead: 41.47ms - Uncompressed size: 18.44MiB (~2.08KiB per object) - Output size: 6.48MiB (~748B per object; compression = 35.17%) - IO speed: 43.23MiB/s - Concurrency adjusted uncompressed speed: 14.98MiB/s - Actual uncompressed speed: 13.48MiB/s - Actual speed: 4.74MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 748B - Blocks: 62 (~107.1KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - Checksum ok! - Pending / IO / Serde: 2 / 1 / 0 - - I. Stats 1: - Wall clock time: 1.16s - Total CPU time: 1.44s - Serialization time: 603.35ms (41.94%) - Checksum calculation time: 294.81ms (20.49%) - Compression time: 515.78ms (35.85%) - Total IO delay: 320.99ms - Input size: 6.48MiB - Decompressed size: 18.44MiB (compression = 35.17%) - IO speed: 20.26MiB/s - Concurrency adjusted uncompressed speed: 10.48MiB/s - Actual uncompressed speed: 15.96MiB/s - Actual speed: 5.61MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 748B - Blocks: 62 (~107.1KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - Pending / IO / Serde: 0 / 0 / 0 - - I. Stats 2: - Wall clock time: 2.31s - Total CPU time: 3.18s - Serialization time: 1.37s (43.23%) - Checksum calculation time: 589.27ms (18.55%) - Compression time: 1.16s (36.48%) - Total IO delay: 549.87ms - Input size: 12.97MiB - Decompressed size: 36.87MiB (compression = 35.17%) - IO speed: 23.62MiB/s - Concurrency adjusted uncompressed speed: 9.9MiB/s - Actual uncompressed speed: 16MiB/s - Actual speed: 5.63MiB/s - Objects: 18158 - Average object size uncompressed: 2.08KiB - Average object size compressed: 748B - Blocks: 124 (~107.1KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - - ================== - High compression: false - Concurrency: 1 - File size: 6791878 - Write time: 1.24s - - O. Stats: - Wall clock time: 1.25s - Total CPU time: 962.36ms - User wait time: 1.1s - Serialization time: 439.25ms (45.64%) - Checksum calculation time: 158.59ms (16.48%) - Compression time: 318.18ms (33.06%) - Total IO delay: 119.42ms - Concurrency overhead: 7.75ms - Uncompressed size: 18.44MiB (~2.08KiB per object) - Output size: 6.48MiB (~748B per object; compression = 35.13%) - IO speed: 54.43MiB/s - Concurrency adjusted uncompressed speed: 16.93MiB/s - Actual uncompressed speed: 14.79MiB/s - Actual speed: 5.19MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 748B - Blocks: 20 (~331.63KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - Checksum ok! - Pending / IO / Serde: 0 / 0 / 0 - - I. Stats 1: - Wall clock time: 1.09s - Total CPU time: 1.44s - Serialization time: 543.58ms (37.71%) - Checksum calculation time: 266.81ms (18.51%) - Compression time: 628.08ms (43.58%) - Total IO delay: 69.24ms - Input size: 6.48MiB - Decompressed size: 18.44MiB (compression = 35.13%) - IO speed: 93.87MiB/s - Concurrency adjusted uncompressed speed: 12.21MiB/s - Actual uncompressed speed: 16.95MiB/s - Actual speed: 5.95MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 748B - Blocks: 20 (~331.63KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - Pending / IO / Serde: 0 / 0 / 0 - - I. Stats 2: - Wall clock time: 2.55s - Total CPU time: 3s - Serialization time: 1.08s (36.03%) - Checksum calculation time: 556.96ms (18.54%) - Compression time: 1.36s (45.22%) - Total IO delay: 161ms - Input size: 12.95MiB - Decompressed size: 36.87MiB (compression = 35.13%) - IO speed: 80.46MiB/s - Concurrency adjusted uncompressed speed: 11.65MiB/s - Actual uncompressed speed: 14.45MiB/s - Actual speed: 5.08MiB/s - Objects: 18158 - Average object size uncompressed: 2.08KiB - Average object size compressed: 748B - Blocks: 40 (~331.63KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - Pending / IO / Serde: 1 / 0 / 3 - Pending / IO / Serde: 0 / 0 / 4 - Pending / IO / Serde: 1 / 0 / 3 - Pending / IO / Serde: 3 / 0 / 1 - Pending / IO / Serde: 1 / 0 / 3 - Pending / IO / Serde: 2 / 0 / 2 - Pending / IO / Serde: 0 / 0 / 4 - Pending / IO / Serde: 0 / 0 / 4 - Pending / IO / Serde: 1 / 0 / 2 - - ================== - High compression: true - Concurrency: 4 - File size: 4156299 - Write time: 18.06s - - O. Stats: - Wall clock time: 18.06s - Total CPU time: 48.16s - User wait time: 17.15s - Serialization time: 645.89ms (1.34%) - Checksum calculation time: 279.87ms (0.58%) - Compression time: 47.17s (97.94%) - Total IO delay: 229.44ms - Concurrency overhead: 144.87ms - Uncompressed size: 18.44MiB (~2.08KiB per object) - Output size: 3.96MiB (~457B per object; compression = 21.5%) - IO speed: 17.31MiB/s - Concurrency adjusted uncompressed speed: 1.51MiB/s - Actual uncompressed speed: 1.02MiB/s - Actual speed: 224.73KiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 457B - Blocks: 62 (~65.47KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - - I. Stats 1: - Wall clock time: 703.91ms - Total CPU time: 969.8ms - Serialization time: 347.14ms (35.8%) - Checksum calculation time: 249.37ms (25.71%) - Compression time: 361.55ms (37.28%) - Total IO delay: 220.86ms - Input size: 3.96MiB - Decompressed size: 18.44MiB (compression = 21.5%) - IO speed: 18.02MiB/s - Concurrency adjusted uncompressed speed: 62.08MiB/s - Actual uncompressed speed: 26.23MiB/s - Actual speed: 5.64MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 457B - Blocks: 62 (~65.47KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - Pending / IO / Serde: 0 / 0 / 0 - - I. Stats 2: - Wall clock time: 1.73s - Total CPU time: 2.11s - Serialization time: 735.24ms (34.85%) - Checksum calculation time: 532.6ms (25.24%) - Compression time: 818.2ms (38.78%) - Total IO delay: 449.48ms - Input size: 7.93MiB - Decompressed size: 36.87MiB (compression = 21.5%) - IO speed: 17.66MiB/s - Concurrency adjusted uncompressed speed: 57.71MiB/s - Actual uncompressed speed: 21.3MiB/s - Actual speed: 4.58MiB/s - Objects: 18158 - Average object size uncompressed: 2.08KiB - Average object size compressed: 457B - Blocks: 124 (~65.47KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - Pending / IO / Serde: 2 / 0 / 2 - Pending / IO / Serde: 2 / 0 / 2 - Pending / IO / Serde: 3 / 0 / 1 - Pending / IO / Serde: 2 / 0 / 2 - Pending / IO / Serde: 2 / 0 / 2 - Pending / IO / Serde: 2 / 0 / 2 - Pending / IO / Serde: 2 / 0 / 2 - Pending / IO / Serde: 3 / 0 / 1 - Pending / IO / Serde: 3 / 0 / 1 - Pending / IO / Serde: 3 / 0 / 1 - Pending / IO / Serde: 3 / 0 / 1 - - ================== - High compression: true - Concurrency: 4 - File size: 4098671 - Write time: 23.46s - - O. Stats: - Wall clock time: 23.47s - Total CPU time: 39.1s - User wait time: 22.05s - Serialization time: 383.58ms (0.98%) - Checksum calculation time: 206.99ms (0.53%) - Compression time: 38.47s (98.39%) - Total IO delay: 93.93ms - Concurrency overhead: 14.4ms - Uncompressed size: 18.44MiB (~2.08KiB per object) - Output size: 3.91MiB (~451B per object; compression = 21.2%) - IO speed: 42.03MiB/s - Concurrency adjusted uncompressed speed: 1.88MiB/s - Actual uncompressed speed: 804.41KiB/s - Actual speed: 170.54KiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 451B - Blocks: 20 (~200.13KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - Pending / IO / Serde: 0 / 0 / 0 - - I. Stats 1: - Wall clock time: 608.82ms - Total CPU time: 622.15ms - Serialization time: 173.74ms (27.93%) - Checksum calculation time: 153.3ms (24.64%) - Compression time: 293.74ms (47.21%) - Total IO delay: 42.16ms - Input size: 3.91MiB - Decompressed size: 18.44MiB (compression = 21.2%) - IO speed: 93.07MiB/s - Concurrency adjusted uncompressed speed: 111.07MiB/s - Actual uncompressed speed: 30.32MiB/s - Actual speed: 6.43MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 451B - Blocks: 20 (~200.13KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - - I. Stats 2: - Wall clock time: 1.29s - Total CPU time: 1.24s - Serialization time: 341.17ms (27.52%) - Checksum calculation time: 301.87ms (24.35%) - Compression time: 593.66ms (47.89%) - Total IO delay: 88.33ms - Input size: 7.82MiB - Decompressed size: 36.87MiB (compression = 21.2%) - IO speed: 88.84MiB/s - Concurrency adjusted uncompressed speed: 111.07MiB/s - Actual uncompressed speed: 28.54MiB/s - Actual speed: 6.05MiB/s - Objects: 18158 - Average object size uncompressed: 2.08KiB - Average object size compressed: 451B - Blocks: 40 (~200.13KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - Pending / IO / Serde: 0 / 0 / 1 - Pending / IO / Serde: 0 / 0 / 1 - Pending / IO / Serde: 0 / 0 / 1 - Pending / IO / Serde: 0 / 0 / 1 - Pending / IO / Serde: 0 / 0 / 1 - Pending / IO / Serde: 0 / 0 / 1 - Pending / IO / Serde: 0 / 0 / 1 - Pending / IO / Serde: 0 / 0 / 1 - Pending / IO / Serde: 0 / 0 / 1 - Pending / IO / Serde: 0 / 0 / 1 - Pending / IO / Serde: 0 / 0 / 1 - Pending / IO / Serde: 0 / 0 / 1 - - ================== - High compression: true - Concurrency: 1 - File size: 4156299 - Write time: 23.97s - - O. Stats: - Wall clock time: 23.97s - Total CPU time: 23.77s - User wait time: 23.89s - Serialization time: 260.83ms (1.1%) - Checksum calculation time: 144.97ms (0.61%) - Compression time: 23.34s (98.22%) - Total IO delay: 104.16ms - Concurrency overhead: 14.41ms - Uncompressed size: 18.44MiB (~2.08KiB per object) - Output size: 3.96MiB (~457B per object; compression = 21.5%) - IO speed: 38.11MiB/s - Concurrency adjusted uncompressed speed: 790.46KiB/s - Actual uncompressed speed: 787.63KiB/s - Actual speed: 169.33KiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 457B - Blocks: 62 (~65.47KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - Checksum ok! - - I. Stats 1: - Wall clock time: 530.61ms - Total CPU time: 663.27ms - Serialization time: 206.34ms (31.11%) - Checksum calculation time: 157.86ms (23.8%) - Compression time: 293.5ms (44.25%) - Total IO delay: 65.77ms - Input size: 3.96MiB - Decompressed size: 18.44MiB (compression = 21.5%) - IO speed: 60.98MiB/s - Concurrency adjusted uncompressed speed: 25.29MiB/s - Actual uncompressed speed: 34.79MiB/s - Actual speed: 7.48MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 457B - Blocks: 62 (~65.47KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - - I. Stats 2: - Wall clock time: 1.16s - Total CPU time: 1.33s - Serialization time: 417.85ms (31.45%) - Checksum calculation time: 313.37ms (23.59%) - Compression time: 581.45ms (43.77%) - Total IO delay: 145.35ms - Input size: 7.93MiB - Decompressed size: 36.87MiB (compression = 21.5%) - IO speed: 54.67MiB/s - Concurrency adjusted uncompressed speed: 25.03MiB/s - Actual uncompressed speed: 31.9MiB/s - Actual speed: 6.86MiB/s - Objects: 18158 - Average object size uncompressed: 2.08KiB - Average object size compressed: 457B - Blocks: 124 (~65.47KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - Pending / IO / Serde: 0 / 0 / 1 - Pending / IO / Serde: 0 / 0 / 1 - Pending / IO / Serde: 0 / 0 / 1 - Pending / IO / Serde: 0 / 0 / 1 - Pending / IO / Serde: 0 / 0 / 1 - Pending / IO / Serde: 0 / 0 / 1 - Pending / IO / Serde: 0 / 0 / 1 - Pending / IO / Serde: 0 / 0 / 1 - Pending / IO / Serde: 0 / 0 / 1 - Pending / IO / Serde: 0 / 0 / 1 - Pending / IO / Serde: 0 / 0 / 1 - Pending / IO / Serde: 0 / 0 / 1 - - ================== - High compression: true - Concurrency: 1 - File size: 4098671 - Write time: 24.11s - - O. Stats: - Wall clock time: 24.12s - Total CPU time: 23.97s - User wait time: 24.04s - Serialization time: 248.88ms (1.04%) - Checksum calculation time: 125.78ms (0.52%) - Compression time: 23.58s (98.36%) - Total IO delay: 66.52ms - Concurrency overhead: 4.22ms - Uncompressed size: 18.44MiB (~2.08KiB per object) - Output size: 3.91MiB (~451B per object; compression = 21.2%) - IO speed: 59.22MiB/s - Concurrency adjusted uncompressed speed: 785.23KiB/s - Actual uncompressed speed: 782.79KiB/s - Actual speed: 165.96KiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 451B - Blocks: 20 (~200.13KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - Checksum ok! - - I. Stats 1: - Wall clock time: 536.75ms - Total CPU time: 587.62ms - Serialization time: 152.76ms (26%) - Checksum calculation time: 147.2ms (25.05%) - Compression time: 286ms (48.67%) - Total IO delay: 36.05ms - Input size: 3.91MiB - Decompressed size: 18.44MiB (compression = 21.2%) - IO speed: 108.58MiB/s - Concurrency adjusted uncompressed speed: 29.59MiB/s - Actual uncompressed speed: 34.4MiB/s - Actual speed: 7.29MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 451B - Blocks: 20 (~200.13KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - - I. Stats 2: - Wall clock time: 1.18s - Total CPU time: 1.2s - Serialization time: 313.26ms (26.01%) - Checksum calculation time: 303.18ms (25.17%) - Compression time: 584.55ms (48.54%) - Total IO delay: 76.32ms - Input size: 7.82MiB - Decompressed size: 36.87MiB (compression = 21.2%) - IO speed: 102.86MiB/s - Concurrency adjusted uncompressed speed: 28.81MiB/s - Actual uncompressed speed: 31.17MiB/s - Actual speed: 6.61MiB/s - Objects: 18158 - Average object size uncompressed: 2.08KiB - Average object size compressed: 451B - Blocks: 40 (~200.13KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - -com.milaboratory.primitivio.blocks.PrimitivOBlocksTest > bigBlocks STANDARD_OUT - Pending / IO / Serde / Objs: 0 / 0 / 1 / 0 - Pending / IO / Serde / Objs: 0 / 1 / 1 / 1000 - Pending / IO / Serde / Objs: 0 / 1 / 1 / 2000 - Pending / IO / Serde / Objs: 1 / 1 / 0 / 4000 - Pending / IO / Serde / Objs: 0 / 1 / 1 / 5000 - Pending / IO / Serde / Objs: 0 / 0 / 1 / 6000 - Pending / IO / Serde / Objs: 0 / 1 / 1 / 8000 - Pending / IO / Serde / Objs: 0 / 1 / 1 / 9000 - Pending / IO / Serde / Objs: 0 / 0 / 1 / 10000 - Pending / IO / Serde / Objs: 0 / 0 / 1 / 11000 - Pending / IO / Serde / Objs: 0 / 1 / 1 / 13000 - Pending / IO / Serde / Objs: 0 / 0 / 1 / 14000 - Pending / IO / Serde / Objs: 0 / 1 / 1 / 15000 - Pending / IO / Serde / Objs: 0 / 0 / 1 / 16000 - Pending / IO / Serde / Objs: 0 / 0 / 1 / 17000 - Pending / IO / Serde / Objs: 0 / 0 / 1 / 18000 - Pending / IO / Serde / Objs: 1 / 0 / 1 / 19000 - O. Stats: - Wall clock time: 35.21s - Total CPU time: 27.37s - User wait time: 558.54us - Serialization time: 4.75s (17.34%) - Checksum calculation time: 14.55s (53.15%) - Compression time: 3.5s (12.78%) - Total IO delay: 21.61s - Concurrency overhead: 19.56ms - Uncompressed size: 1.86GiB (~97.66KiB per object) - Output size: 1.86GiB (~97.66KiB per object; compression = 100%) - IO speed: 88.27MiB/s - Concurrency adjusted uncompressed speed: 310.56MiB/s - Actual uncompressed speed: 54.18MiB/s - Actual speed: 54.18MiB/s - Objects: 20000 - Average object size uncompressed: 97.66KiB - Average object size compressed: 97.66KiB - Blocks: 20 (~95.37MiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - -com.milaboratory.util.IntCombinationsTest > test1 STANDARD_OUT - [0, 1] - [0, 2] - [1, 2] - -com.milaboratory.util.RemoveActionTest > test1 STANDARD_OUT - /tmp/milib_57df84f9852ce8d7738016aec3d58fb04b3e20da3204330060324933045 - -com.milaboratory.util.RemoveActionTest > test2 STANDARD_OUT - /tmp/milib_edd7a3dfb1745a2959c8b58d06aa28bee05262aa3696775241197821344.tmp - -com.milaboratory.util.VersionInfoTest > test3 SKIPPED - -com.milaboratory.util.ByteStringTest > testSpeed1 STANDARD_OUT - Time per hash: 1.22us - Addition to hash set (per operation): 3.28us - Hash set removal (per operation): 1.79us - b - -com.milaboratory.util.sorting.HashSorterTest > testSingleton STANDARD_OUT - /tmp/milib_37dc4afa1aaa7bdebe0c9dc469030455cf21f280191412631343915194 - timeInCollate: 43.59s - timeInCollatorInit: 30.73s - timeAwaitingO: 12ms - timeAwaitingI: 5.23s - timeInFinalSorting1: 0ns - timeInFinalSorting2: 125.2ms - timeInFinalSorting3: 493.32ms - /2S (5|27|32): objs=50000 size=3.19MiB - -com.milaboratory.util.sorting.HashSorterTest > test1 STANDARD_OUT - /tmp/milib_8bec0268d50e8ce28174ef31ccc3b192783bd44c18018545032853239805 - timeInCollate: 1.71m - timeInCollatorInit: 5.17s - timeAwaitingO: 5.72s - timeAwaitingI: 23.8s - timeInFinalSorting1: 17.19s - timeInFinalSorting2: 13.96s - timeInFinalSorting3: 5.42s - /0N (5|27|32): objs=158058 size=9.01MiB - /1N (5|27|32): objs=156232 size=8.71MiB - /2N (5|27|32): objs=155067 size=9.1MiB - /3N (5|27|32): objs=150140 size=8.02MiB - /4N (5|27|32): objs=153080 size=8.45MiB - /5N (5|27|32): objs=163008 size=9.36MiB - /6N (5|27|32): objs=153357 size=8.45MiB - /7N (5|27|32): objs=158403 size=8.95MiB - /8N (5|27|32): objs=156553 size=8.85MiB - /9N (5|27|32): objs=153207 size=8.68MiB - /10N (5|27|32): objs=153978 size=8.62MiB - /11N (5|27|32): objs=157249 size=8.89MiB - /12N (5|27|32): objs=159224 size=8.96MiB - /13N (5|27|32): objs=145947 size=8.17MiB - /14N (5|27|32): objs=156943 size=8.73MiB - /15N (5|27|32): objs=155990 size=8.86MiB - /16N (5|27|32): objs=158455 size=8.95MiB - /17N (5|27|32): objs=159771 size=8.96MiB - /18N (5|27|32): objs=166828 size=9.48MiB - /19N (5|27|32): objs=160002 size=8.79MiB - /20N (5|27|32): objs=161075 size=9.14MiB - /21N (5|27|32): objs=150001 size=8.29MiB - /22N (5|27|32): objs=159313 size=8.77MiB - /23N (5|27|32): objs=159191 size=8.91MiB - /24N (5|27|32): objs=149906 size=8.37MiB - /25N (5|27|32): objs=160684 size=9.11MiB - /26N (5|27|32): objs=161869 size=9.18MiB - /27N (5|27|32): objs=151661 size=8.52MiB - /28N (5|27|32): objs=150018 size=8.29MiB - /29N (5|27|32): objs=148303 size=8.16MiB - /30N (5|27|32): objs=155210 size=8.8MiB - /31N (5|27|32): objs=161277 size=9.32MiB - /0/0N (2|25|36): objs=39853 size=942.7KiB - /0/1N (2|25|36): objs=42100 size=1.02MiB - /0/2N (2|25|36): objs=27599 size=404.9KiB - /0/3S (2|25|36): objs=160 size=127B - /0/4N (2|25|36): objs=2612 size=10.76KiB - /0/5S (2|25|36): objs=141 size=231B - /0/6N (2|25|36): objs=1506 size=6.13KiB - /0/7S (2|25|36): objs=152 size=210B - /0/9S (2|25|36): objs=129 size=293B - /0/10N (2|25|36): objs=2328 size=10.16KiB - /0/11N (2|25|36): objs=8964 size=48.78KiB - /0/12S (2|25|36): objs=142 size=104B - /0/13N (2|25|36): objs=3831 size=16.73KiB - /0/14S (2|25|36): objs=158 size=155B - /0/15N (2|25|36): objs=2224 size=9.39KiB - /0/16S (2|25|36): objs=154 size=115B - /0/18S (2|25|36): objs=159 size=121B - /0/19N (2|25|36): objs=4287 size=19.7KiB - /0/20S (2|25|36): objs=136 size=184B - /0/21N (2|25|36): objs=1709 size=6.96KiB - /0/22S (2|25|36): objs=169 size=225B - /0/23N (2|25|36): objs=312 size=842B - /0/24S (2|25|36): objs=176 size=274B - /0/25N (2|25|36): objs=5939 size=26.04KiB - /0/26S (2|25|36): objs=138 size=106B - /0/27N (2|25|36): objs=3227 size=13.69KiB - /0/28S (2|25|36): objs=150 size=324B - /0/29N (2|25|36): objs=1878 size=7.61KiB - /0/30S (2|25|36): objs=169 size=130B - /0/31N (2|25|36): objs=5198 size=24.17KiB - /0/32S (2|25|36): objs=158 size=126B - /0/33N (2|25|36): objs=1085 size=4.12KiB - /0/34S (2|25|36): objs=166 size=94B - /0/35N (2|25|36): objs=949 size=3.61KiB - /1/0N (2|25|36): objs=39501 size=842.6KiB - /1/1N (2|25|36): objs=37629 size=752.03KiB - /1/2N (2|25|36): objs=40807 size=1.01MiB - /1/3N (2|25|36): objs=11701 size=65.76KiB - /1/4S (2|25|36): objs=169 size=105B - /1/5N (2|25|36): objs=1631 size=6.51KiB - /1/6S (2|25|36): objs=144 size=326B - /1/7N (2|25|36): objs=1851 size=7.51KiB - /1/8S (2|25|36): objs=150 size=302B - /1/9N (2|25|36): objs=1051 size=4.06KiB - /1/10S (2|25|36): objs=151 size=269B - /1/11N (2|25|36): objs=1878 size=7.71KiB - /1/12S (2|25|36): objs=157 size=300B - /1/13N (2|25|36): objs=1968 size=8.27KiB - /1/14S (2|25|36): objs=168 size=164B - /1/15N (2|25|36): objs=558 size=2.04KiB - /1/16S (2|25|36): objs=129 size=146B - /1/17N (2|25|36): objs=626 size=2.28KiB - /1/18S (2|25|36): objs=147 size=300B - /1/20S (2|25|36): objs=128 size=316B - /1/21N (2|25|36): objs=6203 size=27.76KiB - /1/22S (2|25|36): objs=148 size=267B - /1/23N (2|25|36): objs=942 size=3.64KiB - /1/24S (2|25|36): objs=151 size=91B - /1/25S (2|25|36): objs=131 size=235B - /1/26S (2|25|36): objs=133 size=300B - /1/27S (2|25|36): objs=154 size=260B - /1/28S (2|25|36): objs=152 size=278B - /1/29N (2|25|36): objs=918 size=3.69KiB - /1/30S (2|25|36): objs=153 size=123B - /1/31N (2|25|36): objs=3163 size=13.58KiB - /1/32S (2|25|36): objs=166 size=311B - /1/33N (2|25|36): objs=2207 size=9.12KiB - /1/34S (2|25|36): objs=136 size=314B - /1/35N (2|25|36): objs=931 size=3.54KiB - /2/0N (2|25|36): objs=36095 size=762.63KiB - /2/1N (2|25|36): objs=43379 size=1.07MiB - /2/2N (2|25|36): objs=35857 size=728.27KiB - /2/3N (2|25|36): objs=12704 size=99.09KiB - /2/4S (2|25|36): objs=159 size=141B - /2/5N (2|25|36): objs=5481 size=30.27KiB - /2/6S (2|25|36): objs=162 size=263B - /2/7N (2|25|36): objs=339 size=1.03KiB - /2/8S (2|25|36): objs=157 size=88B - /2/9N (2|25|36): objs=1170 size=4.87KiB - /2/10S (2|25|36): objs=136 size=213B - /2/12S (2|25|36): objs=122 size=273B - /2/13S (2|25|36): objs=153 size=136B - /2/14S (2|25|36): objs=140 size=128B - /2/15N (2|25|36): objs=1828 size=7.76KiB - /2/16S (2|25|36): objs=130 size=237B - /2/17N (2|25|36): objs=2680 size=11.2KiB - /2/18S (2|25|36): objs=137 size=320B - /2/19N (2|25|36): objs=473 size=1.57KiB - /2/20S (2|25|36): objs=142 size=141B - /2/21N (2|25|36): objs=2408 size=10.43KiB - /2/22S (2|25|36): objs=176 size=236B - /2/23N (2|25|36): objs=460 size=1.54KiB - /2/24S (2|25|36): objs=150 size=177B - /2/25S (2|25|36): objs=141 size=95B - /2/26S (2|25|36): objs=149 size=95B - /2/27N (2|25|36): objs=2158 size=8.99KiB - /2/28S (2|25|36): objs=138 size=108B - /2/29N (2|25|36): objs=3151 size=15.76KiB - /2/30S (2|25|36): objs=142 size=182B - /2/31N (2|25|36): objs=818 size=3.09KiB - /2/32S (2|25|36): objs=167 size=114B - /2/33N (2|25|36): objs=1070 size=4.19KiB - /2/34S (2|25|36): objs=143 size=259B - /2/35N (2|25|36): objs=2352 size=10.01KiB - /3/0N (2|25|36): objs=39606 size=877.59KiB - /3/1N (2|25|36): objs=36279 size=567.26KiB - /3/2N (2|25|36): objs=37394 size=664.31KiB - /3/3S (2|25|36): objs=164 size=146B - /3/4S (2|25|36): objs=163 size=141B - /3/5N (2|25|36): objs=1978 size=8.09KiB - /3/6S (2|25|36): objs=130 size=140B - /3/7N (2|25|36): objs=783 size=3.09KiB - /3/8S (2|25|36): objs=166 size=186B - /3/9N (2|25|36): objs=2289 size=9.68KiB - /3/10S (2|25|36): objs=142 size=118B - /3/11N (2|25|36): objs=8707 size=41.96KiB - /3/12S (2|25|36): objs=156 size=232B - /3/13N (2|25|36): objs=675 size=2.46KiB - /3/14S (2|25|36): objs=157 size=106B - /3/15N (2|25|36): objs=1042 size=3.99KiB - /3/16S (2|25|36): objs=145 size=303B - /3/17N (2|25|36): objs=635 size=2.31KiB - /3/18S (2|25|36): objs=148 size=208B - /3/19N (2|25|36): objs=2367 size=10.48KiB - /3/20S (2|25|36): objs=149 size=234B - /3/21N (2|25|36): objs=757 size=2.9KiB - /3/22S (2|25|36): objs=156 size=304B - /3/23N (2|25|36): objs=305 size=956B - /3/24S (2|25|36): objs=146 size=298B - /3/25N (2|25|36): objs=1446 size=5.98KiB - /3/26S (2|25|36): objs=155 size=87B - /3/27N (2|25|36): objs=1400 size=5.6KiB - /3/28S (2|25|36): objs=153 size=309B - /3/29N (2|25|36): objs=3885 size=17.53KiB - /3/30S (2|25|36): objs=162 size=148B - /3/31N (2|25|36): objs=1818 size=7.78KiB - /3/32S (2|25|36): objs=135 size=92B - /3/33N (2|25|36): objs=601 size=2.17KiB - /3/34S (2|25|36): objs=147 size=317B - /3/35N (2|25|36): objs=5599 size=27.12KiB - /4/0N (2|25|36): objs=38566 size=737.91KiB - /4/1N (2|25|36): objs=33987 size=559.09KiB - /4/2N (2|25|36): objs=37297 size=812.78KiB - /4/3S (2|25|36): objs=159 size=330B - /4/4N (2|25|36): objs=1186 size=4.85KiB - /4/5N (2|25|36): objs=4950 size=21.69KiB - /4/6S (2|25|36): objs=163 size=151B - /4/7N (2|25|36): objs=3843 size=18.22KiB - /4/8S (2|25|36): objs=133 size=164B - /4/9S (2|25|36): objs=165 size=181B - /4/10S (2|25|36): objs=177 size=256B - /4/11N (2|25|36): objs=763 size=2.88KiB - /4/12S (2|25|36): objs=158 size=169B - /4/13N (2|25|36): objs=3076 size=14.37KiB - /4/14S (2|25|36): objs=177 size=223B - /4/15N (2|25|36): objs=3486 size=15.33KiB - /4/16S (2|25|36): objs=158 size=306B - /4/17N (2|25|36): objs=4763 size=22.6KiB - /4/18S (2|25|36): objs=155 size=280B - /4/19N (2|25|36): objs=2019 size=8.23KiB - /4/20S (2|25|36): objs=142 size=143B - /4/22S (2|25|36): objs=145 size=216B - /4/23N (2|25|36): objs=5426 size=24.87KiB - /4/24S (2|25|36): objs=151 size=214B - /4/25N (2|25|36): objs=2757 size=11.57KiB - /4/26S (2|25|36): objs=151 size=277B - /4/27S (2|25|36): objs=157 size=170B - /4/28S (2|25|36): objs=149 size=103B - /4/29N (2|25|36): objs=3506 size=15.14KiB - /4/30S (2|25|36): objs=154 size=148B - /4/31N (2|25|36): objs=1535 size=6.3KiB - /4/32S (2|25|36): objs=121 size=289B - /4/33S (2|25|36): objs=148 size=236B - /4/34S (2|25|36): objs=158 size=141B - /4/35N (2|25|36): objs=2999 size=13.14KiB - /5/0N (2|25|36): objs=38295 size=796.15KiB - /5/1N (2|25|36): objs=41094 size=981.9KiB - /5/2N (2|25|36): objs=38682 size=741.19KiB - /5/3S (2|25|36): objs=154 size=92B - /5/4N (2|25|36): objs=2718 size=12.34KiB - /5/5S (2|25|36): objs=166 size=330B - /5/6N (2|25|36): objs=300 size=842B - /5/7N (2|25|36): objs=1529 size=6.12KiB - /5/8S (2|25|36): objs=137 size=308B - /5/9N (2|25|36): objs=3542 size=16.15KiB - /5/10S (2|25|36): objs=144 size=263B - /5/12S (2|25|36): objs=149 size=337B - /5/13N (2|25|36): objs=5400 size=25.63KiB - /5/14S (2|25|36): objs=158 size=203B - /5/15S (2|25|36): objs=144 size=277B - /5/16S (2|25|36): objs=142 size=188B - /5/17N (2|25|36): objs=2852 size=12.36KiB - /5/18S (2|25|36): objs=136 size=138B - /5/19N (2|25|36): objs=477 size=1.58KiB - /5/20S (2|25|36): objs=159 size=298B - /5/21N (2|25|36): objs=747 size=2.93KiB - /5/22S (2|25|36): objs=136 size=160B - /5/23N (2|25|36): objs=4165 size=18.89KiB - /5/24S (2|25|36): objs=159 size=292B - /5/25N (2|25|36): objs=8133 size=40.64KiB - /5/26S (2|25|36): objs=160 size=272B - /5/27N (2|25|36): objs=6757 size=33.41KiB - /5/28S (2|25|36): objs=148 size=301B - /5/29N (2|25|36): objs=769 size=3.04KiB - /5/30S (2|25|36): objs=157 size=269B - /5/31N (2|25|36): objs=2006 size=8.23KiB - /5/32S (2|25|36): objs=155 size=317B - /5/33N (2|25|36): objs=654 size=2.42KiB - /5/34S (2|25|36): objs=152 size=231B - /5/35N (2|25|36): objs=2332 size=10.61KiB - /6/0N (2|25|36): objs=41012 size=850.03KiB - /6/1N (2|25|36): objs=36067 size=806.1KiB - /6/2N (2|25|36): objs=40409 size=944.96KiB - /6/3N (2|25|36): objs=15130 size=85.3KiB - /6/4S (2|25|36): objs=137 size=201B - /6/5N (2|25|36): objs=1193 size=4.61KiB - /6/6S (2|25|36): objs=149 size=184B - /6/7N (2|25|36): objs=1589 size=6.59KiB - /6/8S (2|25|36): objs=164 size=161B - /6/9N (2|25|36): objs=2138 size=8.81KiB - /6/10S (2|25|36): objs=161 size=187B - /6/11N (2|25|36): objs=1867 size=7.77KiB - /6/12S (2|25|36): objs=164 size=220B - /6/13N (2|25|36): objs=1317 size=5.35KiB - /6/14S (2|25|36): objs=149 size=220B - /6/15N (2|25|36): objs=1999 size=8.77KiB - /6/16S (2|25|36): objs=162 size=162B - /6/17N (2|25|36): objs=870 size=3.31KiB - /6/18S (2|25|36): objs=155 size=220B - /6/19N (2|25|36): objs=1107 size=4.41KiB - /6/20S (2|25|36): objs=161 size=306B - /6/22S (2|25|36): objs=161 size=216B - /6/24S (2|25|36): objs=153 size=306B - /6/25N (2|25|36): objs=2648 size=11.33KiB - /6/26S (2|25|36): objs=166 size=199B - /6/28S (2|25|36): objs=132 size=249B - /6/29N (2|25|36): objs=1045 size=4.17KiB - /6/30S (2|25|36): objs=153 size=136B - /6/31N (2|25|36): objs=775 size=2.95KiB - /6/32S (2|25|36): objs=150 size=231B - /6/33N (2|25|36): objs=460 size=1.76KiB - /6/34S (2|25|36): objs=154 size=316B - /6/35N (2|25|36): objs=1260 size=4.88KiB - /7/0N (2|25|36): objs=37015 size=790.76KiB - /7/1N (2|25|36): objs=38491 size=817.43KiB - /7/2N (2|25|36): objs=38559 size=867.18KiB - /7/3N (2|25|36): objs=10638 size=60.64KiB - /7/4S (2|25|36): objs=152 size=94B - /7/5N (2|25|36): objs=1055 size=4.27KiB - /7/6S (2|25|36): objs=144 size=123B - /7/7N (2|25|36): objs=3003 size=13.38KiB - /7/8S (2|25|36): objs=143 size=93B - /7/9N (2|25|36): objs=3097 size=14.21KiB - /7/10S (2|25|36): objs=150 size=311B - /7/11N (2|25|36): objs=1758 size=7.42KiB - /7/12S (2|25|36): objs=147 size=109B - /7/13N (2|25|36): objs=1511 size=6.48KiB - /7/14S (2|25|36): objs=150 size=303B - /7/16S (2|25|36): objs=138 size=309B - /7/17N (2|25|36): objs=1049 size=4.24KiB - /7/18S (2|25|36): objs=142 size=332B - /7/19S (2|25|36): objs=139 size=105B - /7/20S (2|25|36): objs=152 size=336B - /7/21N (2|25|36): objs=2582 size=11.2KiB - /7/22S (2|25|36): objs=149 size=324B - /7/23N (2|25|36): objs=2174 size=9.14KiB - /7/24S (2|25|36): objs=152 size=235B - /7/25N (2|25|36): objs=2567 size=11.07KiB - /7/26S (2|25|36): objs=135 size=281B - /7/27N (2|25|36): objs=1185 size=4.87KiB - /7/28S (2|25|36): objs=154 size=280B - /7/29N (2|25|36): objs=737 size=2.8KiB - /7/30S (2|25|36): objs=152 size=133B - /7/31N (2|25|36): objs=1358 size=5.38KiB - /7/32S (2|25|36): objs=156 size=117B - /7/33N (2|25|36): objs=4821 size=22.1KiB - /7/34S (2|25|36): objs=146 size=155B - /7/35N (2|25|36): objs=4302 size=18.52KiB - /8/0N (2|25|36): objs=41165 size=981.22KiB - /8/1N (2|25|36): objs=39510 size=949.12KiB - /8/2N (2|25|36): objs=37698 size=723.78KiB - /8/3S (2|25|36): objs=141 size=112B - /8/5N (2|25|36): objs=3159 size=14.7KiB - /8/6S (2|25|36): objs=153 size=319B - /8/7N (2|25|36): objs=3674 size=15.88KiB - /8/8S (2|25|36): objs=132 size=119B - /8/9N (2|25|36): objs=2127 size=8.97KiB - /8/10S (2|25|36): objs=152 size=180B - /8/11N (2|25|36): objs=572 size=2.16KiB - /8/12S (2|25|36): objs=180 size=344B - /8/13N (2|25|36): objs=2079 size=8.85KiB - /8/14S (2|25|36): objs=183 size=224B - /8/15N (2|25|36): objs=926 size=3.75KiB - /8/16S (2|25|36): objs=177 size=337B - /8/17N (2|25|36): objs=1096 size=4.39KiB - /8/18S (2|25|36): objs=168 size=142B - /8/19N (2|25|36): objs=2286 size=9.31KiB - /8/20S (2|25|36): objs=138 size=102B - /8/21S (2|25|36): objs=138 size=136B - /8/22S (2|25|36): objs=147 size=172B - /8/23N (2|25|36): objs=2506 size=10.88KiB - /8/24S (2|25|36): objs=153 size=195B - /8/25N (2|25|36): objs=773 size=3KiB - /8/26S (2|25|36): objs=151 size=211B - /8/27N (2|25|36): objs=6748 size=33.72KiB - /8/28S (2|25|36): objs=168 size=227B - /8/29S (2|25|36): objs=161 size=325B - /8/30S (2|25|36): objs=145 size=250B - /8/31N (2|25|36): objs=1248 size=5.02KiB - /8/32S (2|25|36): objs=169 size=182B - /8/34S (2|25|36): objs=182 size=328B - /8/35N (2|25|36): objs=8148 size=45.05KiB - /9/0N (2|25|36): objs=41714 size=999.42KiB - /9/1N (2|25|36): objs=38294 size=812.99KiB - /9/2N (2|25|36): objs=39204 size=904.57KiB - /9/3N (2|25|36): objs=8703 size=42.62KiB - /9/4S (2|25|36): objs=121 size=242B - /9/5S (2|25|36): objs=173 size=146B - /9/6S (2|25|36): objs=155 size=184B - /9/7N (2|25|36): objs=3874 size=17.54KiB - /9/8S (2|25|36): objs=153 size=102B - /9/9N (2|25|36): objs=305 size=804B - /9/10S (2|25|36): objs=158 size=304B - /9/11N (2|25|36): objs=918 size=3.44KiB - /9/12S (2|25|36): objs=160 size=206B - /9/13N (2|25|36): objs=1739 size=7.3KiB - /9/14S (2|25|36): objs=177 size=268B - /9/15N (2|25|36): objs=2863 size=12.91KiB - /9/16S (2|25|36): objs=147 size=136B - /9/17N (2|25|36): objs=2122 size=8.92KiB - /9/18S (2|25|36): objs=150 size=259B - /9/19N (2|25|36): objs=727 size=2.76KiB - /9/20S (2|25|36): objs=159 size=348B - /9/21N (2|25|36): objs=732 size=2.75KiB - /9/22S (2|25|36): objs=153 size=229B - /9/24S (2|25|36): objs=182 size=143B - /9/25N (2|25|36): objs=2195 size=9.04KiB - /9/26S (2|25|36): objs=162 size=347B - /9/27N (2|25|36): objs=1988 size=8.25KiB - /9/28S (2|25|36): objs=136 size=192B - /9/29N (2|25|36): objs=1282 size=5.03KiB - /9/30S (2|25|36): objs=135 size=146B - /9/31N (2|25|36): objs=3589 size=18.21KiB - /9/32S (2|25|36): objs=173 size=313B - /9/34S (2|25|36): objs=167 size=233B - /9/35N (2|25|36): objs=297 size=874B - /10/0N (2|25|36): objs=37239 size=765.37KiB - /10/1N (2|25|36): objs=41194 size=850.12KiB - /10/2N (2|25|36): objs=34801 size=728.72KiB - /10/3S (2|25|36): objs=144 size=96B - /10/4N (2|25|36): objs=496 size=1.55KiB - /10/5N (2|25|36): objs=464 size=1.69KiB - /10/6S (2|25|36): objs=152 size=274B - /10/7N (2|25|36): objs=6832 size=30.81KiB - /10/8S (2|25|36): objs=163 size=253B - /10/9N (2|25|36): objs=3019 size=12.52KiB - /10/10S (2|25|36): objs=135 size=162B - /10/11N (2|25|36): objs=1644 size=6.65KiB - /10/12S (2|25|36): objs=140 size=257B - /10/13N (2|25|36): objs=758 size=2.97KiB - /10/14S (2|25|36): objs=140 size=284B - /10/15N (2|25|36): objs=1952 size=8.36KiB - /10/16S (2|25|36): objs=151 size=163B - /10/17N (2|25|36): objs=4016 size=18.72KiB - /10/18S (2|25|36): objs=157 size=303B - /10/19N (2|25|36): objs=634 size=2.39KiB - /10/20S (2|25|36): objs=173 size=130B - /10/21N (2|25|36): objs=5073 size=22.99KiB - /10/22S (2|25|36): objs=153 size=115B - /10/23N (2|25|36): objs=3611 size=16.69KiB - /10/24S (2|25|36): objs=164 size=241B - /10/25N (2|25|36): objs=4466 size=21.48KiB - /10/26S (2|25|36): objs=150 size=147B - /10/27N (2|25|36): objs=1040 size=4.11KiB - /10/28S (2|25|36): objs=156 size=300B - /10/29N (2|25|36): objs=872 size=3.32KiB - /10/30S (2|25|36): objs=128 size=310B - /10/31N (2|25|36): objs=290 size=779B - /10/32S (2|25|36): objs=150 size=96B - /10/33N (2|25|36): objs=1945 size=8.54KiB - /10/34S (2|25|36): objs=152 size=250B - /10/35N (2|25|36): objs=1224 size=4.92KiB - /11/0N (2|25|36): objs=40444 size=947.27KiB - /11/1N (2|25|36): objs=35242 size=665.89KiB - /11/2N (2|25|36): objs=41837 size=962.84KiB - /11/3N (2|25|36): objs=3598 size=15.84KiB - /11/4S (2|25|36): objs=177 size=330B - /11/5N (2|25|36): objs=1174 size=4.77KiB - /11/6S (2|25|36): objs=153 size=252B - /11/7N (2|25|36): objs=1209 size=4.99KiB - /11/8S (2|25|36): objs=155 size=330B - /11/9N (2|25|36): objs=1087 size=4.41KiB - /11/10S (2|25|36): objs=163 size=215B - /11/11N (2|25|36): objs=2266 size=10.2KiB - /11/12S (2|25|36): objs=138 size=227B - /11/13N (2|25|36): objs=333 size=909B - /11/14S (2|25|36): objs=146 size=222B - /11/15S (2|25|36): objs=163 size=122B - /11/16S (2|25|36): objs=139 size=108B - /11/17N (2|25|36): objs=1927 size=7.98KiB - /11/18S (2|25|36): objs=155 size=233B - /11/19N (2|25|36): objs=6457 size=30.7KiB - /11/20S (2|25|36): objs=167 size=100B - /11/21N (2|25|36): objs=7544 size=39.65KiB - /11/22S (2|25|36): objs=150 size=275B - /11/23N (2|25|36): objs=4371 size=20.23KiB - /11/24S (2|25|36): objs=152 size=124B - /11/25N (2|25|36): objs=893 size=3.39KiB - /11/26S (2|25|36): objs=139 size=304B - /11/27N (2|25|36): objs=1198 size=4.91KiB - /11/28S (2|25|36): objs=154 size=307B - /11/29N (2|25|36): objs=892 size=3.35KiB - /11/30S (2|25|36): objs=146 size=162B - /11/31N (2|25|36): objs=1908 size=8.01KiB - /11/32S (2|25|36): objs=172 size=324B - /11/33N (2|25|36): objs=2257 size=9.48KiB - /11/34S (2|25|36): objs=143 size=94B - /12/0N (2|25|36): objs=37685 size=779.29KiB - /12/1N (2|25|36): objs=36668 size=634.32KiB - /12/2N (2|25|36): objs=25313 size=318.19KiB - /12/3S (2|25|36): objs=165 size=152B - /12/4N (2|25|36): objs=10382 size=60.02KiB - /12/5S (2|25|36): objs=154 size=331B - /12/7S (2|25|36): objs=158 size=298B - /12/8N (2|25|36): objs=1661 size=6.79KiB - /12/9S (2|25|36): objs=142 size=192B - /12/10N (2|25|36): objs=594 size=2.11KiB - /12/11N (2|25|36): objs=6428 size=33.47KiB - /12/12S (2|25|36): objs=163 size=195B - /12/13N (2|25|36): objs=2494 size=10.79KiB - /12/14S (2|25|36): objs=159 size=251B - /12/15N (2|25|36): objs=2409 size=11.03KiB - /12/16S (2|25|36): objs=171 size=346B - /12/17N (2|25|36): objs=2150 size=9.33KiB - /12/18S (2|25|36): objs=157 size=326B - /12/19N (2|25|36): objs=10213 size=56.86KiB - /12/20S (2|25|36): objs=152 size=120B - /12/21S (2|25|36): objs=140 size=219B - /12/22S (2|25|36): objs=144 size=308B - /12/23N (2|25|36): objs=1635 size=7.12KiB - /12/24S (2|25|36): objs=149 size=251B - /12/25N (2|25|36): objs=4554 size=19.85KiB - /12/26S (2|25|36): objs=141 size=83B - /12/27N (2|25|36): objs=1078 size=4.25KiB - /12/28S (2|25|36): objs=159 size=264B - /12/29N (2|25|36): objs=1359 size=5.52KiB - /12/30S (2|25|36): objs=141 size=253B - /12/31N (2|25|36): objs=4173 size=18.46KiB - /12/32S (2|25|36): objs=148 size=340B - /12/33N (2|25|36): objs=2582 size=10.81KiB - /12/34S (2|25|36): objs=163 size=339B - /12/35N (2|25|36): objs=5240 size=25.99KiB - /13/0N (2|25|36): objs=32927 size=663.77KiB - /13/1N (2|25|36): objs=36813 size=669.31KiB - /13/2N (2|25|36): objs=39506 size=900.82KiB - /13/3S (2|25|36): objs=174 size=142B - /13/4N (2|25|36): objs=1683 size=7.22KiB - /13/5N (2|25|36): objs=6668 size=31.12KiB - /13/6S (2|25|36): objs=147 size=241B - /13/7N (2|25|36): objs=1084 size=4.46KiB - /13/8S (2|25|36): objs=143 size=275B - /13/10S (2|25|36): objs=165 size=130B - /13/12S (2|25|36): objs=147 size=238B - /13/13N (2|25|36): objs=8123 size=39.42KiB - /13/14S (2|25|36): objs=160 size=298B - /13/16S (2|25|36): objs=151 size=315B - /13/17N (2|25|36): objs=4003 size=19.78KiB - /13/18S (2|25|36): objs=185 size=152B - /13/19N (2|25|36): objs=940 size=3.59KiB - /13/20S (2|25|36): objs=141 size=187B - /13/21N (2|25|36): objs=1574 size=6.19KiB - /13/22S (2|25|36): objs=177 size=179B - /13/23N (2|25|36): objs=3680 size=16.41KiB - /13/24S (2|25|36): objs=176 size=246B - /13/25N (2|25|36): objs=610 size=2.14KiB - /13/26S (2|25|36): objs=141 size=308B - /13/27S (2|25|36): objs=148 size=278B - /13/28S (2|25|36): objs=137 size=257B - /13/29N (2|25|36): objs=807 size=3.05KiB - /13/30S (2|25|36): objs=163 size=96B - /13/31N (2|25|36): objs=1240 size=5.22KiB - /13/32S (2|25|36): objs=156 size=181B - /13/33S (2|25|36): objs=185 size=295B - /13/34S (2|25|36): objs=153 size=336B - /13/35N (2|25|36): objs=3440 size=14.69KiB - /14/0N (2|25|36): objs=41248 size=1021.82KiB - /14/1N (2|25|36): objs=39639 size=795.44KiB - /14/2N (2|25|36): objs=38630 size=866.2KiB - /14/3N (2|25|36): objs=6164 size=32.45KiB - /14/4S (2|25|36): objs=171 size=260B - /14/5N (2|25|36): objs=310 size=768B - /14/6S (2|25|36): objs=162 size=139B - /14/7N (2|25|36): objs=1047 size=4.2KiB - /14/8S (2|25|36): objs=152 size=233B - /14/9N (2|25|36): objs=1247 size=5.09KiB - /14/10S (2|25|36): objs=151 size=219B - /14/11S (2|25|36): objs=169 size=124B - /14/12S (2|25|36): objs=135 size=204B - /14/13N (2|25|36): objs=1413 size=5.73KiB - /14/14S (2|25|36): objs=154 size=287B - /14/15N (2|25|36): objs=4560 size=20.12KiB - /14/16S (2|25|36): objs=147 size=223B - /14/18S (2|25|36): objs=171 size=178B - /14/19N (2|25|36): objs=3593 size=17.07KiB - /14/20S (2|25|36): objs=149 size=161B - /14/21N (2|25|36): objs=4484 size=22.06KiB - /14/22S (2|25|36): objs=168 size=164B - /14/23N (2|25|36): objs=5633 size=27.32KiB - /14/24S (2|25|36): objs=141 size=97B - /14/25N (2|25|36): objs=1678 size=6.85KiB - /14/26S (2|25|36): objs=139 size=156B - /14/27N (2|25|36): objs=2084 size=8.7KiB - /14/28S (2|25|36): objs=152 size=176B - /14/29N (2|25|36): objs=1241 size=4.83KiB - /14/30S (2|25|36): objs=124 size=198B - /14/31N (2|25|36): objs=1055 size=4.4KiB - /14/32S (2|25|36): objs=169 size=111B - /14/33N (2|25|36): objs=283 size=912B - /14/34S (2|25|36): objs=180 size=218B - /15/0N (2|25|36): objs=36535 size=698.68KiB - /15/1N (2|25|36): objs=39815 size=863.58KiB - /15/2N (2|25|36): objs=28084 size=395.49KiB - /15/3S (2|25|36): objs=172 size=260B - /15/4N (2|25|36): objs=14992 size=104.67KiB - /15/5N (2|25|36): objs=1395 size=5.67KiB - /15/6S (2|25|36): objs=157 size=327B - /15/7N (2|25|36): objs=617 size=2.19KiB - /15/8S (2|25|36): objs=142 size=218B - /15/9N (2|25|36): objs=3655 size=16.63KiB - /15/10S (2|25|36): objs=158 size=241B - /15/11N (2|25|36): objs=1243 size=4.87KiB - /15/12S (2|25|36): objs=177 size=156B - /15/13N (2|25|36): objs=2135 size=9.1KiB - /15/14S (2|25|36): objs=142 size=295B - /15/15S (2|25|36): objs=173 size=147B - /15/16S (2|25|36): objs=147 size=290B - /15/18S (2|25|36): objs=128 size=271B - /15/19S (2|25|36): objs=148 size=266B - /15/20S (2|25|36): objs=125 size=258B - /15/21N (2|25|36): objs=593 size=2.14KiB - /15/22S (2|25|36): objs=169 size=149B - /15/23N (2|25|36): objs=16222 size=112.03KiB - /15/24S (2|25|36): objs=151 size=156B - /15/25N (2|25|36): objs=508 size=1.76KiB - /15/26S (2|25|36): objs=138 size=149B - /15/27N (2|25|36): objs=1405 size=5.63KiB - /15/28S (2|25|36): objs=147 size=318B - /15/29N (2|25|36): objs=894 size=3.4KiB - /15/30S (2|25|36): objs=147 size=87B - /15/31N (2|25|36): objs=4278 size=19.2KiB - /15/32S (2|25|36): objs=149 size=91B - /15/33S (2|25|36): objs=149 size=332B - /15/34S (2|25|36): objs=135 size=323B - /15/35N (2|25|36): objs=765 size=2.97KiB - /16/0N (2|25|36): objs=39744 size=888.52KiB - /16/1N (2|25|36): objs=38880 size=911.54KiB - /16/2N (2|25|36): objs=36637 size=708.43KiB - /16/3S (2|25|36): objs=131 size=271B - /16/4N (2|25|36): objs=1374 size=5.52KiB - /16/5N (2|25|36): objs=15789 size=102.5KiB - /16/6S (2|25|36): objs=166 size=274B - /16/7N (2|25|36): objs=312 size=1.04KiB - /16/8S (2|25|36): objs=164 size=202B - /16/9N (2|25|36): objs=2708 size=11.36KiB - /16/10S (2|25|36): objs=159 size=342B - /16/11S (2|25|36): objs=151 size=292B - /16/12S (2|25|36): objs=130 size=150B - /16/13N (2|25|36): objs=744 size=2.76KiB - /16/14S (2|25|36): objs=171 size=114B - /16/15N (2|25|36): objs=319 size=963B - /16/16S (2|25|36): objs=167 size=91B - /16/17N (2|25|36): objs=6387 size=31.18KiB - /16/18S (2|25|36): objs=143 size=196B - /16/19S (2|25|36): objs=172 size=348B - /16/20S (2|25|36): objs=130 size=99B - /16/21N (2|25|36): objs=465 size=1.67KiB - /16/22S (2|25|36): objs=147 size=154B - /16/23N (2|25|36): objs=1243 size=4.78KiB - /16/24S (2|25|36): objs=169 size=251B - /16/25N (2|25|36): objs=1672 size=6.92KiB - /16/26S (2|25|36): objs=157 size=274B - /16/27N (2|25|36): objs=938 size=3.55KiB - /16/28S (2|25|36): objs=138 size=261B - /16/30S (2|25|36): objs=141 size=168B - /16/31N (2|25|36): objs=1529 size=6.38KiB - /16/32S (2|25|36): objs=138 size=304B - /16/33N (2|25|36): objs=2086 size=8.93KiB - /16/34S (2|25|36): objs=141 size=181B - /16/35N (2|25|36): objs=4913 size=22.14KiB - /17/0N (2|25|36): objs=40517 size=877.07KiB - /17/1N (2|25|36): objs=40230 size=928.89KiB - /17/2N (2|25|36): objs=39002 size=857.29KiB - /17/4S (2|25|36): objs=148 size=194B - /17/5N (2|25|36): objs=2988 size=12.7KiB - /17/6S (2|25|36): objs=159 size=103B - /17/7N (2|25|36): objs=1217 size=4.87KiB - /17/8S (2|25|36): objs=153 size=213B - /17/9N (2|25|36): objs=3403 size=14.49KiB - /17/10S (2|25|36): objs=170 size=87B - /17/11N (2|25|36): objs=8266 size=41.58KiB - /17/12S (2|25|36): objs=155 size=246B - /17/14S (2|25|36): objs=165 size=231B - /17/15N (2|25|36): objs=1407 size=5.61KiB - /17/16S (2|25|36): objs=139 size=199B - /17/17S (2|25|36): objs=164 size=206B - /17/18S (2|25|36): objs=159 size=309B - /17/19N (2|25|36): objs=1399 size=5.64KiB - /17/20S (2|25|36): objs=142 size=191B - /17/21N (2|25|36): objs=3664 size=16.05KiB - /17/22S (2|25|36): objs=137 size=239B - /17/23N (2|25|36): objs=1212 size=4.9KiB - /17/24S (2|25|36): objs=158 size=255B - /17/25N (2|25|36): objs=3739 size=15.81KiB - /17/26S (2|25|36): objs=168 size=171B - /17/27N (2|25|36): objs=3427 size=14.92KiB - /17/28S (2|25|36): objs=140 size=250B - /17/29N (2|25|36): objs=924 size=3.72KiB - /17/30S (2|25|36): objs=157 size=232B - /17/31N (2|25|36): objs=5120 size=23.36KiB - /17/32S (2|25|36): objs=157 size=183B - /17/33N (2|25|36): objs=469 size=1.62KiB - /17/34S (2|25|36): objs=159 size=192B - /17/35S (2|25|36): objs=157 size=347B - /18/0N (2|25|36): objs=38886 size=972.83KiB - /18/1N (2|25|36): objs=44522 size=1021.76KiB - /18/2N (2|25|36): objs=36326 size=662.89KiB - /18/3S (2|25|36): objs=131 size=85B - /18/4N (2|25|36): objs=3345 size=15.2KiB - /18/5S (2|25|36): objs=151 size=188B - /18/6N (2|25|36): objs=2484 size=10.63KiB - /18/7S (2|25|36): objs=163 size=247B - /18/8N (2|25|36): objs=468 size=1.73KiB - /18/9N (2|25|36): objs=1513 size=6.28KiB - /18/10S (2|25|36): objs=142 size=224B - /18/11N (2|25|36): objs=870 size=3.31KiB - /18/12S (2|25|36): objs=177 size=145B - /18/13N (2|25|36): objs=5072 size=24.82KiB - /18/14S (2|25|36): objs=155 size=295B - /18/15N (2|25|36): objs=3319 size=15.8KiB - /18/16S (2|25|36): objs=161 size=100B - /18/17N (2|25|36): objs=296 size=838B - /18/18S (2|25|36): objs=160 size=176B - /18/19N (2|25|36): objs=577 size=1.93KiB - /18/20S (2|25|36): objs=146 size=270B - /18/22S (2|25|36): objs=141 size=180B - /18/23N (2|25|36): objs=2721 size=11.96KiB - /18/24S (2|25|36): objs=132 size=197B - /18/25N (2|25|36): objs=3404 size=15.85KiB - /18/26S (2|25|36): objs=151 size=338B - /18/27N (2|25|36): objs=1210 size=4.61KiB - /18/28S (2|25|36): objs=133 size=201B - /18/29S (2|25|36): objs=169 size=300B - /18/30S (2|25|36): objs=167 size=315B - /18/31N (2|25|36): objs=3885 size=16.67KiB - /18/32S (2|25|36): objs=148 size=131B - /18/33N (2|25|36): objs=11343 size=63.33KiB - /18/34S (2|25|36): objs=156 size=233B - /18/35N (2|25|36): objs=4004 size=18.04KiB - /19/0N (2|25|36): objs=41671 size=960.96KiB - /19/1N (2|25|36): objs=42636 size=989.81KiB - /19/2N (2|25|36): objs=29913 size=398.74KiB - /19/3S (2|25|36): objs=140 size=89B - /19/4N (2|25|36): objs=4101 size=18.21KiB - /19/5S (2|25|36): objs=145 size=327B - /19/6N (2|25|36): objs=314 size=976B - /19/7S (2|25|36): objs=158 size=90B - /19/8N (2|25|36): objs=3179 size=15.39KiB - /19/10S (2|25|36): objs=155 size=281B - /19/11N (2|25|36): objs=445 size=1.47KiB - /19/12S (2|25|36): objs=149 size=128B - /19/13S (2|25|36): objs=151 size=143B - /19/14S (2|25|36): objs=153 size=313B - /19/15N (2|25|36): objs=5280 size=26.28KiB - /19/16S (2|25|36): objs=148 size=151B - /19/17N (2|25|36): objs=5771 size=28.29KiB - /19/18S (2|25|36): objs=150 size=150B - /19/19N (2|25|36): objs=1662 size=6.96KiB - /19/20S (2|25|36): objs=163 size=335B - /19/21N (2|25|36): objs=2923 size=12.15KiB - /19/22S (2|25|36): objs=167 size=351B - /19/23N (2|25|36): objs=3352 size=14.57KiB - /19/24S (2|25|36): objs=154 size=163B - /19/25N (2|25|36): objs=2644 size=11.07KiB - /19/26S (2|25|36): objs=155 size=289B - /19/27N (2|25|36): objs=3854 size=17.67KiB - /19/28S (2|25|36): objs=161 size=280B - /19/29N (2|25|36): objs=3988 size=18.49KiB - /19/30S (2|25|36): objs=165 size=167B - /19/31N (2|25|36): objs=1580 size=6.33KiB - /19/32S (2|25|36): objs=149 size=324B - /19/33N (2|25|36): objs=1827 size=7.71KiB - /19/34S (2|25|36): objs=162 size=200B - /19/35N (2|25|36): objs=2237 size=9.35KiB - /20/0N (2|25|36): objs=42356 size=988.63KiB - /20/1N (2|25|36): objs=38863 size=880.74KiB - /20/2N (2|25|36): objs=40498 size=875.91KiB - /20/3S (2|25|36): objs=154 size=302B - /20/4N (2|25|36): objs=1407 size=5.71KiB - /20/5N (2|25|36): objs=1371 size=5.62KiB - /20/6S (2|25|36): objs=139 size=119B - /20/7N (2|25|36): objs=1784 size=7.6KiB - /20/8S (2|25|36): objs=160 size=132B - /20/9N (2|25|36): objs=273 size=733B - /20/10S (2|25|36): objs=152 size=305B - /20/11N (2|25|36): objs=1218 size=5KiB - /20/12S (2|25|36): objs=134 size=171B - /20/13N (2|25|36): objs=1739 size=7.21KiB - /20/14S (2|25|36): objs=142 size=164B - /20/15N (2|25|36): objs=7174 size=35.83KiB - /20/16S (2|25|36): objs=157 size=143B - /20/17N (2|25|36): objs=803 size=2.82KiB - /20/18S (2|25|36): objs=139 size=198B - /20/19N (2|25|36): objs=2686 size=11.55KiB - /20/20S (2|25|36): objs=148 size=133B - /20/21N (2|25|36): objs=1554 size=6.27KiB - /20/22S (2|25|36): objs=152 size=194B - /20/23N (2|25|36): objs=4312 size=18.57KiB - /20/24S (2|25|36): objs=180 size=246B - /20/26S (2|25|36): objs=141 size=235B - /20/27N (2|25|36): objs=3555 size=16.18KiB - /20/28S (2|25|36): objs=149 size=109B - /20/29N (2|25|36): objs=1551 size=6.5KiB - /20/30S (2|25|36): objs=169 size=162B - /20/31N (2|25|36): objs=1788 size=7.12KiB - /20/32S (2|25|36): objs=161 size=157B - /20/33N (2|25|36): objs=888 size=3.39KiB - /20/34S (2|25|36): objs=142 size=137B - /20/35N (2|25|36): objs=4836 size=22.1KiB - /21/0N (2|25|36): objs=37192 size=748.69KiB - /21/1N (2|25|36): objs=26861 size=428.65KiB - /21/2S (2|25|36): objs=133 size=142B - /21/3N (2|25|36): objs=10987 size=65.2KiB - /21/4N (2|25|36): objs=35465 size=730.1KiB - /21/5N (2|25|36): objs=6389 size=31.77KiB - /21/6S (2|25|36): objs=147 size=287B - /21/7S (2|25|36): objs=146 size=273B - /21/8S (2|25|36): objs=157 size=291B - /21/9N (2|25|36): objs=1232 size=4.89KiB - /21/10S (2|25|36): objs=149 size=199B - /21/11N (2|25|36): objs=428 size=1.46KiB - /21/12S (2|25|36): objs=158 size=333B - /21/13N (2|25|36): objs=1045 size=4.29KiB - /21/14S (2|25|36): objs=152 size=118B - /21/15N (2|25|36): objs=296 size=1.03KiB - /21/16S (2|25|36): objs=144 size=197B - /21/17N (2|25|36): objs=1079 size=4.13KiB - /21/18S (2|25|36): objs=139 size=245B - /21/19N (2|25|36): objs=7010 size=35.07KiB - /21/20S (2|25|36): objs=143 size=285B - /21/21N (2|25|36): objs=1370 size=5.23KiB - /21/22S (2|25|36): objs=171 size=219B - /21/23N (2|25|36): objs=2401 size=9.76KiB - /21/24S (2|25|36): objs=149 size=264B - /21/26S (2|25|36): objs=157 size=343B - /21/27N (2|25|36): objs=598 size=2.24KiB - /21/28S (2|25|36): objs=135 size=116B - /21/29N (2|25|36): objs=296 size=682B - /21/30S (2|25|36): objs=142 size=282B - /21/31N (2|25|36): objs=7734 size=39KiB - /21/32S (2|25|36): objs=192 size=207B - /21/33N (2|25|36): objs=4604 size=20.39KiB - /21/34S (2|25|36): objs=153 size=89B - /21/35N (2|25|36): objs=2447 size=9.95KiB - /22/0N (2|25|36): objs=38493 size=802.38KiB - /22/1N (2|25|36): objs=40892 size=838.36KiB - /22/2N (2|25|36): objs=39952 size=815.13KiB - /22/3N (2|25|36): objs=20269 size=189.32KiB - /22/4S (2|25|36): objs=163 size=276B - /22/5N (2|25|36): objs=4462 size=20.08KiB - /22/6S (2|25|36): objs=139 size=96B - /22/7N (2|25|36): objs=2419 size=10.63KiB - /22/8S (2|25|36): objs=174 size=285B - /22/9S (2|25|36): objs=181 size=137B - /22/10S (2|25|36): objs=137 size=120B - /22/11N (2|25|36): objs=1480 size=5.89KiB - /22/12S (2|25|36): objs=146 size=227B - /22/13N (2|25|36): objs=1882 size=8.01KiB - /22/14S (2|25|36): objs=166 size=218B - /22/15N (2|25|36): objs=721 size=2.85KiB - /22/16S (2|25|36): objs=152 size=166B - /22/17N (2|25|36): objs=324 size=973B - /22/18S (2|25|36): objs=153 size=181B - /22/19S (2|25|36): objs=125 size=92B - /22/20S (2|25|36): objs=176 size=250B - /22/21N (2|25|36): objs=636 size=2.23KiB - /22/22S (2|25|36): objs=144 size=228B - /22/24S (2|25|36): objs=151 size=307B - /22/25S (2|25|36): objs=163 size=291B - /22/26S (2|25|36): objs=173 size=89B - /22/27N (2|25|36): objs=498 size=1.67KiB - /22/28S (2|25|36): objs=171 size=197B - /22/29N (2|25|36): objs=961 size=3.75KiB - /22/30S (2|25|36): objs=166 size=331B - /22/31N (2|25|36): objs=1988 size=8.6KiB - /22/32S (2|25|36): objs=165 size=119B - /22/33N (2|25|36): objs=888 size=3.63KiB - /22/34S (2|25|36): objs=158 size=183B - /22/35N (2|25|36): objs=445 size=1.5KiB - /23/0N (2|25|36): objs=37945 size=702.71KiB - /23/1N (2|25|36): objs=18139 size=130.25KiB - /23/2S (2|25|36): objs=155 size=107B - /23/3N (2|25|36): objs=21703 size=181.54KiB - /23/4N (2|25|36): objs=28489 size=477.68KiB - /23/5S (2|25|36): objs=155 size=340B - /23/6N (2|25|36): objs=12670 size=75.58KiB - /23/7N (2|25|36): objs=8739 size=49.74KiB - /23/8S (2|25|36): objs=151 size=221B - /23/9N (2|25|36): objs=588 size=2.22KiB - /23/10S (2|25|36): objs=160 size=328B - /23/11N (2|25|36): objs=440 size=1.66KiB - /23/12S (2|25|36): objs=151 size=203B - /23/13N (2|25|36): objs=1799 size=8.32KiB - /23/14S (2|25|36): objs=138 size=318B - /23/15N (2|25|36): objs=2173 size=8.92KiB - /23/16S (2|25|36): objs=174 size=243B - /23/17N (2|25|36): objs=3264 size=14.78KiB - /23/18S (2|25|36): objs=153 size=258B - /23/19N (2|25|36): objs=1610 size=6.67KiB - /23/20S (2|25|36): objs=155 size=199B - /23/21N (2|25|36): objs=3780 size=18.21KiB - /23/22S (2|25|36): objs=144 size=108B - /23/23N (2|25|36): objs=1270 size=5.34KiB - /23/24S (2|25|36): objs=149 size=273B - /23/25N (2|25|36): objs=456 size=1.66KiB - /23/26S (2|25|36): objs=151 size=207B - /23/27N (2|25|36): objs=2150 size=8.87KiB - /23/28S (2|25|36): objs=171 size=337B - /23/29N (2|25|36): objs=441 size=1.42KiB - /23/30S (2|25|36): objs=158 size=333B - /23/31N (2|25|36): objs=4344 size=18.89KiB - /23/32S (2|25|36): objs=145 size=92B - /23/33N (2|25|36): objs=2736 size=11.47KiB - /23/34S (2|25|36): objs=159 size=299B - /23/35N (2|25|36): objs=3986 size=18.32KiB - /24/0N (2|25|36): objs=37637 size=760.08KiB - /24/1N (2|25|36): objs=37515 size=785.15KiB - /24/2N (2|25|36): objs=29501 size=498.25KiB - /24/3S (2|25|36): objs=171 size=191B - /24/4N (2|25|36): objs=6011 size=28.25KiB - /24/6S (2|25|36): objs=158 size=222B - /24/7N (2|25|36): objs=1868 size=7.46KiB - /24/8S (2|25|36): objs=156 size=337B - /24/9N (2|25|36): objs=2644 size=11.42KiB - /24/10S (2|25|36): objs=160 size=342B - /24/11N (2|25|36): objs=3383 size=14.7KiB - /24/12S (2|25|36): objs=165 size=186B - /24/13N (2|25|36): objs=286 size=840B - /24/14S (2|25|36): objs=152 size=258B - /24/15N (2|25|36): objs=1241 size=4.94KiB - /24/16S (2|25|36): objs=158 size=229B - /24/17N (2|25|36): objs=5178 size=24.72KiB - /24/18S (2|25|36): objs=161 size=195B - /24/19N (2|25|36): objs=3525 size=15.31KiB - /24/20S (2|25|36): objs=138 size=103B - /24/21N (2|25|36): objs=1685 size=7.19KiB - /24/22S (2|25|36): objs=136 size=116B - /24/23N (2|25|36): objs=2538 size=10.7KiB - /24/24S (2|25|36): objs=151 size=197B - /24/25N (2|25|36): objs=2693 size=11.56KiB - /24/26S (2|25|36): objs=147 size=92B - /24/27N (2|25|36): objs=3257 size=14.04KiB - /24/28S (2|25|36): objs=169 size=263B - /24/30S (2|25|36): objs=156 size=316B - /24/31N (2|25|36): objs=3358 size=13.86KiB - /24/32S (2|25|36): objs=149 size=275B - /24/33N (2|25|36): objs=1802 size=7.72KiB - /24/34S (2|25|36): objs=148 size=199B - /24/35N (2|25|36): objs=3309 size=13.97KiB - /25/0N (2|25|36): objs=41726 size=989.23KiB - /25/1N (2|25|36): objs=40222 size=955.96KiB - /25/2N (2|25|36): objs=37693 size=725.3KiB - /25/3N (2|25|36): objs=22624 size=232.49KiB - /25/4S (2|25|36): objs=166 size=116B - /25/5N (2|25|36): objs=1293 size=5.52KiB - /25/6S (2|25|36): objs=175 size=325B - /25/7N (2|25|36): objs=909 size=3.59KiB - /25/8S (2|25|36): objs=143 size=203B - /25/9S (2|25|36): objs=152 size=206B - /25/10S (2|25|36): objs=155 size=253B - /25/11N (2|25|36): objs=4059 size=19.15KiB - /25/12S (2|25|36): objs=157 size=117B - /25/13N (2|25|36): objs=789 size=3.14KiB - /25/14S (2|25|36): objs=163 size=219B - /25/15N (2|25|36): objs=766 size=2.84KiB - /25/16S (2|25|36): objs=141 size=261B - /25/17N (2|25|36): objs=429 size=1.48KiB - /25/18S (2|25|36): objs=134 size=105B - /25/19S (2|25|36): objs=144 size=137B - /25/20S (2|25|36): objs=158 size=334B - /25/21S (2|25|36): objs=147 size=169B - /25/22S (2|25|36): objs=159 size=326B - /25/23N (2|25|36): objs=963 size=3.5KiB - /25/24S (2|25|36): objs=149 size=217B - /25/25N (2|25|36): objs=569 size=2.25KiB - /25/26S (2|25|36): objs=127 size=229B - /25/27N (2|25|36): objs=711 size=2.59KiB - /25/28S (2|25|36): objs=148 size=265B - /25/29N (2|25|36): objs=2736 size=11.47KiB - /25/30S (2|25|36): objs=176 size=133B - /25/31N (2|25|36): objs=611 size=2.31KiB - /25/32S (2|25|36): objs=156 size=100B - /25/33N (2|25|36): objs=480 size=1.62KiB - /25/34S (2|25|36): objs=121 size=83B - /25/35N (2|25|36): objs=1233 size=4.8KiB - /26/0N (2|25|36): objs=35674 size=680.53KiB - /26/1N (2|25|36): objs=2398 size=10.29KiB - /26/2S (2|25|36): objs=152 size=130B - /26/3N (2|25|36): objs=45133 size=1.03MiB - /26/4N (2|25|36): objs=33355 size=570.61KiB - /26/5S (2|25|36): objs=147 size=169B - /26/6N (2|25|36): objs=3032 size=13.01KiB - /26/7S (2|25|36): objs=166 size=249B - /26/9S (2|25|36): objs=159 size=228B - /26/10S (2|25|36): objs=155 size=293B - /26/11N (2|25|36): objs=2598 size=11.03KiB - /26/12S (2|25|36): objs=137 size=151B - /26/13N (2|25|36): objs=568 size=2.32KiB - /26/14S (2|25|36): objs=175 size=108B - /26/15N (2|25|36): objs=810 size=3.09KiB - /26/16S (2|25|36): objs=165 size=188B - /26/17N (2|25|36): objs=9038 size=49.65KiB - /26/18S (2|25|36): objs=171 size=307B - /26/19N (2|25|36): objs=5693 size=32.5KiB - /26/20S (2|25|36): objs=169 size=180B - /26/21N (2|25|36): objs=1853 size=7.73KiB - /26/22S (2|25|36): objs=152 size=257B - /26/23S (2|25|36): objs=162 size=127B - /26/24S (2|25|36): objs=159 size=171B - /26/25N (2|25|36): objs=4872 size=21.29KiB - /26/26S (2|25|36): objs=155 size=228B - /26/27N (2|25|36): objs=4844 size=21.99KiB - /26/28S (2|25|36): objs=159 size=191B - /26/29S (2|25|36): objs=149 size=293B - /26/30S (2|25|36): objs=148 size=87B - /26/31N (2|25|36): objs=1028 size=4.14KiB - /26/32S (2|25|36): objs=144 size=121B - /26/33N (2|25|36): objs=2047 size=8.53KiB - /26/34S (2|25|36): objs=127 size=133B - /26/35N (2|25|36): objs=5975 size=33.06KiB - /27/0N (2|25|36): objs=35807 size=710.08KiB - /27/1N (2|25|36): objs=38971 size=822.08KiB - /27/2N (2|25|36): objs=39936 size=851.85KiB - /27/3N (2|25|36): objs=8665 size=47.71KiB - /27/4S (2|25|36): objs=174 size=156B - /27/5N (2|25|36): objs=2912 size=12.65KiB - /27/6S (2|25|36): objs=146 size=257B - /27/7N (2|25|36): objs=2267 size=9.39KiB - /27/8S (2|25|36): objs=158 size=331B - /27/9N (2|25|36): objs=1581 size=6.24KiB - /27/10S (2|25|36): objs=173 size=335B - /27/11N (2|25|36): objs=1418 size=5.82KiB - /27/12S (2|25|36): objs=150 size=314B - /27/13N (2|25|36): objs=879 size=3.35KiB - /27/14S (2|25|36): objs=152 size=226B - /27/15N (2|25|36): objs=642 size=2.25KiB - /27/16S (2|25|36): objs=151 size=274B - /27/18S (2|25|36): objs=146 size=287B - /27/19N (2|25|36): objs=1687 size=7.04KiB - /27/20S (2|25|36): objs=186 size=127B - /27/21N (2|25|36): objs=1836 size=7.75KiB - /27/22S (2|25|36): objs=137 size=247B - /27/23N (2|25|36): objs=1706 size=6.98KiB - /27/24S (2|25|36): objs=167 size=219B - /27/25N (2|25|36): objs=5367 size=27.42KiB - /27/26S (2|25|36): objs=165 size=227B - /27/27N (2|25|36): objs=1218 size=4.79KiB - /27/28S (2|25|36): objs=183 size=213B - /27/29N (2|25|36): objs=1836 size=7.57KiB - /27/30S (2|25|36): objs=165 size=299B - /27/31N (2|25|36): objs=1895 size=8.15KiB - /27/32S (2|25|36): objs=184 size=101B - /27/33N (2|25|36): objs=459 size=1.44KiB - /27/34S (2|25|36): objs=142 size=169B - /28/0N (2|25|36): objs=38498 size=776.56KiB - /28/1N (2|25|36): objs=37219 size=711.29KiB - /28/2N (2|25|36): objs=34308 size=630.56KiB - /28/3S (2|25|36): objs=158 size=314B - /28/4N (2|25|36): objs=469 size=1.51KiB - /28/5S (2|25|36): objs=148 size=109B - /28/6S (2|25|36): objs=153 size=159B - /28/7N (2|25|36): objs=598 size=2.42KiB - /28/8S (2|25|36): objs=147 size=108B - /28/9N (2|25|36): objs=784 size=2.93KiB - /28/10S (2|25|36): objs=140 size=99B - /28/11N (2|25|36): objs=3274 size=14.88KiB - /28/12S (2|25|36): objs=179 size=300B - /28/13N (2|25|36): objs=2255 size=9.47KiB - /28/14S (2|25|36): objs=138 size=254B - /28/15N (2|25|36): objs=3105 size=13.11KiB - /28/16S (2|25|36): objs=163 size=264B - /28/17N (2|25|36): objs=14811 size=90.37KiB - /28/18S (2|25|36): objs=149 size=155B - /28/19N (2|25|36): objs=1084 size=4.33KiB - /28/20S (2|25|36): objs=176 size=308B - /28/22S (2|25|36): objs=136 size=247B - /28/23N (2|25|36): objs=1059 size=4.11KiB - /28/24S (2|25|36): objs=155 size=295B - /28/25N (2|25|36): objs=4675 size=20.06KiB - /28/26S (2|25|36): objs=165 size=210B - /28/27N (2|25|36): objs=609 size=2.09KiB - /28/28S (2|25|36): objs=145 size=326B - /28/29N (2|25|36): objs=4229 size=18.65KiB - /28/30S (2|25|36): objs=154 size=125B - /28/31N (2|25|36): objs=287 size=849B - /28/32S (2|25|36): objs=132 size=224B - /28/33S (2|25|36): objs=168 size=184B - /28/34S (2|25|36): objs=148 size=88B - /29/0N (2|25|36): objs=38926 size=823.78KiB - /29/1N (2|25|36): objs=31532 size=449.87KiB - /29/2N (2|25|36): objs=40332 size=904.51KiB - /29/3N (2|25|36): objs=7309 size=33.98KiB - /29/4S (2|25|36): objs=153 size=212B - /29/5N (2|25|36): objs=2346 size=10.02KiB - /29/6S (2|25|36): objs=154 size=299B - /29/7S (2|25|36): objs=148 size=324B - /29/8S (2|25|36): objs=173 size=186B - /29/9N (2|25|36): objs=945 size=3.71KiB - /29/10S (2|25|36): objs=148 size=185B - /29/11N (2|25|36): objs=1627 size=6.69KiB - /29/12S (2|25|36): objs=167 size=244B - /29/13N (2|25|36): objs=736 size=2.71KiB - /29/14S (2|25|36): objs=151 size=259B - /29/15N (2|25|36): objs=299 size=1021B - /29/16S (2|25|36): objs=134 size=126B - /29/17N (2|25|36): objs=2875 size=12.45KiB - /29/18S (2|25|36): objs=152 size=89B - /29/19N (2|25|36): objs=7398 size=35.59KiB - /29/20S (2|25|36): objs=166 size=277B - /29/21N (2|25|36): objs=2506 size=10.8KiB - /29/22S (2|25|36): objs=135 size=93B - /29/23N (2|25|36): objs=330 size=998B - /29/24S (2|25|36): objs=177 size=260B - /29/25N (2|25|36): objs=2600 size=11.17KiB - /29/26S (2|25|36): objs=174 size=240B - /29/27N (2|25|36): objs=3012 size=13.37KiB - /29/28S (2|25|36): objs=143 size=314B - /29/30S (2|25|36): objs=155 size=316B - /29/32S (2|25|36): objs=143 size=260B - /29/33N (2|25|36): objs=1079 size=4.21KiB - /29/34S (2|25|36): objs=164 size=186B - /29/35N (2|25|36): objs=1814 size=8.05KiB - /30/0N (2|25|36): objs=39811 size=873.29KiB - /30/1N (2|25|36): objs=37689 size=703.09KiB - /30/2N (2|25|36): objs=38487 size=903.8KiB - /30/3N (2|25|36): objs=14542 size=137.76KiB - /30/4S (2|25|36): objs=134 size=102B - /30/5N (2|25|36): objs=295 size=816B - /30/6S (2|25|36): objs=142 size=109B - /30/7N (2|25|36): objs=2299 size=9.61KiB - /30/8S (2|25|36): objs=178 size=322B - /30/9S (2|25|36): objs=146 size=281B - /30/10S (2|25|36): objs=167 size=289B - /30/11N (2|25|36): objs=322 size=888B - /30/12S (2|25|36): objs=144 size=192B - /30/14S (2|25|36): objs=150 size=217B - /30/15N (2|25|36): objs=1936 size=7.96KiB - /30/16S (2|25|36): objs=150 size=220B - /30/17N (2|25|36): objs=1700 size=7.2KiB - /30/18S (2|25|36): objs=145 size=247B - /30/20S (2|25|36): objs=151 size=221B - /30/21N (2|25|36): objs=4522 size=22.51KiB - /30/22S (2|25|36): objs=143 size=332B - /30/23N (2|25|36): objs=4341 size=19.94KiB - /30/24S (2|25|36): objs=166 size=150B - /30/25N (2|25|36): objs=3241 size=13.76KiB - /30/26S (2|25|36): objs=158 size=155B - /30/28S (2|25|36): objs=154 size=342B - /30/29N (2|25|36): objs=280 size=763B - /30/30S (2|25|36): objs=164 size=275B - /30/32S (2|25|36): objs=178 size=113B - /30/33N (2|25|36): objs=2529 size=10.62KiB - /30/34S (2|25|36): objs=143 size=325B - /30/35N (2|25|36): objs=603 size=2.21KiB - /31/0N (2|25|36): objs=21602 size=231.61KiB - /31/1S (2|25|36): objs=145 size=169B - /31/2N (2|25|36): objs=18241 size=150.79KiB - /31/3N (2|25|36): objs=40382 size=911.56KiB - /31/4N (2|25|36): objs=40154 size=787.18KiB - /31/5N (2|25|36): objs=6526 size=30.59KiB - /31/6S (2|25|36): objs=153 size=119B - /31/8S (2|25|36): objs=163 size=267B - /31/10S (2|25|36): objs=147 size=200B - /31/11N (2|25|36): objs=2262 size=9.41KiB - /31/12S (2|25|36): objs=150 size=262B - /31/13N (2|25|36): objs=5819 size=28.49KiB - /31/14S (2|25|36): objs=168 size=232B - /31/15N (2|25|36): objs=4258 size=21.23KiB - /31/16S (2|25|36): objs=151 size=186B - /31/17N (2|25|36): objs=328 size=1.05KiB - /31/18S (2|25|36): objs=159 size=314B - /31/19N (2|25|36): objs=771 size=2.85KiB - /31/20S (2|25|36): objs=142 size=286B - /31/21N (2|25|36): objs=1682 size=7.21KiB - /31/22S (2|25|36): objs=146 size=164B - /31/23N (2|25|36): objs=4310 size=19.46KiB - /31/24S (2|25|36): objs=147 size=183B - /31/26S (2|25|36): objs=147 size=292B - /31/27N (2|25|36): objs=3618 size=16.66KiB - /31/28S (2|25|36): objs=178 size=166B - /31/29N (2|25|36): objs=1173 size=4.65KiB - /31/30S (2|25|36): objs=160 size=317B - /31/31N (2|25|36): objs=4847 size=23.25KiB - /31/32S (2|25|36): objs=177 size=121B - /31/33N (2|25|36): objs=2684 size=11.84KiB - /31/34S (2|25|36): objs=153 size=310B - /31/35S (2|25|36): objs=134 size=309B - -com.milaboratory.util.sorting.HashSorterTest > test2 SKIPPED - Gradle is still running, please be patient... - -com.milaboratory.util.sorting.SortingUtilTest > test1 STANDARD_OUT - Collation: 1.05s - Sorting: 1.06s - 1 - 217 - 41528 - 99464 - 99997 - -com.milaboratory.util.AtomicEnumHistogramTest > test1 STANDARD_OUT - {"labels":["A","B","C","null"],"hist":[1,2,0,1]} - -com.milaboratory.util.CacheTest > test1 STANDARD_OUT - Cache misses:400 - Cache hits:800 +com.milaboratory.core.RangeTest > test23e14 STANDARD_OUT + 1000001 + 1010100 + 1000111 + 1000011 -com.milaboratory.util.NSequenceWithQualityPrintHelperTest > test1 SKIPPED + 1000010 -com.milaboratory.util.JsonOverriderTest > test1 STANDARD_OUT - WARNING: unnecessary override -Ob= with the same value. +com.milaboratory.core.io.sequence.fasta.RandomAccessFastaReaderTest > test1nt STANDARD_ERROR + Indexing milib_7cc922641d0428c3f1c8cd7760adbec2a0130a072210065809450978917.fasta: 0% + Indexing milib_7cc922641d0428c3f1c8cd7760adbec2a0130a072210065809450978917.fasta: done -com.milaboratory.test.TestUtil > testLT STANDARD_OUT - Short tests. - No system env properties. +com.milaboratory.core.io.sequence.fasta.RandomAccessFastaReaderTest > test1 STANDARD_ERROR + Indexing milib_7cc922641d0428c3f1c8cd7760adbec2a0130a072210065809450978917.fasta: 0% + Indexing milib_7cc922641d0428c3f1c8cd7760adbec2a0130a072210065809450978917.fasta: done -com.milaboratory.core.motif.BitapPatternTest > ttt STANDARD_OUT - 0 ATTWCCGACA 9 - ||| |||| - 20 ATTT--GACA 27 - [S3:W->T,D4:C,D5:C] - 24 - -26 +com.milaboratory.core.io.sequence.fasta.RandomAccessFastaReaderTest > test2 STANDARD_ERROR + Indexing milib_14468ae625bbb23af9f8af1072e3abd11f9d04fb14564995339112736564.tmp: 0% + Indexing milib_14468ae625bbb23af9f8af1072e3abd11f9d04fb14564995339112736564.tmp: done -com.milaboratory.core.mutations.MutationTest > exportRegexps STANDARD_OUT - S([\QAGCTNRYSWKMBDHV\E])(\d+)([\QAGCTNRYSWKMBDHV\E])|D([\QAGCTNRYSWKMBDHV\E])(\d+)|I(\d+)([\QAGCTNRYSWKMBDHV\E]) - S([\Q*ACDEFGHIKLMNPQRSTVWY_XBJZ\E])(\d+)([\Q*ACDEFGHIKLMNPQRSTVWY_XBJZ\E])|D([\Q*ACDEFGHIKLMNPQRSTVWY_XBJZ\E])(\d+)|I(\d+)([\Q*ACDEFGHIKLMNPQRSTVWY_XBJZ\E]) +com.milaboratory.core.io.util.IOUtilTest > test111 STANDARD_OUT + 3 + 3 + -2147483648 + -9223372036854775808 -com.milaboratory.core.mutations.MutationsTest > testCanonical1 STANDARD_OUT - GCTCGCCTAGAGAGGGAGATTGTATTGAGTTCATCTGACTGGCCATCTTTGGAGACTCTCAGCCTCCTTATAAGAAGTAAGCGGCTCGAAGAAGCGAATCGGGGTTAAGGCTTACCGTGTGCTTTCTAATAGTTAGGGGGCTATTGCGACAGACTTATCTCGTTGCGGCAGTGGGTAATCCCAAAAATCTAGACGTCCATGTCGGGTACCCCTCTATTCGACGTAGGGAACAAGACACCCTAGAATAGCGAATCTCCGCTACATTCTTAATCGACGTGCCTCGTAGACGTACTCATTAATGCCCTTGCCGTCCGAGGACCGTTCTCAAAGTACTGCGCTCGGATGATGTTATTAAACGGAGTACAGGTGCTAGCGTATTAGAGACATGCGGCAAATTCTCACGTTTGAACCAAAAACTTGGGTATTGCTCGCTTGTACAGGATCTAACATGTTTTGTAGTACGACGTGAAAGCTCCTTCCAGGGTAGGCCTAACGACAGCGCTCGGATCTTAGGATCGTAGGCTGGGTTCTTGGATCCACAGAAATAAAGCAGAGCGGTCACAATGATCTTCTGGTTTGTGGTGCCTCATGTATATATACTAGCATAGATTAATTCCGCCCTCAAAGACCGAAGGACCCCATCAGTCTCAAACTTGGTCTGGTGGGGTGTTAGAGGTGTGGGTTTAGCAGAATCTTTGCTGCGAGAGTGTTGTCCCAAAGCTCTCTGGGCTCTTAAGCGCTCAGTTACTCGTGAGCGTGGAATGACCATGTTCGTGGGCTGACATTGTCCA - GCTCGCCTAGAGAGGAGATTGATTGAGTTCATCTGACTGGCCATCTTTGGAACTGCTCAGCCTCTTATAGATGTAGCGGTCGAACGAAGCGAATGCGGTGTTGAGGCTTACTGTGTGCTTTCTGATAGTTAGGGGGCTACTTGCGACAGACTTATCTCATTGCGGCAGTGAGTAATCCCAAAAATCTAACGTCCATGTCGGGTACCCCTCTATTCGACGTAGGAACAAGACACCCTAGAATAAGCGATCTCTACTACATCCTTAATCGTCGTGCCTCGTAGACGTACTCATTAATCCCTTGCCGTCCGAGACCGTTCTCAAAGTACCTGCGCTCGGAGGTGTTATTAAACGAGTACAGGTGCTACGCGTATTAGAGACATGCGGCAAATTCACGTGAACCAAAAACTTGGGTATTCTCGCTTGTACAGGATCTAACATGTTTATGAGTACGACGTGAACAGCTCTTCCAGTGTAGGCCTAACGACAGCGCTCGGACTTAGGATCGTAGGCTGGGTGTCTTGGATCCACAGGAATAAAGCGAGGGTCCAATGATCTTCTGGTTTTGGTGCCTCAGATATATACTACATGATTAACTCCGCCCTCAATAGTCCGAAAGACCCCATCGTCTCAAACTGTGTCTGGTGGGGTGTAGAGGTGTGGGTTTAGCAGAATCTTTGCTGCGAGAGTGTTCCCAAAGCTCTCTGGGCTCTTAAGCGCTCAGTTACTCGTGGCGTGGAATGACCTGTTCGTGGGCTGACATTTGTC - GCTCGCCTAGAGAGGAATTGATTGAGTTCATCTGATCTGGCCATCTTTGGAACTGCTCAGCCTCTTATTGATGTAGCCGTTCGAACGAATCGAATGCGGTGTTGAGGCTTACTGTGTGCTTTTCTATAGTTAGGGGTTACTTCGACAGACTTATCTCATGGGCAGTGAGTATATCCAAGAATCAACGTCCATGTCGGGTACCCTCTATTCACGTGGAATTAGACACCCTAGACATAAGCGATCTCTACATCTTAATCGTCGTGCCTCGTTACGTACTCTTAATCCCTTGCCGTCCGAGAACCGTTCTCGAAGTACCTGCGCTCGGAGGTTCTTATTAAACGAGTACTGTTACGCGTATTGGAGGCATGCGGGAAATTCACTGAACCAAAAACTTGGGTATTCTCGCTGTACAGGATCTAACAGTGTTTATGAGTACGACGTATCAGCTCCTTCTAGTGAGGCCTAACGACAGGCTCGGACTAGGGTCGTAGGCTGGGTGTCTTGGATCCACAGGGATAAAGCGAGGGTCCAATGATCTTCTGGTTTTGGTGTCCTCAGGATATACTACTATATTAACTCCGCCCTCAATAGTCCGAAAGACCCCACGTCTCAAATGTGTCTGGTGGGGTGAAGGTGTGATTTAGCAGTTCCTTGCGCGAAGGGTTCCCAAAGCTCCTGGGTCTTAAGCGCTCATACTCGTGGGCGTGGAATGACCTGTTCCTTGGCCGGCATTCGGTC - 0 GCTCGCCTAGAGA-GGA-ATTG-ATTGAGTTCATCTGATCTGGCCATCTTTGGA-ACTGCTCAGCCT-CTTAT-TGATGT-AGCCGTTCGAACGAATCGAATGCGGTGTTGAGGCTTACTGTGTGCTTTTCT-ATAGTTA-GGGGTTACTT-CGACAGACTTATCTC-ATG-GGCAGTGAGTATAT-CCAAGAATC-A-ACGTCCATGTCGGGTA-CCCTCTATTC-ACGT--GGAATTAGACACCCTAGACATAAGCG-ATCT---CTACA-TCTTAATCGTCGTGCCTCGT-TACGTACTC-TTAAT-CCCTTGCCGTCCGAGAACCGTTCTCGAAGTACCTGCGCTCGGAGGTTCTTATTAAAC-GAGTAC---TGTTACGCGTATTGGAGGCATGCGGGAAA-T-TCAC---TGAACCAAAAACTTGGGTATT-CTCGC-TGTACAGGATCTAACAGTGTTTATG-AGTACGACGT-ATCAGCTCCTTCTAGTG-AGGCCTAACGACAG-GCTCGGA-C-TAGGGTCGTAGGCTGGGTGTCTTGGATCCACAGGGATAAAGC-GAG-GGTC-CAATGATCTTCTGGTTT-TGGTGTCCTCA-G--GATATACTA-C-TATATTAACTCCGCCCTCAATAGTCCGAAAGACCCCA-C-GTCTCAAA--TGTGTCTGGTGGGGTG--A-AGGTGT-GATTTAGCAG-TTCCTTGC-GCGA-AG-GGT-TCCCAAAGCTC-CTGGG-TCTTAAGCGCTCA--TACTCGTGGGCGTGGAATGACC-TGTTCCTTGGCCGGCATTCGGT-C- 737 - ||||||||||||| ||| |||| ||||||||||||||| ||||||||||||||| ||| |||||||| ||||| || || ||| | ||||| ||| ||||| ||| ||| |||||||| |||||| ||||| ||||||| |||| || || ||||||||||||||| || ||||||| ||| || |||| |||| | |||||||||||||||| |||||||||| |||| |||| |||||||||||| || |||| |||| ||||| ||||||||| |||||||||| |||||||| ||||| ||||||||||||||| ||||||||| ||||| ||||||||||| | | ||||||||| |||||| || || ||||||| ||| ||||||| ||| | |||| ||||||||||||||||||||| ||||| |||||||||||||||| ||||| || |||||||||| | ||||||||| || | |||||||||||||| ||||||| | |||| ||||||||||||| |||||||||||||| ||||||| ||| |||| ||||||||||||||||| ||||| ||||| | |||||||| | || ||||| ||||||||||| || ||||| ||||||| | |||||||| || ||||||||||||| | |||||| | |||||||| || |||| |||| || | | ||||||||||| ||||| ||||||||||||| |||||||| ||||||||||||| ||||| | ||| | |||| || | - 0 GCTCGCCTAGAGAGGGAGATTGTATTGAGTTCATCTGA-CTGGCCATCTTTGGAGACT-CTCAGCCTCCTTATAAGAAGTAAGCGGCTCGAA-GAAGCGAAT-CGGGGTTAAGGCTTACCGTGTGC-TTTCTAATAGTTAGGGGGCTA-TTGCGACAGACTTATCTCGTTGCGGCAGTGGGTA-ATCCCAAAAATCTAGACGTCCATGTCGGGTACCCCTCTATTCGACGTAGGGAACAAGACACCCTAGA-AT-AGCGAATCTCCGCTACATTCTTAATCGACGTGCCTCGTAGACGTACTCATTAATGCCCTTGCCGTCCGAGGACCGTTCTCAAAGTA-CTGCGCTCGGATGATGTTATTAAACGGAGTACAGGTGCTA-GCGTATTAGAGACATGCGGCAAATTCTCACGTTTGAACCAAAAACTTGGGTATTGCTCGCTTGTACAGGATCTAACA-TGTTT-TGTAGTACGACGTGA-AAGCTCCTTCCAGGGTAGGCCTAACGACAGCGCTCGGATCTTAGGATCGTAGGCTGGGT-TCTTGGATCCACAGAAATAAAGCAGAGCGGTCACAATGATCTTCTGGTTTGTGGTG-CCTCATGTATATATACTAGCATAGATTAATTCCGCCCTCAA-AGACCGAAGGACCCCATCAGTCTCAAACTTG-GTCTGGTGGGGTGTTAGAGGTGTGGGTTTAGCAGAATCTTTGCTGCGAGAGTGTTGTCCCAAAGCTCTCTGGGCTCTTAAGCGCTCAGTTACTCGTGAGCGTGGAATGACCATGTTCGTGGGCTGACATT--GTCCA 790 - [I13:G,D15:G,I65:C,D66:C,I78:A,D79:A,I81:C,S81:C->G,S83:G->C,D84:C,D122:T,I125:T,I161:G,S161:G->T,D163:T,I224:A,S224:A->G,D225:G,I250:A,D251:A,D252:T,D253:C,S256:C->T,I257:C,I257:C,I263:T,S264:T->C,D265:C,D343:T,S344:G->T,S345:A->G,S346:T->A,S347:G->T,I348:G,I357:G,D358:G,I364:A,I364:G,I364:G,S364:A->T,D366:G,S367:T->C,D368:G,S369:C->T,D370:T,I389:G,S390:G->C,D391:C,I395:T,I396:C,D397:C,D398:T,I402:G,I402:T,S402:G->T,D403:T,D404:T,I432:T,D433:T,D474:C,I476:C,I591:T,S591:T->A,S592:A->T,D593:T,I604:A,I604:T,S605:T->G,D606:A,D607:G,I652:C,S652:C->T,S654:T->G,D655:G,I669:T,D670:T,I690:A,D691:A,I707:T,S707:T->G,S708:G->T,D709:T,I743:G,S743:G->T,D745:T,I772:C,S772:C->G,S773:G->T,S774:T->G,D776:G] - 0 GCTCGCCTAGAGA-GGGAGATTGTATTGAGTTCATCTGACTGGCCATCTTTGGAGACTCTCAGCCT-CCTTATAAGAAGT-AAG-CGGCTCGAAGAAGCGAATCGGGGTTAAGGCTTACCGTGTGCTTT-CTAATAGTTAGGGGGCTATTGCGACAGACTTATCTC-GTTGCGGCAGTGGGTAATCCCAAAAATCTAGACGTCCATGTCGGGTACCCCTCTATTCGACGT-AGGGAACAAGACACCCTAGAATAGCG-AATCTCC--GCTACA-TTCTTAATCGACGTGCCTCGTAGACGTACTCATTAATGCCCTTGCCGTCCGAGGACCGTTCTCAAAGTACTGCGCTCGGATGATG-TTATTAAAC-GGAGTAC---AGGTGCTAGCGTATTAGAGACATGC-GGCAAA-T-TCTCAC--GTTTGAACCAAAAACTTGGGTATTGCTCGC-TTGTACAGGATCTAACATGTTTTGTAGTACGACGTGAAAGCTCC-TTCCAGGGTAGGCCTAACGACAGCGCTCGGATCTTAGGATCGTAGGCTGGGTTCTTGGATCCACAGAAATAAAGCAGAGCGGTCACAATGATCTTCTGGTTTGTGGTGCCTCATG-TATATATACTAGC--ATAGATTAATTCCGCCCTCAAAGACCGAAGGACCCCATCAGTCTCAAA-CTTGGTCTGGTGGGGTG-TTAGAGGTGTGGGTTTAGCAG-AATCTTTGCTGCGAGAG-TGTTGTCCCAAAGCTCTCTGGGCTCTTAAGCGCTCA-GTTACTCGTGAGCGTGGAATGACCATGTT-CGTGGGCTGACATTGTCCA 790 - ||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| | | | ||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | || |||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | ||||| | |||||||||||||||||| | ||| | | ||| ||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| | ||||||||||||||||||| | ||||||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| | |||||||||||||| - 0 GCTCGCCTAGAGAGGG-AGATTGTATTGAGTTCATCTGACTGGCCATCTTTGGAGACTCTCAGCCTCC-TTATAAGAAGTAA-GCGGC-TCGAAGAAGCGAATCGGGGTTAAGGCTTACCGTGTGC-TTTCTAATAGTTAGGGGGCTATTGCGACAGACTTATCTCGTT-GCGGCAGTGGGTAATCCCAAAAATCTAGACGTCCATGTCGGGTACCCCTCTATTCGACGTAG-GGAACAAGACACCCTAGAATAGCGAA---TCTCCGCTACATTC-TTAATCGACGTGCCTCGTAGACGTACTCATTAATGCCCTTGCCGTCCGAGGACCGTTCTCAAAGTACTGCGCTCGGA-TGATGTTATTAAACGG-AGTACAGGTG-C-T-AGCGTATTAGAGACATGCGGC-AAATTCT--CACGTT--TGAACCAAAAACTTGGGTATTGCTCGCTT-GTACAGGATCTAACATGTTTTGTAGTACGACGTGAAAGCT-CCTTCCAGGGTAGGCCTAACGACAGCGCTCGGATCTTAGGATCGTAGGCTGGGTTCTTGGATCCACAGAAATAAAGCAGAGCGGTCACAATGATCTTCTGGTTTGTGGTGCCTCATGTAT-ATATACTAGCATAG--ATTAATTCCGCCCTCAAAGACCGAAGGACCCCATCAGTCTCAAACTTG-GTCTGGTGGGGTGTT-AGAGGTGTGGGTTTAGCAGAA-TCTTTGCTGCGAGAGTGT-TGTCCCAAAGCTCTCTGGGCTCTTAAGCGCTCAGTT-ACTCGTGAGCGTGGAATGACCATGTTCGTGG-GCTGACATTGTCCA 790 +com.milaboratory.core.merger.MergerParametersTest > test2 STANDARD_OUT + { + "qualityMergingAlgorithm": "SumSubtraction", + "partsLayout": "Collinear", + "minimalOverlap": 15, + "maxQuality": 50, + "minimalIdentity": 0.8, + "identityType": "Unweighted" + } com.milaboratory.core.mutations.MutationsUtilTest > test1111 STANDARD_OUT S([\QAGCTNRYSWKMBDHV\E])(\d+)([\QAGCTNRYSWKMBDHV\E])|D([\QAGCTNRYSWKMBDHV\E])(\d+)|I(\d+)([\QAGCTNRYSWKMBDHV\E]) @@ -4292,25 +2510,29 @@ com.milaboratory.core.mutations.MutationsUtilTest > nt2AAWithMappingManual4 STANDARD_OUT [S3:S->M,D4:D,S5:_->I] -com.milaboratory.core.io.util.IOUtilTest > test111 STANDARD_OUT - 3 - 3 - -2147483648 - -9223372036854775808 - -com.milaboratory.core.io.sequence.fasta.RandomAccessFastaReaderTest > test1nt STANDARD_ERROR - Indexing milib_c599519b574b09d3e9e7065b3573b11d4f3360276966349625176437433.fasta: 0% - Indexing milib_c599519b574b09d3e9e7065b3573b11d4f3360276966349625176437433.fasta: done +com.milaboratory.core.mutations.MutationTest > exportRegexps STANDARD_OUT + S([\QAGCTNRYSWKMBDHV\E])(\d+)([\QAGCTNRYSWKMBDHV\E])|D([\QAGCTNRYSWKMBDHV\E])(\d+)|I(\d+)([\QAGCTNRYSWKMBDHV\E]) + S([\Q*ACDEFGHIKLMNPQRSTVWY_XBJZ\E])(\d+)([\Q*ACDEFGHIKLMNPQRSTVWY_XBJZ\E])|D([\Q*ACDEFGHIKLMNPQRSTVWY_XBJZ\E])(\d+)|I(\d+)([\Q*ACDEFGHIKLMNPQRSTVWY_XBJZ\E]) -com.milaboratory.core.io.sequence.fasta.RandomAccessFastaReaderTest > test1 STANDARD_ERROR - Indexing milib_c599519b574b09d3e9e7065b3573b11d4f3360276966349625176437433.fasta: 0% - Indexing milib_c599519b574b09d3e9e7065b3573b11d4f3360276966349625176437433.fasta: done +com.milaboratory.core.mutations.MutationsTest > testCanonical1 STANDARD_OUT + TAAGTTTTGTAGCGCGTTATCAAACGCGTTGAAAAATCTACCGTACGTCACTCACCCGGGAAGAATAATTAAAGTTCGTTTTTAGGCGCAAACTACCTAAATTTTTAGCATCTGTGCCCGAAAGAGGTTAACAGACCATGACGTCGGTACCATTTGGCAGGTGTGGCGGTCGTGAGTAACCGTGAATTGACGCTTAAGCACCGCTCATTTCCCCGGTAAGCAAAGACTGCCGTTGCCAGTGTCCCTCTTCAAAGTACTTCTCACGCGCCTAGCTTTATAGACGGACCGGTGTCAGTAGACATCGTAAGAAGCTTACGCATAGCACTATGAGCTGCCATCCAAGAATACCCTGGGGGAATCATAATTCTTAGAAAGAGACTCTCTAGTAAGCCCGACGTTTACCCGATCTTCCGCGTTTATCTTCTTTCCTGCGTTGCATGTTAGGTTGCTAAACCCGCCCCACGAGGCGTCAGGGTTACGTCCTTCCTCCACGACGTATGTTTTGCATTCTAAGGCCTCCGCAGTAGGTATTGCAGCCGAGCTTTTTACTGATCCTGCGATTGGGGGTAACTGCCGCATCTAGCGCGGATTCCCTTACGACTCTCTGTATATCAGCCGGGGCATGGTGGTTTCGGCATAATGTACAGCCATAACTTTGGACGTCTCGACAACCTATGTACAGATCCGTCATCCTCGC + TAAGTTTTGTAGCGCCGTTTCAACGCGTTGAAAAATCTACACGTCGTCCTCACCCGTGAATAATAATTAAAGTTCGTTTTTAGCTCAAACTGGCCTGAATTTTTAGCTTCTGTGCCGAAAGAGGTTAACAACCTGACGTCGGTACCATTTGGCAGGTGTGGCGTCGTGAGTAACCGGAATTGACGCTAAGCACCGCTCATTTCCTCGTAAGAAAGACTGCCGTTGCCCAGTGTCCTCTTCAAAGTATTTCTCACGCGCCTAGCTCTTATAGACGGACCGTGTCAGTTATCGTATGGAGCTTACGCATAGCATTATGAGCTCCATCCAAAATACCTGGGGAATCGATGTTCTTAGAAAGAGACTCTTAGTAAGCCCGACGTTTACCCGATCTTCCGCGTTTATCTTCTATTCCTGGTTGCATGTTGAGGTTGCTAAACCGCCCCACAGGGCGTCAGGGTTCGCCTTCCTCCACGACGTATGTTTTATCTAAGGCCTCCTCAGTAGGTATTGCAGCCGAGCTTTTTACTGACCTGCGATTGGGGGTAACTGCCGGTCTAGCGCGGATCCCTTACGACTCTCTGTATATCAGCCGGGGGCATGGTGGTTTCGGCATAATGTACAGCCATAACTTTTGACGTGCTCGACAACTCATGTACAGATCCGTCATCCTCGC + TAAGTTTTGTAGCGCCGATTTCAACGCGTTTGAAATATCTACACTCGTCCTCACGTGAATAATAATTGAAGTTTCTTTCTAGCTCAAACTGGCTGAATTTTTAGCTTCTGTCCGAAGAGGTTGACATCTTACTCGGTACCATTTGGCAGGGTCGCGTGTAACGGAATGACGCTAAGCACCGCTCATTTCCTCGTAAGAAAGACTGCCGTTGCCCAGTGTCCTCTTCAAGTATTTCTCACGCGCCTAGCCTTATTTGACGGACCGGGTCAGTCGTATGGGCTTACGCATGCATTATGAGCTCCGTCCAGAATACCTGGGGAATCGATGTTCTTAGAAGAGACTCTTAGTAAGCCCGACTTTACCCGATCTTCCGCGTTTATCTTCTATTCCTGGTTGGCATGTTGAGGTTGCTAAACGCCCCACAGTGGCGTCAGTGTTCTCCTCCTCCACGACGTATGTTTTATCTAAGCCTCTCATAGGTATTGCTGCCGAGCTTTTATGACCTGCGATTTGGGTAACTGCGTTCTAGCGCGGACCTTTACCACTCTCTTTATATCAGCCGGTGGCATGGTGGTTTCGGCATATGTACAGCCAAAACTTTTGACGTGCTCGGCAACCATGTACAGATCCGTCATCCTCGC + 0 TAAGTTTTGTAGCGCCGATT-TC-AACGCGTTTGAAATATCTACAC-T-CGTC-CTCA--CGTGAATAATAATTGAAGTTTC-TTTCTA-GCTCAAACTGGCTGAATTTTTAGCTTCTGT--CCG-AAGAGGTTGAC--ATC-TTAC-TCGGTACCATTTGGCAGG-GT--C-G-CGT--GTAA-CG-GAA-TGACGC-TAAGCACCGCTCATTTCCTC-GTAAG-AAAGACTGCCGTTGCCCAGTGT-CCTCTTC-AAGTATTTCTCACGCGCCTAGCCTTATTTGACGGACCGG-GTC---AG---TCGTATG-GGCTTACGCAT-GCATTATGAGCT-CCGTCC-AGAATA-CCT-GGGGAATCGAT-GTTCTTAG-AAGAGACTCT-TAGTAAGCCCGAC-TTTACCCGATCTTCCGCGTTTATCTTCTATTCCTG-GTTGGCATGTTGAGGTTGCTAAA--CGCCCCACAGTGGCGTCAGTGTT-C-TCC-TCCTCCACGACGTATGTTTT--A-TCTAA-GCCT-CTCA-TAGGTATTGCTGCCGAGC-TTTTA-TGA-CCTGCGATT-TGGGTAACTG-CG-TTCTAGCGCGGA--CCTTTACCACTCTCTTTATATCAGCCGGTGGCATGGTGGTTTCGGCAT-ATGTACAGCCAAAACTTTTGACGTGCTCGGCAACC-ATGTACAGATCCGTCATCCTCGC 640 + |||||||||||||| || || || |||||| |||||| |||||| | | |||| |||| || ||| ||||||| ||| ||| ||| || || |||||| || |||||||||| ||||| ||| |||||||| || | | | || |||||||||||||||||| || | | ||| |||| || ||| |||||| |||||||||||||||||| | ||||| |||||||||||||| ||||||| ||||||| ||||| |||||||||||||||| ||| | |||||||||| ||| || ||||| | |||||||||| ||| |||||||| || ||| |||||| ||| |||||||| || ||||||| |||||||||| ||||||||||||| |||||||||||||||||||||||||||| |||||| ||| ||||||| ||||||||||| |||||||| | |||||||| ||| | ||| |||||||||||||||||||| | ||||| |||| | || |||||||||| ||||||| ||||| ||| ||||||||| ||||||||| || ||||||||||| || |||| ||||||| |||||||||||| ||||||||||||||||||| ||||||||||| |||||| ||||| |||| ||||| ||||||||||||||||||||||| + 0 TAAGTTTTGTAGCG-CG-TTATCAAACGCG-TTGAAAAATCTAC-CGTACGTCACTCACCCGGGAAGAATAATTAAAG-TTCGTTTTTAGGCGCAAACTACCTAAATTTTTAGCATCTGTGCCCGAAAGAGGTTAACAGACCATGACGTCGGTACCATTTGGCAGGTGTGGCGGTCGTGAGTAACCGTGAATTGACGCTTAAGCACCGCTCATTTCCCCGGTAAGCAAAGACTGCCGTTG-CCAGTGTCCCTCTTCAAAGTACTTCTCACGCGCCTAGCTTTA-TAGACGGACCGGTGTCAGTAGACATCGTAAGAAGCTTACGCATAGCACTATGAGCTGCCATCCAAGAATACCCTGGGGGAATC-ATAATTCTTAGAAAGAGACTCTCTAGTAAGCCCGACGTTTACCCGATCTTCCGCGTTTATCTTCT-TTCCTGCGTT-GCATGTT-AGGTTGCTAAACCCGCCCCAC-GAGGCGTCAGGGTTACGTCCTTCCTCCACGACGTATGTTTTGCATTCTAAGGCCTCCGCAGTAGGTATTGCAGCCGAGCTTTTTACTGATCCTGCGATTGGGGGTAACTGCCGCATCTAGCGCGGATTCCCTTACGACTCTCTGTATATCAGCCGG-GGCATGGTGGTTTCGGCATAATGTACAGCCATAACTTTGGACGT-CTCGACAACCTATGTACAGATCCGTCATCCTCGC 696 + [D43:T,S44:A->T,I45:A,I54:C,I54:C,D55:C,D56:C,I95:C,D96:C,I115:G,S115:G->C,D118:C,I120:A,D122:A,I132:A,S132:A->G,D133:G,I164:G,D165:G,I167:G,S168:G->T,D169:T,I173:G,I173:A,D174:A,D175:G,I242:C,D244:C,I250:A,D252:A,D288:G,S289:T->G,I290:T,I293:A,I293:G,I293:T,I295:A,I295:C,S295:T->A,D296:A,D297:G,D298:A,D299:C,D300:A,I308:A,D309:A,I340:A,S341:A->G,D342:G,I351:G,D353:G,I362:A,D363:A,I371:A,D372:A,I453:C,D455:C,D463:G,S464:A->G,I465:A,I479:G,S479:G->T,D480:T,I483:T,D484:T,I504:G,S504:G->C,D505:C,I513:G,D514:G,I542:T,I542:T,D544:T,D546:T,I562:G,D564:G,I589:T,D590:T,D591:C,S594:T->C,I596:T,I617:G,D618:G,I638:A,D639:A,I654:T,S656:T->G,D658:G] + 0 TAAGTTTTGTAGCGCGTTATCAAACGCGTTGAAAAATCTACCGTA-CGTCACTCA--CCCGGGAAGAATAATTAAAGTTCGTTTTTAGGCGCAAACTA-CCTAAATTTTTAGCATCTGT-GCCCG-AAAGAGGTTAAC-AGACCATGACGTCGGTACCATTTGGCAGGTGT-GGC-GGTCGT--GAGTAACCGTGAATTGACGCTTAAGCACCGCTCATTTCCCCGGTAAGCAAAGACTGCCGTTGCCAGTGT-CCCTCTTC-AAAGTACTTCTCACGCGCCTAGCTTTATAGACGGACCGGT-GTC---AG--TAGACATCGTAAG-AAGCTTACGCATAGCACTATGAGCTGCCATCC-AAGAATACCCT-GGGGGAATCAT-AATTCTTAG-AAAGAGACTCTCTAGTAAGCCCGACGTTTACCCGATCTTCCGCGTTTATCTTCTTTCCTGCGTTGCATGTTAGGTTGCTAAA-CCCGCCCCACGA-GGCGTCAGGGTTAC-GTCC-TTCCTCCACGACGTATGTTTT-GCATTCTAA-GGCCTCCGCAGTAGGTATTGCAGCCGAGC--TTTTTACTGATCCTGCGATT-GGGGGTAACTGCCGCATCTAGCGCGGA-TTCCCTT-ACGACTCTCTGTATATCAGCC-GGGGCATGGTGGTTTCGGCAT-AATGTACAGCCATAAC-TTTGGACGTCTCGACAACCTATGTACAGATCCGTCATCCTCGC 696 + ||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| || | || ||||||||| |||||||||||||||||||||||||||||| | | | ||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| || ||||||||||||||||||||||||||||||||||| ||| || ||||||| | |||||||||||||||||||||||||||||| | |||||||| || |||||||| | ||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||| || | ||||||||||||||||||| ||||||| | ||||||||||||||||||||||||||| || | ||||||||||||||| || |||||||||||||||||||||||| | || | ||||||||||||||||||||| | ||||||||||||||||||| | |||||||||||||| || | |||||||||||||||||||||||||||||||||||||| + 0 TAAGTTTTGTAGCGCGTTATCAAACGCGTTGAAAAATCTACCG-TACGTCACTCACCC--GGGAAGAATAATTAAAGTTCGTTTTTAGGCGCAAACTACC-TAAATTTTTAGCATCTGTGCCC-GAAA-GAGGTTAACAG-ACCATGACGTCGGTACCATTTGGCAGGTGTGG-CGGT-CGTGAG--TAACCGTGAATTGACGCTTAAGCACCGCTCATTTCCCCGGTAAGCAAAGACTGCCGTTGCCAGTGTCCC-TCTTCAAA-GTACTTCTCACGCGCCTAGCTTTATAGACGGACCG-GTGTCAGTAGACA-----TCGTAAGAA-GCTTACGCATAGCACTATGAGCTGCCATCCAAG-AATACCCTGGG-GGAATCATAA-TTCTTAGAA-AGAGACTCTCTAGTAAGCCCGACGTTTACCCGATCTTCCGCGTTTATCTTCTTTCCTGCGTTGCATGTTAGGTTGCTAAACCC-GCCCCAC-GAGGCGTCAGGGTTACGT-CCTT-CCTCCACGACGTATGTTTTGC-ATTCTAAGG-CCTCCGCAGTAGGTATTGCAGCCGAGCTTTT-T-ACTGATCCTGCGATTGGG-GGTAACTGCCGCATCTAGCGCGGATT--CCCTTACGACTCTCTGTATATCAGCCGG-GGCATGGTGGTTTCGGCATAA-TGTACAGCCATAACTTTGG-ACGTCTCGACAACCTATGTACAGATCCGTCATCCTCGC 696 -com.milaboratory.core.io.sequence.fasta.RandomAccessFastaReaderTest > test2 STANDARD_ERROR - Indexing milib_b2f762a1e7af6fe249632762e7d461d2a6411e4918343225654943373063.tmp: 0% - Indexing milib_b2f762a1e7af6fe249632762e7d461d2a6411e4918343225654943373063.tmp: 46.4% - Indexing milib_b2f762a1e7af6fe249632762e7d461d2a6411e4918343225654943373063.tmp: 97.8% - Indexing milib_b2f762a1e7af6fe249632762e7d461d2a6411e4918343225654943373063.tmp: done +com.milaboratory.core.motif.BitapPatternTest > ttt STANDARD_OUT + 0 ATTWCCGACA 9 + ||| |||| + 20 ATTT--GACA 27 + [S3:W->T,D4:C,D5:C] + 24 + -26 com.milaboratory.core.tree.SequenceTreeMapTest > testCase9 STANDARD_OUT Hit 1 @@ -4368,195 +2590,6 @@ com.milaboratory.core.tree.PrimerGenerator > generate SKIPPED -com.milaboratory.core.merger.MergerParametersTest > test2 STANDARD_OUT - { - "qualityMergingAlgorithm": "SumSubtraction", - "partsLayout": "Collinear", - "minimalOverlap": 15, - "maxQuality": 50, - "minimalIdentity": 0.8, - "identityType": "Unweighted" - } - -com.milaboratory.core.sequence.AminoAcidSequenceTest > testName STANDARD_OUT - 3 - -com.milaboratory.core.sequence.AminoAcidSequenceTest > testConvertPositionSync1 STANDARD_OUT - FromCenter - 2 - 3 - 4 - 5 - 6 - 7 - 8 - 9 - 10 - 11 - 12 - 13 - 14 - 15 - 16 - 17 - 18 - 19 - FromLeftWithoutIncompleteCodon - 2 - 3 - 4 - 5 - 6 - 7 - 8 - 9 - 10 - 11 - 12 - 13 - 14 - 15 - 16 - 17 - 18 - 19 - FromLeftWithIncompleteCodon - 2 - 3 - 4 - 5 - 6 - 7 - 8 - 9 - 10 - 11 - 12 - 13 - 14 - 15 - 16 - 17 - 18 - 19 - FromRightWithoutIncompleteCodon - 2 - 3 - 4 - 5 - 6 - 7 - 8 - 9 - 10 - 11 - 12 - 13 - 14 - 15 - 16 - 17 - 18 - 19 - FromRightWithIncompleteCodon - 2 - 3 - 4 - 5 - 6 - 7 - 8 - 9 - 10 - 11 - 12 - 13 - 14 - 15 - 16 - 17 - 18 - 19 - -com.milaboratory.core.sequence.GeneticCodeTest > generateExtendedGeneticCode SKIPPED - -com.milaboratory.core.sequence.ShortSequenceSetTest > test1 STANDARD_OUT - 99955 elements with 366.33KiB in raw nucleotide entropy serialized into 273.41KiB - -com.milaboratory.core.sequence.AminoAcidAlphabetTest > testCalculateMatches SKIPPED - -com.milaboratory.core.sequence.NucleotideAlphabetTest > testCalculateIntersections SKIPPED - -com.milaboratory.core.sequence.quality.QualityTrimmerTest > testParametersSerialization0 STANDARD_OUT - { - "averageQualityThreshold": 7.0, - "windowSize": 6 - } - -com.milaboratory.core.sequence.quality.QualityAggregatorTest > test1 STANDARD_OUT - 45 - -com.milaboratory.core.sequence.quality.QualityAggregatorTest > test2 STANDARD_OUT - 650 - -com.milaboratory.core.sequence.quality.QualityAggregatorTest > test3 STANDARD_OUT - 2511 - -com.milaboratory.core.RangeTest > test23e14 STANDARD_OUT - 1000001 - 1010100 - 1000111 - 1000011 - - 1000010 - -com.milaboratory.core.alignment.AlignmentTest > testInvert STANDARD_OUT - 8 AGACACAGATACA 20 - ||||||| ||||| - 0 AGACACATATACA 12 - 0 AGACACATATACA 12 - ||||||| ||||| - 8 AGACACAGATACA 20 - - 0 GATACATTAGACACAGATACA--- 20 - ||||||| ||||| - 0 --------AGACACATATACACAG 15 - 0 --------AGACACATATACACAG 15 - ||||||| ||||| - 0 GATACATTAGACACAGATACA--- 20 - - 0 GATACATTAGA---CACAGATACA 20 - ||||||||||| |||||||||| - 5 GATACATTAGAGACCACAGATACA 28 - 5 GATACATTAGAGACCACAGATACA 28 - ||||||||||| |||||||||| - 0 GATACATTAGA---CACAGATACA 20 - - 0 GATAC-----ATTAGA---CACAGATACA 20 - ||||| |||||| |||||||||| - 0 GATACGATACATTAGAGACCACAGATACA 28 - 0 GATACGATACATTAGAGACCACAGATACA 28 - ||||| |||||| |||||||||| - 0 GATAC-----ATTAGA---CACAGATACA 20 - - -com.milaboratory.core.alignment.AlignmentTrimmerTest > testRandom1 STANDARD_OUT - lTrimmed = 1761 - rTrimmed = 1674 - lTrimmed = 2941 - rTrimmed = 2771 - -com.milaboratory.core.alignment.AlignmentIteratorTest > test1 STANDARD_OUT - 0 -ATT-AGACA-- 7 - ||| || | - 0 AATTGGGA-ATT 10 - I0AI3GSA3GDC6I8TI8T - -com.milaboratory.core.alignment.AlignerTest > testCalculateScore1 STANDARD_OUT - 11.69us - 10.60us - 8.65us - com.milaboratory.core.alignment.AlignerCustomTest > testSemiLocal0 STANDARD_OUT 29.0 2 c----cccTTgaa---tgTtaGTa-----taacta--tct 27 @@ -4565,11 +2598,32 @@ 2 c----cccTTgaa---tgTtaGTa-----taacta--tct 27 0 cAGTTccc--gaaACCtgCta--aGCTCTtaactaCTtct 35 +com.milaboratory.core.alignment.kaligner2.KAligner2Test > testBoundaries STANDARD_OUT + 4962 + +com.milaboratory.core.alignment.kaligner2.KAligner2Test > caseJ1 STANDARD_OUT + 52 + 0 TGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAGGA 51 + ||||||||||||||||||||||||||||||||||||||||||||||||||| + 55 TGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAGGG 106 + [S51:A->G] + (0->52) + (55->107) + +com.milaboratory.core.alignment.kaligner2.KAligner2Test > testCase0 SKIPPED + +com.milaboratory.core.alignment.kaligner2.KAligner2Test > testSimpleRandomTest STANDARD_OUT + Time per query: 2.93ms + Processed queries: 16 + Bad percent: 0.0 + False positive percent: 0.771513353115727 + Scoring error percent: 0.0 + com.milaboratory.core.alignment.kaligner2.OffsetPacksAccumulatorTest > testScoreCorrection2 SKIPPED com.milaboratory.core.alignment.kaligner2.KMapper2Test > test11112 STANDARD_OUT ID: 0 - Score: 1719 + Score: 1716 Cluster 0: Q 27 -> T 15 - -12 Q 30 -> T 18 - -12 @@ -4585,9 +2639,9 @@ Q 93 -> T 59 - -34 Q 96 -> T 62 - -34 Q 99 -> T 65 - -34 - Q 111 -> T 79 - -32 Q 114 -> T 82 - -32 Cluster 2: + Q 150 -> T 92 - -58 Q 153 -> T 95 - -58 Q 156 -> T 98 - -58 Q 159 -> T 101 - -58 @@ -4615,7 +2669,7 @@ com.milaboratory.core.alignment.kaligner2.KMapper2Test > test1111 STANDARD_OUT ID: 0 - Score: 1209 + Score: 1152 Cluster 0: Q 9 -> T 15 - 6 Q 12 -> T 18 - 6 @@ -4625,36 +2679,34 @@ Q 24 -> T 30 - 6 Q 27 -> T 33 - 6 Q 30 -> T 36 - 6 - Q 33 -> T 39 - 6 Cluster 1: + Q 57 -> T 48 - -9 Q 60 -> T 51 - -9 Q 69 -> T 61 - -8 - Q 78 -> T 69 - -9 Q 81 -> T 72 - -9 Q 84 -> T 75 - -9 + Q 87 -> T 78 - -9 + Q 90 -> T 81 - -9 Cluster 2: Q 123 -> T 89 - -34 Q 126 -> T 92 - -34 Q 129 -> T 95 - -34 Q 132 -> T 98 - -34 Q 135 -> T 101 - -34 - Q 150 -> T 116 - -34 Q 171 -> T 135 - -36 Q 174 -> T 138 - -36 Q 177 -> T 141 - -36 - Q 180 -> T 144 - -36 Q 183 -> T 147 - -36 Q 185 -> T 149 - -36 - Gradle is still running, please be patient... com.milaboratory.core.alignment.kaligner2.KMapper2Test > testRandom1 STANDARD_OUT - noHits: 279 + noHits: 284 noHits2: 0 noHits3: 0 - wrongTopHit: 44 - wrongTopHitS: 33 - noCorrectHitInList: 24 + wrongTopHit: 40 + wrongTopHitS: 31 + noCorrectHitInList: 17 @@ -4662,13 +2714,13 @@ Timings: DescriptiveStatistics: n: 100000 - min: 36167.0 - max: 3.429470975E9 - mean: 616507.5305198506 - std dev: 1.3187345072383659E7 - median: 466960.0 - skewness: 195.94171272705825 - kurtosis: 47032.72944620415 + min: 12659.0 + max: 6.29572101E8 + mean: 230099.5307599999 + std dev: 3935967.9555507055 + median: 177883.0 + skewness: 112.57507512040276 + kurtosis: 14084.443569302293 @@ -4676,14 +2728,14 @@ Clusters basicSize DescriptiveStatistics: - n: 99677 + n: 99676 min: 1.0 - max: 7.0 - mean: 2.874775524945585 - std dev: 1.1083725853414113 + max: 6.0 + mean: 2.8748043661463196 + std dev: 1.1014580194445598 median: 3.0 - skewness: 0.277642954820058 - kurtosis: -0.7015571477916591 + skewness: 0.2822000827053505 + kurtosis: -0.6974203322172272 @@ -4691,143 +2743,14 @@ Top Delta DescriptiveStatistics: - n: 99697 - min: -24.0 + n: 99699 + min: -19.0 max: 0.0 - mean: -0.0011033431296830984 - std dev: 0.12833102365179114 + mean: -0.0016549814942979928 + std dev: 0.15118298612055525 median: 0.0 - skewness: -130.14997250803614 - kurtosis: 18764.981167284237 - - -com.milaboratory.core.alignment.kaligner2.KAligner2Test > testBoundaries STANDARD_OUT - 4956 - -com.milaboratory.core.alignment.kaligner2.KAligner2Test > caseJ1 STANDARD_OUT - 52 - 0 TGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAGGA 51 - ||||||||||||||||||||||||||||||||||||||||||||||||||| - 55 TGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAGGG 106 - [S51:A->G] - (0->52) - (55->107) - -com.milaboratory.core.alignment.kaligner2.KAligner2Test > testCase0 SKIPPED - -com.milaboratory.core.alignment.kaligner2.KAligner2Test > testSimpleRandomTest STANDARD_OUT - Time per query: 12.02ms - Processed queries: 5 - Bad percent: 0.0 - False positive percent: 0.36363636363636365 - Scoring error percent: 0.0 - -com.milaboratory.core.alignment.BandedAffineAlignerTest > test11 STANDARD_OUT - 0 --------------------- -1 - 0 ATAAAAAAAAAAACGAGCTAG 20 - 0 --------------------- -1 - 0 ATAAAAAAAAAAACGAGCTAG 20 - -com.milaboratory.core.alignment.BandedAffineAlignerTest > test23 STANDARD_OUT - 0 atgcggggatgc 11 - 0 atgcggggatgc 11 - -com.milaboratory.core.alignment.BandedAffineAlignerTest > test1 STANDARD_OUT - 0 at-----------cgagctagTTTTTTTTTTT 20 - 0 atAAAAAAAAAAAcgagctag----------- 20 - 0 at-----------cgagctagTTTTTTTTTTT 20 - 0 atAAAAAAAAAAAcgagctag----------- 20 - -com.milaboratory.core.alignment.BandedAffineAlignerTest > test2 STANDARD_OUT - 0 atgcGGGGatgc 11 - 0 atgcTA--atgc 9 - 0 atgcGGGGatgc----------- 11 - 0 atgcTA--atgcTTTTTTTTTTT 20 - -com.milaboratory.core.alignment.BandedAffineAlignerTest > test3 STANDARD_OUT - 0 cgtaGGGGcgta 11 - 11 cgta--ATcgta 20 - 0 -----------cgtaGGGGcgta 11 - 0 TTTTTTTTTTTcgtaAT--cgta 20 - -com.milaboratory.core.alignment.BandedAffineAlignerTest > test4 STANDARD_OUT - 0 atgcggggat-gTTTTT 15 - 0 atgcggggatAg----- 11 - 0 atgcggggat-gTTTTTTT 17 - 0 atgcggggatAg------- 11 - -com.milaboratory.core.alignment.BandedAffineAlignerTest > test5 STANDARD_OUT - 7 g-taggggcgta 17 - 0 gAtaggggcgta 11 - - 0 TTTTTTTg-taggggcgta 17 - 0 -------gAtaggggcgta 11 - -com.milaboratory.core.alignment.BandedAffineAlignerTest > test6 STANDARD_OUT - 0 0 - 0 0 - -com.milaboratory.core.alignment.BandedAffineAlignerTest > semiGlobalLeft1 STANDARD_OUT - 0 gCccTtgtgatgacccagactccagcctccgtgGAGgCaGctgtgggaggcacagtcaccatcaagtgccaggccagtcagagcattagcaacctcttaGCCTGGTATCAGCAGAAACCAGGGCAGCCTCCCAAGCTCCTGATCTATTATGCATCCGATCTGGcatctggggtctcatcaaggttcaaaggcagtggatctgggacagagtAcactctcaccatcagTggcgtgcagtgtgccgatgctgccacttactac 260 - 1 gAccCtgtgatgacccagactccagcctccgtgTCTgAaCctgtgggaggcacagtcaccatcaagtgccaggccagtcagagcattagcaacctctta-------------------------------------------------------------NNNcatctggggtctcatcaaggttcaaaggcagtggatctgggacagagtTcactctcaccatcagCggcgtgcagtgtgccgatgctgccacttactac 200 - -com.milaboratory.core.alignment.batch.SimpleBatchAlignerTest > test1 STANDARD_OUT - 4 hits. - -com.milaboratory.core.alignment.blast.BlastAlignerTest > test1 SKIPPED - -com.milaboratory.core.alignment.blast.BlastAlignerTest > simpleRandomTestT1 SKIPPED - -com.milaboratory.core.alignment.blast.BlastAlignerTest > simpleRandomTestT2 SKIPPED - -com.milaboratory.core.alignment.blast.BlastAlignerTest > simpleRandomTestT3 SKIPPED - -com.milaboratory.core.alignment.blast.BlastDBBuilderTest > test1 SKIPPED - -com.milaboratory.core.alignment.blast.BlastAlignerExtTest > test16SMicrobial1 SKIPPED - -com.milaboratory.core.alignment.blast.BlastAlignerExtTest > test1 SKIPPED - -com.milaboratory.core.alignment.AlignmentHelperTest > test1 STANDARD_OUT - 0 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGC 29 - |||||||||||||||||||||||||||||| - 0 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGC 29 - - 30 TTGGT-ACAGCCTGGGGGGTCCCTGAGACT 58 - |||| | |||||||||||||| |||||| - 30 CTGGTCA-AGCCTGGGGGGTCCATGAGACA 58 - - 59 CTCCTGTGCAGCCTCTGGATTCACCTTCAG 88 - |||||||||||||||||||||| ||||||| - 59 CTCCTGTGCAGCCTCTGGATTCCCCTTCAG 88 - - 89 TAGC-TATAGCATGAACTGGGTCCGCCAGG 117 - || | ||||||||||||||||||||||||| - 89 TA-CTTATAGCATGAACTGGGTCCGCCAGG 117 - - 118 CTCCAGGGAAGGGGCTGGAGTGGGTTTCAT 147 - ||||||||||||||||||||||||| |||| - 118 CTCCAGGGAAGGGGCTGGAGTGGGTCTCAT 147 - - 148 ACATTAGTAGTAGTAGTAG-TACCATATAC 176 - |||||||||| ||||||| || |||||| - 148 CCATTAGTAGTGGTAGTAGTTA-CATATAT 176 - - 177 TACGCAGACTCTGTGAAGGGCCGATTCACC 206 - ||||||||||| |||||||||||||||||| - 177 TACGCAGACTCCGTGAAGGGCCGATTCACC 206 - - 207 ATCTCCAGAGACAATGCCAAGAACTCACTG 236 - |||||||||||||| ||||||||||||||| - 207 ATCTCCAGAGACAACGCCAAGAACTCACTG 236 - - 237 TATCTGCAAATGAACAGCCTGAGAGACGAG 266 - ||||||||||||||||||||||||| |||| - 237 TATCTGCAAATGAACAGCCTGAGAGCCGAG 266 - - 267 GACACGGCTGTGTATTACTGTGC 289 - ||||||||||||||||||||||| - 267 GACACGGCTGTGTATTACTGTGC 289 + skewness: -101.20146687314869 + kurtosis: 10922.707348922804 com.milaboratory.core.alignment.MultiAlignmentHelperTest > test1 STANDARD_OUT @@ -4949,14 +2872,124 @@ |||||| | 1 AATTGACAG 9 -com.milaboratory.core.alignment.kaligner1.KMapperTest > testBestOffset2 STANDARD_OUT - -205 +com.milaboratory.core.alignment.AlignmentTest > testInvert STANDARD_OUT + 8 AGACACAGATACA 20 + ||||||| ||||| + 0 AGACACATATACA 12 + 0 AGACACATATACA 12 + ||||||| ||||| + 8 AGACACAGATACA 20 + + 0 GATACATTAGACACAGATACA--- 20 + ||||||| ||||| + 0 --------AGACACATATACACAG 15 + 0 --------AGACACATATACACAG 15 + ||||||| ||||| + 0 GATACATTAGACACAGATACA--- 20 + + 0 GATACATTAGA---CACAGATACA 20 + ||||||||||| |||||||||| + 5 GATACATTAGAGACCACAGATACA 28 + 5 GATACATTAGAGACCACAGATACA 28 + ||||||||||| |||||||||| + 0 GATACATTAGA---CACAGATACA 20 + + 0 GATAC-----ATTAGA---CACAGATACA 20 + ||||| |||||| |||||||||| + 0 GATACGATACATTAGAGACCACAGATACA 28 + 0 GATACGATACATTAGAGACCACAGATACA 28 + ||||| |||||| |||||||||| + 0 GATAC-----ATTAGA---CACAGATACA 20 + + +com.milaboratory.core.alignment.AlignmentTrimmerTest > testRandom1 STANDARD_OUT + lTrimmed = 1688 + rTrimmed = 1650 + lTrimmed = 2839 + rTrimmed = 2864 + +com.milaboratory.core.alignment.AlignmentIteratorTest > test1 STANDARD_OUT + 0 -ATT-AGACA-- 7 + ||| || | + 0 AATTGGGA-ATT 10 + I0AI3GSA3GDC6I8TI8T + +com.milaboratory.core.alignment.batch.SimpleBatchAlignerTest > test1 STANDARD_OUT + 4 hits. + +com.milaboratory.core.alignment.blast.BlastAlignerTest > test1 SKIPPED + +com.milaboratory.core.alignment.blast.BlastAlignerTest > simpleRandomTestT1 SKIPPED + +com.milaboratory.core.alignment.blast.BlastAlignerTest > simpleRandomTestT2 SKIPPED + +com.milaboratory.core.alignment.blast.BlastAlignerTest > simpleRandomTestT3 SKIPPED + +com.milaboratory.core.alignment.blast.BlastAlignerExtTest > test16SMicrobial1 SKIPPED + +com.milaboratory.core.alignment.blast.BlastAlignerExtTest > test1 SKIPPED + +com.milaboratory.core.alignment.blast.BlastDBBuilderTest > test1 SKIPPED + +com.milaboratory.core.alignment.BandedAffineAlignerTest > test11 STANDARD_OUT + 0 --------------------- -1 + 0 ATAAAAAAAAAAACGAGCTAG 20 + 0 --------------------- -1 + 0 ATAAAAAAAAAAACGAGCTAG 20 + +com.milaboratory.core.alignment.BandedAffineAlignerTest > test23 STANDARD_OUT + 0 atgcggggatgc 11 + 0 atgcggggatgc 11 + +com.milaboratory.core.alignment.BandedAffineAlignerTest > test1 STANDARD_OUT + 0 at-----------cgagctagTTTTTTTTTTT 20 + 0 atAAAAAAAAAAAcgagctag----------- 20 + 0 at-----------cgagctagTTTTTTTTTTT 20 + 0 atAAAAAAAAAAAcgagctag----------- 20 + +com.milaboratory.core.alignment.BandedAffineAlignerTest > test2 STANDARD_OUT + 0 atgcGGGGatgc 11 + 0 atgcTA--atgc 9 + 0 atgcGGGGatgc----------- 11 + 0 atgcTA--atgcTTTTTTTTTTT 20 + +com.milaboratory.core.alignment.BandedAffineAlignerTest > test3 STANDARD_OUT + 0 cgtaGGGGcgta 11 + 11 cgta--ATcgta 20 + 0 -----------cgtaGGGGcgta 11 + 0 TTTTTTTTTTTcgtaAT--cgta 20 + +com.milaboratory.core.alignment.BandedAffineAlignerTest > test4 STANDARD_OUT + 0 atgcggggat-gTTTTT 15 + 0 atgcggggatAg----- 11 + 0 atgcggggat-gTTTTTTT 17 + 0 atgcggggatAg------- 11 + +com.milaboratory.core.alignment.BandedAffineAlignerTest > test5 STANDARD_OUT + 7 g-taggggcgta 17 + 0 gAtaggggcgta 11 + + 0 TTTTTTTg-taggggcgta 17 + 0 -------gAtaggggcgta 11 + +com.milaboratory.core.alignment.BandedAffineAlignerTest > test6 STANDARD_OUT + 0 0 + 0 0 + +com.milaboratory.core.alignment.BandedAffineAlignerTest > semiGlobalLeft1 STANDARD_OUT + 0 gCccTtgtgatgacccagactccagcctccgtgGAGgCaGctgtgggaggcacagtcaccatcaagtgccaggccagtcagagcattagcaacctcttaGCCTGGTATCAGCAGAAACCAGGGCAGCCTCCCAAGCTCCTGATCTATTATGCATCCGATCTGGcatctggggtctcatcaaggttcaaaggcagtggatctgggacagagtAcactctcaccatcagTggcgtgcagtgtgccgatgctgccacttactac 260 + 1 gAccCtgtgatgacccagactccagcctccgtgTCTgAaCctgtgggaggcacagtcaccatcaagtgccaggccagtcagagcattagcaacctctta-------------------------------------------------------------NNNcatctggggtctcatcaaggttcaaaggcagtggatctgggacagagtTcactctcaccatcagCggcgtgcagtgtgccgatgctgccacttactac 200 + +com.milaboratory.core.alignment.AlignerTest > testCalculateScore1 STANDARD_OUT + 4.57us + 4.49us + 3.19us com.milaboratory.core.alignment.kaligner1.KAlignerTest > testRandomCorrectness STANDARD_OUT - C=1182;I=0;M=0;ScE=0;R=0.0 AlignmentTime = 821.38us - C=1642;I=1;M=0;ScE=0;R=0.0 AlignmentTime = 807.44us - C=2048;I=0;M=0;ScE=0;R=0.0 AlignmentTime = 530.32us - C=2142;I=0;M=0;ScE=0;R=8.333333333333333E-7 AlignmentTime = 540.72us + C=1182;I=0;M=0;ScE=0;R=0.0 AlignmentTime = 784.69us + C=1642;I=1;M=0;ScE=0;R=0.0 AlignmentTime = 416.44us + C=2048;I=0;M=0;ScE=0;R=0.0 AlignmentTime = 249.01us + C=2142;I=0;M=0;ScE=0;R=8.333333333333333E-7 AlignmentTime = 268.13us com.milaboratory.core.alignment.kaligner1.KAlignerTest > testRandom1 STANDARD_OUT ##teamcity[buildStatisticValue key='kmFound' value='0.9449'] @@ -4964,21 +2997,2018 @@ ##teamcity[buildStatisticValue key='kmFalse' value='0.0058'] com.milaboratory.core.alignment.kaligner1.KAlignerTest > testRandomCorrectnessConcurrent STANDARD_OUT - C=2999;I=0;M=0;ScE=1;R=0.0 AlignmentTime = 965.30us - C=2999;I=0;M=0;ScE=0;R=0.0 AlignmentTime = 1.07ms - C=3000;I=0;M=0;ScE=0;R=0.0 AlignmentTime = 946.47us - C=2998;I=0;M=0;ScE=0;R=0.0 AlignmentTime = 1.11ms -Gradle Test Executor 1 finished executing tests. + C=3000;I=0;M=0;ScE=0;R=0.0 AlignmentTime = 3.83ms + C=2999;I=0;M=0;ScE=1;R=0.0 AlignmentTime = 3.22ms + C=2998;I=0;M=0;ScE=0;R=8.333333333333333E-7 AlignmentTime = 2.74ms + C=2997;I=0;M=1;ScE=0;R=0.0 AlignmentTime = 434.28us + +com.milaboratory.core.alignment.kaligner1.KMapperTest > testBestOffset2 STANDARD_OUT + -205 + +com.milaboratory.core.alignment.AlignmentHelperTest > test1 STANDARD_OUT + 0 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGC 29 + |||||||||||||||||||||||||||||| + 0 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGC 29 + + 30 TTGGT-ACAGCCTGGGGGGTCCCTGAGACT 58 + |||| | |||||||||||||| |||||| + 30 CTGGTCA-AGCCTGGGGGGTCCATGAGACA 58 + + 59 CTCCTGTGCAGCCTCTGGATTCACCTTCAG 88 + |||||||||||||||||||||| ||||||| + 59 CTCCTGTGCAGCCTCTGGATTCCCCTTCAG 88 + + 89 TAGC-TATAGCATGAACTGGGTCCGCCAGG 117 + || | ||||||||||||||||||||||||| + 89 TA-CTTATAGCATGAACTGGGTCCGCCAGG 117 + + 118 CTCCAGGGAAGGGGCTGGAGTGGGTTTCAT 147 + ||||||||||||||||||||||||| |||| + 118 CTCCAGGGAAGGGGCTGGAGTGGGTCTCAT 147 + + 148 ACATTAGTAGTAGTAGTAG-TACCATATAC 176 + |||||||||| ||||||| || |||||| + 148 CCATTAGTAGTGGTAGTAGTTA-CATATAT 176 + + 177 TACGCAGACTCTGTGAAGGGCCGATTCACC 206 + ||||||||||| |||||||||||||||||| + 177 TACGCAGACTCCGTGAAGGGCCGATTCACC 206 + + 207 ATCTCCAGAGACAATGCCAAGAACTCACTG 236 + |||||||||||||| ||||||||||||||| + 207 ATCTCCAGAGACAACGCCAAGAACTCACTG 236 + + 237 TATCTGCAAATGAACAGCCTGAGAGACGAG 266 + ||||||||||||||||||||||||| |||| + 237 TATCTGCAAATGAACAGCCTGAGAGCCGAG 266 + + 267 GACACGGCTGTGTATTACTGTGC 289 + ||||||||||||||||||||||| + 267 GACACGGCTGTGTATTACTGTGC 289 + + +com.milaboratory.core.sequence.AminoAcidSequenceTest > testName STANDARD_OUT + 3 + +com.milaboratory.core.sequence.AminoAcidSequenceTest > testConvertPositionSync1 STANDARD_OUT + FromCenter + 2 + 3 + 4 + 5 + 6 + 7 + 8 + 9 + 10 + 11 + 12 + 13 + 14 + 15 + 16 + 17 + 18 + 19 + FromLeftWithoutIncompleteCodon + 2 + 3 + 4 + 5 + 6 + 7 + 8 + 9 + 10 + 11 + 12 + 13 + 14 + 15 + 16 + 17 + 18 + 19 + FromLeftWithIncompleteCodon + 2 + 3 + 4 + 5 + 6 + 7 + 8 + 9 + 10 + 11 + 12 + 13 + 14 + 15 + 16 + 17 + 18 + 19 + FromRightWithoutIncompleteCodon + 2 + 3 + 4 + 5 + 6 + 7 + 8 + 9 + 10 + 11 + 12 + 13 + 14 + 15 + 16 + 17 + 18 + 19 + FromRightWithIncompleteCodon + 2 + 3 + 4 + 5 + 6 + 7 + 8 + 9 + 10 + 11 + 12 + 13 + 14 + 15 + 16 + 17 + 18 + 19 + +com.milaboratory.core.sequence.AminoAcidAlphabetTest > testCalculateMatches SKIPPED + +com.milaboratory.core.sequence.quality.QualityTrimmerTest > testParametersSerialization0 STANDARD_OUT + { + "averageQualityThreshold": 7.0, + "windowSize": 6 + } + +com.milaboratory.core.sequence.quality.QualityAggregatorTest > test1 STANDARD_OUT + 44 + +com.milaboratory.core.sequence.quality.QualityAggregatorTest > test2 STANDARD_OUT + 654 + +com.milaboratory.core.sequence.quality.QualityAggregatorTest > test3 STANDARD_OUT + 2466 + +com.milaboratory.core.sequence.ShortSequenceSetTest > test1 STANDARD_OUT + 99956 elements with 366.3KiB in raw nucleotide entropy serialized into 273.19KiB + +com.milaboratory.core.sequence.GeneticCodeTest > generateExtendedGeneticCode SKIPPED + +com.milaboratory.core.sequence.NucleotideAlphabetTest > testCalculateIntersections SKIPPED + +com.milaboratory.util.NSequenceWithQualityPrintHelperTest > test1 SKIPPED + +com.milaboratory.util.RemoveActionTest > test1 STANDARD_OUT + /tmp/milib_fe7dff4fb48548c46399a23ca768b54074cb913b673008784139180348 + +com.milaboratory.util.RemoveActionTest > test2 STANDARD_OUT + /tmp/milib_bb97ee7bcf9e4202a2bfd438ccd37734996e38d33153039067095070604.tmp + +com.milaboratory.util.IntCombinationsTest > test1 STANDARD_OUT + [0, 1] + [0, 2] + [1, 2] + +com.milaboratory.util.AtomicEnumHistogramTest > test1 STANDARD_OUT + {"labels":["A","B","C","null"],"hist":[1,2,0,1]} + +com.milaboratory.util.sorting.SortingUtilTest > test1 STANDARD_OUT + Collation: 385.2ms + Sorting: 407.61ms + 1 + 217 + 41455 + 99483 + 99998 + +com.milaboratory.util.sorting.HashSorterTest > testSingleton STANDARD_OUT + /tmp/milib_0f6a6e3b95c7e105a4ca92bfaaadf2e518cbdbd18315915529275753549 + timeInCollate: 13.8s + timeInCollatorInit: 8.62s + timeAwaitingO: 1.92ms + timeAwaitingI: 2.77s + timeInFinalSorting1: 0ns + timeInFinalSorting2: 35.14ms + timeInFinalSorting3: 99.17ms + /18S (5|27|32): objs=50000 size=2.9MiB + +com.milaboratory.util.sorting.HashSorterTest > test1 STANDARD_OUT + /tmp/milib_9b6d8285b6fd202015ac9e214d1d25549a8e550d11179729634348886296 + timeInCollate: 53.2s + timeInCollatorInit: 1.57s + timeAwaitingO: 11.56s + timeAwaitingI: 8.83s + timeInFinalSorting1: 4.98s + timeInFinalSorting2: 3.99s + timeInFinalSorting3: 1.63s + /0N (5|27|32): objs=151919 size=8.4MiB + /1N (5|27|32): objs=160502 size=8.79MiB + /2N (5|27|32): objs=160640 size=9.28MiB + /3N (5|27|32): objs=159035 size=8.76MiB + /4N (5|27|32): objs=155071 size=8.75MiB + /5N (5|27|32): objs=152260 size=8.47MiB + /6N (5|27|32): objs=147679 size=8.1MiB + /7N (5|27|32): objs=160570 size=9.33MiB + /8N (5|27|32): objs=154294 size=8.56MiB + /9N (5|27|32): objs=168441 size=9.72MiB + /10N (5|27|32): objs=158224 size=9.12MiB + /11N (5|27|32): objs=158547 size=9.2MiB + /12N (5|27|32): objs=150211 size=8.48MiB + /13N (5|27|32): objs=144429 size=7.56MiB + /14N (5|27|32): objs=156848 size=9.02MiB + /15N (5|27|32): objs=158408 size=9.06MiB + /16N (5|27|32): objs=152078 size=8.44MiB + /17N (5|27|32): objs=149777 size=8.21MiB + /18N (5|27|32): objs=162579 size=9.18MiB + /19N (5|27|32): objs=152197 size=8.6MiB + /20N (5|27|32): objs=158135 size=8.82MiB + /21N (5|27|32): objs=153232 size=8.9MiB + /22N (5|27|32): objs=157405 size=8.77MiB + /23N (5|27|32): objs=170278 size=9.94MiB + /24N (5|27|32): objs=150944 size=8.4MiB + /25N (5|27|32): objs=158985 size=8.73MiB + /26N (5|27|32): objs=150941 size=8.45MiB + /27N (5|27|32): objs=161193 size=9.16MiB + /28N (5|27|32): objs=162088 size=9.39MiB + /29N (5|27|32): objs=159576 size=9.17MiB + /30N (5|27|32): objs=150764 size=8.41MiB + /31N (5|27|32): objs=152750 size=8.36MiB + /0/0N (2|25|36): objs=33489 size=653.93KiB + /0/1N (2|25|36): objs=38729 size=803.68KiB + /0/2N (2|25|36): objs=20524 size=178.66KiB + /0/3S (2|25|36): objs=166 size=237B + /0/4N (2|25|36): objs=15415 size=100.67KiB + /0/5S (2|25|36): objs=155 size=264B + /0/6N (2|25|36): objs=2029 size=8.27KiB + /0/7N (2|25|36): objs=2445 size=10.24KiB + /0/8S (2|25|36): objs=158 size=294B + /0/9N (2|25|36): objs=1887 size=7.99KiB + /0/10S (2|25|36): objs=153 size=313B + /0/11N (2|25|36): objs=2708 size=11.34KiB + /0/12S (2|25|36): objs=142 size=172B + /0/14S (2|25|36): objs=165 size=303B + /0/15N (2|25|36): objs=2023 size=8.58KiB + /0/16S (2|25|36): objs=151 size=183B + /0/17N (2|25|36): objs=6746 size=39.92KiB + /0/18S (2|25|36): objs=178 size=359B + /0/19N (2|25|36): objs=4869 size=23.3KiB + /0/20S (2|25|36): objs=166 size=209B + /0/22S (2|25|36): objs=157 size=180B + /0/23N (2|25|36): objs=2970 size=13.05KiB + /0/24S (2|25|36): objs=150 size=259B + /0/25N (2|25|36): objs=2348 size=9.72KiB + /0/26S (2|25|36): objs=142 size=103B + /0/27N (2|25|36): objs=1432 size=5.68KiB + /0/28S (2|25|36): objs=160 size=156B + /0/29N (2|25|36): objs=3689 size=16.89KiB + /0/30S (2|25|36): objs=164 size=348B + /0/31N (2|25|36): objs=2684 size=11.39KiB + /0/32S (2|25|36): objs=152 size=313B + /0/33N (2|25|36): objs=5428 size=23.76KiB + /0/34S (2|25|36): objs=145 size=296B + /1/0N (2|25|36): objs=37662 size=736.43KiB + /1/1N (2|25|36): objs=38646 size=751.12KiB + /1/2N (2|25|36): objs=41906 size=959.96KiB + /1/3N (2|25|36): objs=11143 size=60.33KiB + /1/4S (2|25|36): objs=135 size=256B + /1/5N (2|25|36): objs=2173 size=9.26KiB + /1/6S (2|25|36): objs=162 size=158B + /1/7N (2|25|36): objs=5256 size=23.62KiB + /1/8S (2|25|36): objs=138 size=181B + /1/9N (2|25|36): objs=1100 size=4.33KiB + /1/10S (2|25|36): objs=170 size=103B + /1/11N (2|25|36): objs=1377 size=5.44KiB + /1/12S (2|25|36): objs=145 size=262B + /1/14S (2|25|36): objs=171 size=246B + /1/15S (2|25|36): objs=156 size=338B + /1/16S (2|25|36): objs=141 size=319B + /1/17N (2|25|36): objs=608 size=2.37KiB + /1/18S (2|25|36): objs=156 size=286B + /1/19N (2|25|36): objs=1258 size=4.88KiB + /1/20S (2|25|36): objs=139 size=94B + /1/21N (2|25|36): objs=773 size=3.05KiB + /1/22S (2|25|36): objs=162 size=98B + /1/23N (2|25|36): objs=3137 size=14.13KiB + /1/24S (2|25|36): objs=150 size=277B + /1/25N (2|25|36): objs=2662 size=11.43KiB + /1/26S (2|25|36): objs=180 size=258B + /1/27N (2|25|36): objs=1941 size=8.4KiB + /1/28S (2|25|36): objs=151 size=309B + /1/29N (2|25|36): objs=1634 size=6.79KiB + /1/30S (2|25|36): objs=135 size=168B + /1/31N (2|25|36): objs=898 size=3.25KiB + /1/32S (2|25|36): objs=154 size=289B + /1/33N (2|25|36): objs=3073 size=13.19KiB + /1/34S (2|25|36): objs=142 size=222B + /1/35N (2|25|36): objs=2668 size=12.39KiB + /2/0N (2|25|36): objs=41875 size=979.19KiB + /2/1N (2|25|36): objs=40289 size=963.03KiB + /2/2N (2|25|36): objs=31357 size=617.84KiB + /2/3S (2|25|36): objs=165 size=89B + /2/4N (2|25|36): objs=1037 size=4.12KiB + /2/5S (2|25|36): objs=141 size=162B + /2/7S (2|25|36): objs=166 size=196B + /2/8N (2|25|36): objs=2237 size=9.16KiB + /2/9S (2|25|36): objs=157 size=276B + /2/10N (2|25|36): objs=4222 size=21.01KiB + /2/11N (2|25|36): objs=3582 size=17.55KiB + /2/12S (2|25|36): objs=168 size=258B + /2/13N (2|25|36): objs=2959 size=12.49KiB + /2/14S (2|25|36): objs=150 size=222B + /2/15N (2|25|36): objs=901 size=3.36KiB + /2/16S (2|25|36): objs=159 size=337B + /2/17N (2|25|36): objs=8167 size=43.88KiB + /2/18S (2|25|36): objs=145 size=219B + /2/19N (2|25|36): objs=475 size=1.52KiB + /2/20S (2|25|36): objs=163 size=212B + /2/21N (2|25|36): objs=3798 size=17.92KiB + /2/22S (2|25|36): objs=172 size=130B + /2/23N (2|25|36): objs=5384 size=26.28KiB + /2/24S (2|25|36): objs=169 size=318B + /2/25N (2|25|36): objs=311 size=952B + /2/26S (2|25|36): objs=143 size=194B + /2/27N (2|25|36): objs=6869 size=36.4KiB + /2/28S (2|25|36): objs=158 size=168B + /2/29N (2|25|36): objs=2793 size=11.79KiB + /2/30S (2|25|36): objs=157 size=264B + /2/32S (2|25|36): objs=153 size=190B + /2/33N (2|25|36): objs=765 size=2.99KiB + /2/34S (2|25|36): objs=158 size=154B + /2/35N (2|25|36): objs=1095 size=4.28KiB + /3/0N (2|25|36): objs=39721 size=875.79KiB + /3/1N (2|25|36): objs=38781 size=752.51KiB + /3/2N (2|25|36): objs=26716 size=369.73KiB + /3/3S (2|25|36): objs=164 size=267B + /3/4N (2|25|36): objs=7283 size=39.22KiB + /3/5S (2|25|36): objs=151 size=206B + /3/6N (2|25|36): objs=4479 size=20.54KiB + /3/7N (2|25|36): objs=2321 size=9.86KiB + /3/8S (2|25|36): objs=168 size=145B + /3/9N (2|25|36): objs=4907 size=26.12KiB + /3/10S (2|25|36): objs=161 size=209B + /3/11N (2|25|36): objs=1267 size=4.93KiB + /3/12S (2|25|36): objs=172 size=339B + /3/13N (2|25|36): objs=860 size=3.47KiB + /3/14S (2|25|36): objs=127 size=192B + /3/15N (2|25|36): objs=3224 size=14.37KiB + /3/16S (2|25|36): objs=155 size=269B + /3/17N (2|25|36): objs=1842 size=7.51KiB + /3/18S (2|25|36): objs=148 size=270B + /3/19N (2|25|36): objs=4821 size=21.97KiB + /3/20S (2|25|36): objs=144 size=232B + /3/21N (2|25|36): objs=749 size=2.82KiB + /3/22S (2|25|36): objs=148 size=93B + /3/23N (2|25|36): objs=3472 size=14.9KiB + /3/24S (2|25|36): objs=179 size=226B + /3/25N (2|25|36): objs=609 size=2.07KiB + /3/26S (2|25|36): objs=163 size=234B + /3/28S (2|25|36): objs=138 size=117B + /3/29N (2|25|36): objs=7771 size=42.77KiB + /3/30S (2|25|36): objs=157 size=250B + /3/31N (2|25|36): objs=651 size=2.2KiB + /3/32S (2|25|36): objs=164 size=101B + /3/33N (2|25|36): objs=3184 size=14.63KiB + /3/34S (2|25|36): objs=143 size=192B + /3/35N (2|25|36): objs=3895 size=16.77KiB + /4/0N (2|25|36): objs=37055 size=715.46KiB + /4/1N (2|25|36): objs=41148 size=953.04KiB + /4/2N (2|25|36): objs=41282 size=1.02MiB + /4/3N (2|25|36): objs=3952 size=17.36KiB + /4/4S (2|25|36): objs=143 size=244B + /4/5N (2|25|36): objs=2562 size=10.63KiB + /4/6S (2|25|36): objs=181 size=199B + /4/8S (2|25|36): objs=166 size=202B + /4/9N (2|25|36): objs=4851 size=25.53KiB + /4/10S (2|25|36): objs=155 size=320B + /4/11N (2|25|36): objs=790 size=2.87KiB + /4/12S (2|25|36): objs=170 size=181B + /4/13N (2|25|36): objs=3142 size=13.14KiB + /4/14S (2|25|36): objs=135 size=264B + /4/15N (2|25|36): objs=1063 size=4.1KiB + /4/16S (2|25|36): objs=174 size=306B + /4/17N (2|25|36): objs=585 size=2.11KiB + /4/18S (2|25|36): objs=174 size=323B + /4/19N (2|25|36): objs=1335 size=5.9KiB + /4/20S (2|25|36): objs=169 size=345B + /4/21N (2|25|36): objs=585 size=2.11KiB + /4/22S (2|25|36): objs=168 size=161B + /4/23N (2|25|36): objs=2037 size=8.5KiB + /4/24S (2|25|36): objs=150 size=97B + /4/25N (2|25|36): objs=5531 size=28.78KiB + /4/26S (2|25|36): objs=155 size=120B + /4/27N (2|25|36): objs=448 size=1.44KiB + /4/28S (2|25|36): objs=159 size=244B + /4/29N (2|25|36): objs=4219 size=20.51KiB + /4/30S (2|25|36): objs=141 size=148B + /4/31S (2|25|36): objs=139 size=271B + /4/32S (2|25|36): objs=145 size=91B + /4/33N (2|25|36): objs=1659 size=6.96KiB + /4/34S (2|25|36): objs=140 size=111B + /4/35S (2|25|36): objs=163 size=291B + /5/0N (2|25|36): objs=38738 size=845.79KiB + /5/1N (2|25|36): objs=36650 size=637.73KiB + /5/2N (2|25|36): objs=28082 size=411.46KiB + /5/3S (2|25|36): objs=152 size=136B + /5/4N (2|25|36): objs=8907 size=42.57KiB + /5/5N (2|25|36): objs=2280 size=9.94KiB + /5/6S (2|25|36): objs=139 size=258B + /5/7N (2|25|36): objs=3542 size=15.27KiB + /5/8S (2|25|36): objs=152 size=184B + /5/9N (2|25|36): objs=2023 size=8.51KiB + /5/10S (2|25|36): objs=177 size=361B + /5/11N (2|25|36): objs=578 size=1.97KiB + /5/12S (2|25|36): objs=142 size=181B + /5/13N (2|25|36): objs=3678 size=16.78KiB + /5/14S (2|25|36): objs=147 size=192B + /5/15S (2|25|36): objs=130 size=197B + /5/16S (2|25|36): objs=150 size=288B + /5/17N (2|25|36): objs=1830 size=7.33KiB + /5/18S (2|25|36): objs=161 size=148B + /5/19N (2|25|36): objs=4235 size=19KiB + /5/20S (2|25|36): objs=144 size=204B + /5/21N (2|25|36): objs=1865 size=7.68KiB + /5/22S (2|25|36): objs=154 size=205B + /5/23N (2|25|36): objs=9684 size=57.31KiB + /5/24S (2|25|36): objs=140 size=173B + /5/26S (2|25|36): objs=133 size=295B + /5/27N (2|25|36): objs=2053 size=8.69KiB + /5/28S (2|25|36): objs=148 size=287B + /5/29N (2|25|36): objs=778 size=2.86KiB + /5/30S (2|25|36): objs=148 size=319B + /5/31N (2|25|36): objs=2209 size=9.28KiB + /5/32S (2|25|36): objs=159 size=212B + /5/33N (2|25|36): objs=1841 size=7.83KiB + /5/34S (2|25|36): objs=152 size=267B + /5/35N (2|25|36): objs=759 size=2.76KiB + /6/0N (2|25|36): objs=35848 size=685.9KiB + /6/1N (2|25|36): objs=35296 size=691.19KiB + /6/2N (2|25|36): objs=6994 size=33.92KiB + /6/3S (2|25|36): objs=146 size=259B + /6/4N (2|25|36): objs=29695 size=431KiB + /6/5N (2|25|36): objs=13525 size=81.3KiB + /6/6S (2|25|36): objs=154 size=153B + /6/7N (2|25|36): objs=300 size=824B + /6/8S (2|25|36): objs=151 size=99B + /6/9N (2|25|36): objs=434 size=1.41KiB + /6/10S (2|25|36): objs=150 size=271B + /6/11N (2|25|36): objs=456 size=1.66KiB + /6/12S (2|25|36): objs=184 size=202B + /6/13N (2|25|36): objs=467 size=1.62KiB + /6/14S (2|25|36): objs=166 size=141B + /6/15N (2|25|36): objs=1459 size=5.87KiB + /6/16S (2|25|36): objs=145 size=249B + /6/17N (2|25|36): objs=2001 size=8.29KiB + /6/18S (2|25|36): objs=157 size=215B + /6/19N (2|25|36): objs=4483 size=19.07KiB + /6/20S (2|25|36): objs=167 size=293B + /6/21N (2|25|36): objs=291 size=1.01KiB + /6/22S (2|25|36): objs=145 size=217B + /6/23N (2|25|36): objs=2073 size=9.16KiB + /6/24S (2|25|36): objs=163 size=99B + /6/25N (2|25|36): objs=585 size=2.32KiB + /6/26S (2|25|36): objs=145 size=235B + /6/27N (2|25|36): objs=1847 size=7.39KiB + /6/28S (2|25|36): objs=151 size=343B + /6/29N (2|25|36): objs=460 size=1.54KiB + /6/30S (2|25|36): objs=148 size=223B + /6/31N (2|25|36): objs=1077 size=4.19KiB + /6/32S (2|25|36): objs=160 size=298B + /6/33N (2|25|36): objs=1757 size=7.21KiB + /6/34S (2|25|36): objs=133 size=103B + /6/35N (2|25|36): objs=6166 size=27.57KiB + /7/0N (2|25|36): objs=39830 size=881.11KiB + /7/1N (2|25|36): objs=37449 size=825.99KiB + /7/2N (2|25|36): objs=39043 size=865.14KiB + /7/3N (2|25|36): objs=17530 size=154.61KiB + /7/4S (2|25|36): objs=163 size=203B + /7/5N (2|25|36): objs=1971 size=8.04KiB + /7/6S (2|25|36): objs=153 size=130B + /7/8S (2|25|36): objs=173 size=115B + /7/9N (2|25|36): objs=2540 size=11.64KiB + /7/10S (2|25|36): objs=173 size=246B + /7/11N (2|25|36): objs=5369 size=25.61KiB + /7/12S (2|25|36): objs=141 size=256B + /7/13N (2|25|36): objs=2900 size=12.32KiB + /7/14S (2|25|36): objs=152 size=179B + /7/15N (2|25|36): objs=637 size=2.48KiB + /7/16S (2|25|36): objs=165 size=219B + /7/17N (2|25|36): objs=775 size=2.9KiB + /7/18S (2|25|36): objs=165 size=296B + /7/20S (2|25|36): objs=135 size=229B + /7/21N (2|25|36): objs=2679 size=11.42KiB + /7/22S (2|25|36): objs=145 size=162B + /7/24S (2|25|36): objs=141 size=229B + /7/25N (2|25|36): objs=2200 size=9.37KiB + /7/26S (2|25|36): objs=150 size=298B + /7/28S (2|25|36): objs=147 size=339B + /7/29N (2|25|36): objs=297 size=735B + /7/30S (2|25|36): objs=162 size=330B + /7/31N (2|25|36): objs=1042 size=4.09KiB + /7/32S (2|25|36): objs=152 size=191B + /7/33N (2|25|36): objs=1059 size=4.06KiB + /7/34S (2|25|36): objs=159 size=160B + /7/35N (2|25|36): objs=2773 size=11.95KiB + /8/0N (2|25|36): objs=40403 size=874.56KiB + /8/1N (2|25|36): objs=38454 size=828.47KiB + /8/2N (2|25|36): objs=37190 size=715.2KiB + /8/3N (2|25|36): objs=6967 size=34.23KiB + /8/4S (2|25|36): objs=160 size=354B + /8/5N (2|25|36): objs=314 size=836B + /8/6S (2|25|36): objs=167 size=233B + /8/7N (2|25|36): objs=1062 size=4.13KiB + /8/8S (2|25|36): objs=141 size=302B + /8/9S (2|25|36): objs=183 size=234B + /8/10S (2|25|36): objs=161 size=294B + /8/11N (2|25|36): objs=765 size=3.08KiB + /8/12S (2|25|36): objs=140 size=150B + /8/13N (2|25|36): objs=1298 size=5.23KiB + /8/14S (2|25|36): objs=192 size=269B + /8/15N (2|25|36): objs=2371 size=11.18KiB + /8/16S (2|25|36): objs=176 size=145B + /8/17N (2|25|36): objs=4092 size=19.75KiB + /8/18S (2|25|36): objs=169 size=269B + /8/19N (2|25|36): objs=5072 size=22.91KiB + /8/20S (2|25|36): objs=145 size=274B + /8/21N (2|25|36): objs=1183 size=4.81KiB + /8/22S (2|25|36): objs=149 size=93B + /8/23N (2|25|36): objs=742 size=2.88KiB + /8/24S (2|25|36): objs=162 size=134B + /8/25N (2|25|36): objs=628 size=2.3KiB + /8/26S (2|25|36): objs=158 size=336B + /8/27N (2|25|36): objs=4623 size=20.62KiB + /8/28S (2|25|36): objs=155 size=220B + /8/29N (2|25|36): objs=1858 size=7.83KiB + /8/30S (2|25|36): objs=143 size=272B + /8/31N (2|25|36): objs=3013 size=12.99KiB + /8/32S (2|25|36): objs=156 size=236B + /8/33N (2|25|36): objs=453 size=1.48KiB + /8/34S (2|25|36): objs=138 size=286B + /8/35N (2|25|36): objs=1111 size=4.56KiB + /9/0N (2|25|36): objs=40237 size=975.18KiB + /9/1N (2|25|36): objs=45251 size=1.12MiB + /9/2N (2|25|36): objs=40525 size=913.63KiB + /9/3N (2|25|36): objs=1676 size=6.79KiB + /9/4S (2|25|36): objs=155 size=151B + /9/5N (2|25|36): objs=15149 size=93.54KiB + /9/6S (2|25|36): objs=161 size=98B + /9/7N (2|25|36): objs=1687 size=6.76KiB + /9/8S (2|25|36): objs=144 size=285B + /9/9N (2|25|36): objs=451 size=1.53KiB + /9/10S (2|25|36): objs=160 size=327B + /9/11N (2|25|36): objs=4013 size=17.51KiB + /9/12S (2|25|36): objs=150 size=328B + /9/13N (2|25|36): objs=1835 size=7.54KiB + /9/14S (2|25|36): objs=167 size=220B + /9/15N (2|25|36): objs=1672 size=6.82KiB + /9/16S (2|25|36): objs=154 size=314B + /9/17N (2|25|36): objs=624 size=2.36KiB + /9/18S (2|25|36): objs=151 size=188B + /9/19N (2|25|36): objs=1849 size=7.64KiB + /9/20S (2|25|36): objs=166 size=226B + /9/21N (2|25|36): objs=1725 size=7.14KiB + /9/22S (2|25|36): objs=165 size=206B + /9/23N (2|25|36): objs=4053 size=19.7KiB + /9/24S (2|25|36): objs=156 size=295B + /9/25S (2|25|36): objs=166 size=106B + /9/26S (2|25|36): objs=145 size=211B + /9/27N (2|25|36): objs=595 size=2.38KiB + /9/28S (2|25|36): objs=163 size=141B + /9/29N (2|25|36): objs=2147 size=9.66KiB + /9/30S (2|25|36): objs=162 size=298B + /9/31N (2|25|36): objs=1071 size=4.15KiB + /9/32S (2|25|36): objs=166 size=103B + /9/33S (2|25|36): objs=151 size=161B + /9/34S (2|25|36): objs=120 size=256B + /9/35N (2|25|36): objs=1079 size=4.1KiB + /10/0N (2|25|36): objs=39621 size=973.98KiB + /10/1N (2|25|36): objs=41965 size=1.02MiB + /10/2N (2|25|36): objs=37205 size=804.01KiB + /10/3N (2|25|36): objs=10888 size=54.66KiB + /10/4S (2|25|36): objs=142 size=110B + /10/5N (2|25|36): objs=2615 size=11.44KiB + /10/6S (2|25|36): objs=171 size=195B + /10/7N (2|25|36): objs=1910 size=7.73KiB + /10/8S (2|25|36): objs=163 size=296B + /10/9N (2|25|36): objs=4656 size=23.29KiB + /10/10S (2|25|36): objs=185 size=178B + /10/11N (2|25|36): objs=2296 size=9.59KiB + /10/12S (2|25|36): objs=159 size=235B + /10/13S (2|25|36): objs=141 size=252B + /10/14S (2|25|36): objs=136 size=312B + /10/15N (2|25|36): objs=3831 size=17.88KiB + /10/16S (2|25|36): objs=145 size=132B + /10/17N (2|25|36): objs=349 size=986B + /10/18S (2|25|36): objs=142 size=279B + /10/19N (2|25|36): objs=317 size=905B + /10/20S (2|25|36): objs=167 size=317B + /10/21N (2|25|36): objs=3295 size=15.04KiB + /10/22S (2|25|36): objs=139 size=136B + /10/23N (2|25|36): objs=1629 size=6.86KiB + /10/24S (2|25|36): objs=158 size=209B + /10/25N (2|25|36): objs=305 size=871B + /10/26S (2|25|36): objs=146 size=206B + /10/27N (2|25|36): objs=1534 size=6.3KiB + /10/28S (2|25|36): objs=145 size=181B + /10/29N (2|25|36): objs=757 size=2.95KiB + /10/30S (2|25|36): objs=144 size=108B + /10/31N (2|25|36): objs=2173 size=9.12KiB + /10/32S (2|25|36): objs=144 size=212B + /10/33N (2|25|36): objs=299 size=854B + /10/34S (2|25|36): objs=152 size=185B + /11/0N (2|25|36): objs=37997 size=779.25KiB + /11/1N (2|25|36): objs=35582 size=716.8KiB + /11/2N (2|25|36): objs=42603 size=1.04MiB + /11/3N (2|25|36): objs=18673 size=136.37KiB + /11/4S (2|25|36): objs=145 size=133B + /11/5N (2|25|36): objs=710 size=2.59KiB + /11/6S (2|25|36): objs=170 size=266B + /11/7N (2|25|36): objs=913 size=3.49KiB + /11/8S (2|25|36): objs=139 size=290B + /11/9S (2|25|36): objs=153 size=122B + /11/10S (2|25|36): objs=157 size=230B + /11/11N (2|25|36): objs=877 size=3.55KiB + /11/12S (2|25|36): objs=152 size=313B + /11/13N (2|25|36): objs=1234 size=5.05KiB + /11/14S (2|25|36): objs=149 size=303B + /11/15N (2|25|36): objs=3944 size=17.97KiB + /11/16S (2|25|36): objs=167 size=296B + /11/17N (2|25|36): objs=653 size=2.43KiB + /11/18S (2|25|36): objs=139 size=232B + /11/19S (2|25|36): objs=136 size=120B + /11/20S (2|25|36): objs=155 size=187B + /11/21N (2|25|36): objs=456 size=1.76KiB + /11/22S (2|25|36): objs=145 size=230B + /11/23N (2|25|36): objs=2176 size=9.08KiB + /11/24S (2|25|36): objs=145 size=162B + /11/25N (2|25|36): objs=1801 size=7.28KiB + /11/26S (2|25|36): objs=158 size=141B + /11/27N (2|25|36): objs=306 size=898B + /11/28S (2|25|36): objs=155 size=318B + /11/29N (2|25|36): objs=908 size=3.56KiB + /11/30S (2|25|36): objs=154 size=270B + /11/32S (2|25|36): objs=159 size=126B + /11/33N (2|25|36): objs=1387 size=5.81KiB + /11/34S (2|25|36): objs=137 size=209B + /11/35N (2|25|36): objs=5612 size=24.78KiB + /12/0N (2|25|36): objs=35760 size=638.4KiB + /12/1N (2|25|36): objs=38086 size=823.79KiB + /12/2N (2|25|36): objs=39544 size=852.96KiB + /12/3N (2|25|36): objs=2268 size=9.58KiB + /12/4S (2|25|36): objs=160 size=319B + /12/5N (2|25|36): objs=2773 size=11.83KiB + /12/6S (2|25|36): objs=161 size=293B + /12/7N (2|25|36): objs=4627 size=22.23KiB + /12/8S (2|25|36): objs=156 size=222B + /12/9N (2|25|36): objs=450 size=1.67KiB + /12/10S (2|25|36): objs=159 size=344B + /12/11N (2|25|36): objs=704 size=2.92KiB + /12/12S (2|25|36): objs=152 size=213B + /12/13N (2|25|36): objs=1218 size=4.61KiB + /12/14S (2|25|36): objs=152 size=282B + /12/15N (2|25|36): objs=1905 size=7.95KiB + /12/16S (2|25|36): objs=165 size=298B + /12/17N (2|25|36): objs=905 size=3.63KiB + /12/18S (2|25|36): objs=164 size=119B + /12/19N (2|25|36): objs=3866 size=16.69KiB + /12/20S (2|25|36): objs=165 size=251B + /12/21N (2|25|36): objs=3320 size=14.1KiB + /12/22S (2|25|36): objs=167 size=316B + /12/23N (2|25|36): objs=434 size=1.29KiB + /12/24S (2|25|36): objs=154 size=323B + /12/25S (2|25|36): objs=151 size=163B + /12/26S (2|25|36): objs=144 size=294B + /12/27N (2|25|36): objs=3195 size=14.16KiB + /12/28S (2|25|36): objs=161 size=175B + /12/29N (2|25|36): objs=2430 size=10.79KiB + /12/30S (2|25|36): objs=151 size=273B + /12/31N (2|25|36): objs=1368 size=5.56KiB + /12/32S (2|25|36): objs=163 size=151B + /12/33N (2|25|36): objs=2830 size=12.42KiB + /12/34S (2|25|36): objs=174 size=343B + /12/35N (2|25|36): objs=1829 size=7.32KiB + /13/0N (1|26|34): objs=68059 size=2.32MiB + /13/1S (1|26|34): objs=151 size=313B + /13/2N (1|26|34): objs=5011 size=26.52KiB + /13/3N (1|26|34): objs=21576 size=143.94KiB + /13/4S (1|26|34): objs=176 size=122B + /13/5N (1|26|34): objs=26087 size=267.4KiB + /13/6S (1|26|34): objs=150 size=126B + /13/7N (1|26|34): objs=777 size=2.9KiB + /13/8S (1|26|34): objs=144 size=134B + /13/9N (1|26|34): objs=973 size=3.99KiB + /13/10S (1|26|34): objs=160 size=315B + /13/11N (1|26|34): objs=2537 size=10.42KiB + /13/12S (1|26|34): objs=177 size=133B + /13/13N (1|26|34): objs=1373 size=5.49KiB + /13/14S (1|26|34): objs=169 size=87B + /13/15N (1|26|34): objs=1501 size=5.95KiB + /13/16S (1|26|34): objs=140 size=324B + /13/17N (1|26|34): objs=794 size=2.98KiB + /13/18S (1|26|34): objs=165 size=278B + /13/19N (1|26|34): objs=759 size=2.78KiB + /13/20S (1|26|34): objs=162 size=305B + /13/21N (1|26|34): objs=1671 size=6.93KiB + /13/22S (1|26|34): objs=140 size=108B + /13/23N (1|26|34): objs=628 size=2.31KiB + /13/24S (1|26|34): objs=147 size=234B + /13/25N (1|26|34): objs=1676 size=6.96KiB + /13/26S (1|26|34): objs=134 size=138B + /13/27N (1|26|34): objs=1335 size=5.56KiB + /13/28S (1|26|34): objs=148 size=182B + /13/29N (1|26|34): objs=5321 size=29.78KiB + /13/30S (1|26|34): objs=172 size=284B + /13/31N (1|26|34): objs=1024 size=3.97KiB + /13/32S (1|26|34): objs=129 size=317B + /13/33N (1|26|34): objs=863 size=3.65KiB + /14/0N (2|25|36): objs=41415 size=960.13KiB + /14/1N (2|25|36): objs=36568 size=887.28KiB + /14/2N (2|25|36): objs=37905 size=882.03KiB + /14/3N (2|25|36): objs=12139 size=75.91KiB + /14/4S (2|25|36): objs=143 size=281B + /14/5N (2|25|36): objs=299 size=1010B + /14/6S (2|25|36): objs=152 size=220B + /14/8S (2|25|36): objs=164 size=185B + /14/9N (2|25|36): objs=4048 size=17.34KiB + /14/10S (2|25|36): objs=142 size=218B + /14/11N (2|25|36): objs=2585 size=11.02KiB + /14/12S (2|25|36): objs=134 size=244B + /14/13N (2|25|36): objs=1493 size=5.88KiB + /14/14S (2|25|36): objs=156 size=135B + /14/15N (2|25|36): objs=2144 size=8.96KiB + /14/16S (2|25|36): objs=161 size=307B + /14/17N (2|25|36): objs=472 size=1.51KiB + /14/18S (2|25|36): objs=163 size=327B + /14/20S (2|25|36): objs=147 size=218B + /14/21N (2|25|36): objs=474 size=1.64KiB + /14/22S (2|25|36): objs=162 size=120B + /14/23N (2|25|36): objs=3173 size=13.8KiB + /14/24S (2|25|36): objs=164 size=358B + /14/25N (2|25|36): objs=6453 size=29.71KiB + /14/26S (2|25|36): objs=154 size=177B + /14/27N (2|25|36): objs=1522 size=6.36KiB + /14/28S (2|25|36): objs=147 size=280B + /14/29N (2|25|36): objs=597 size=2.2KiB + /14/30S (2|25|36): objs=151 size=293B + /14/31S (2|25|36): objs=150 size=249B + /14/32S (2|25|36): objs=160 size=262B + /14/33S (2|25|36): objs=161 size=320B + /14/34S (2|25|36): objs=146 size=187B + /14/35N (2|25|36): objs=2804 size=12.09KiB + /15/0N (2|25|36): objs=39034 size=911.76KiB + /15/1N (2|25|36): objs=41263 size=959.05KiB + /15/2N (2|25|36): objs=40869 size=1.01MiB + /15/3N (2|25|36): objs=3805 size=16.88KiB + /15/4S (2|25|36): objs=151 size=333B + /15/5N (2|25|36): objs=771 size=2.72KiB + /15/6S (2|25|36): objs=153 size=334B + /15/7N (2|25|36): objs=2223 size=9.95KiB + /15/8S (2|25|36): objs=160 size=291B + /15/9N (2|25|36): objs=7187 size=32.9KiB + /15/10S (2|25|36): objs=150 size=292B + /15/11N (2|25|36): objs=733 size=2.74KiB + /15/12S (2|25|36): objs=147 size=136B + /15/13N (2|25|36): objs=2864 size=11.97KiB + /15/14S (2|25|36): objs=161 size=219B + /15/15N (2|25|36): objs=1066 size=4.03KiB + /15/16S (2|25|36): objs=151 size=149B + /15/17N (2|25|36): objs=2150 size=8.96KiB + /15/18S (2|25|36): objs=159 size=138B + /15/19N (2|25|36): objs=486 size=1.73KiB + /15/20S (2|25|36): objs=145 size=236B + /15/21N (2|25|36): objs=1398 size=5.66KiB + /15/22S (2|25|36): objs=140 size=181B + /15/23N (2|25|36): objs=599 size=2.17KiB + /15/24S (2|25|36): objs=158 size=136B + /15/25N (2|25|36): objs=929 size=3.71KiB + /15/26S (2|25|36): objs=155 size=294B + /15/27N (2|25|36): objs=2292 size=9.84KiB + /15/28S (2|25|36): objs=180 size=142B + /15/29N (2|25|36): objs=2676 size=11.47KiB + /15/30S (2|25|36): objs=148 size=99B + /15/31N (2|25|36): objs=5425 size=24.15KiB + /15/32S (2|25|36): objs=155 size=280B + /15/33S (2|25|36): objs=168 size=224B + /15/34S (2|25|36): objs=157 size=333B + /16/0N (2|25|36): objs=42702 size=1MiB + /16/1N (2|25|36): objs=37109 size=665.58KiB + /16/2N (2|25|36): objs=32678 size=569.98KiB + /16/3S (2|25|36): objs=136 size=205B + /16/4S (2|25|36): objs=148 size=327B + /16/5S (2|25|36): objs=158 size=218B + /16/6N (2|25|36): objs=1345 size=5.6KiB + /16/7S (2|25|36): objs=171 size=166B + /16/8N (2|25|36): objs=286 size=1010B + /16/9S (2|25|36): objs=154 size=266B + /16/11S (2|25|36): objs=152 size=299B + /16/12N (2|25|36): objs=2953 size=13.07KiB + /16/13N (2|25|36): objs=3518 size=16.07KiB + /16/14S (2|25|36): objs=148 size=163B + /16/15N (2|25|36): objs=2186 size=8.98KiB + /16/16S (2|25|36): objs=145 size=124B + /16/17N (2|25|36): objs=3226 size=15.14KiB + /16/18S (2|25|36): objs=162 size=97B + /16/20S (2|25|36): objs=163 size=289B + /16/21N (2|25|36): objs=1817 size=7.5KiB + /16/22S (2|25|36): objs=144 size=88B + /16/23N (2|25|36): objs=1766 size=7.42KiB + /16/24S (2|25|36): objs=176 size=221B + /16/25N (2|25|36): objs=3346 size=14.31KiB + /16/26S (2|25|36): objs=156 size=149B + /16/27N (2|25|36): objs=6335 size=28.79KiB + /16/28S (2|25|36): objs=155 size=258B + /16/29N (2|25|36): objs=3338 size=14.27KiB + /16/30S (2|25|36): objs=154 size=258B + /16/31N (2|25|36): objs=2226 size=9.46KiB + /16/32S (2|25|36): objs=125 size=213B + /16/33N (2|25|36): objs=2137 size=9.18KiB + /16/34S (2|25|36): objs=149 size=89B + /16/35N (2|25|36): objs=2514 size=11.32KiB + /17/0N (2|25|36): objs=41408 size=972.6KiB + /17/1N (2|25|36): objs=38147 size=688.09KiB + /17/2N (2|25|36): objs=33093 size=600.95KiB + /17/3N (2|25|36): objs=6969 size=32.54KiB + /17/4S (2|25|36): objs=171 size=177B + /17/5N (2|25|36): objs=1183 size=5.07KiB + /17/6S (2|25|36): objs=186 size=218B + /17/7N (2|25|36): objs=802 size=2.96KiB + /17/8S (2|25|36): objs=151 size=325B + /17/9N (2|25|36): objs=1668 size=6.84KiB + /17/10S (2|25|36): objs=137 size=297B + /17/11N (2|25|36): objs=347 size=1008B + /17/12S (2|25|36): objs=182 size=178B + /17/13N (2|25|36): objs=2007 size=8.18KiB + /17/14S (2|25|36): objs=160 size=218B + /17/16S (2|25|36): objs=160 size=103B + /17/17N (2|25|36): objs=765 size=2.83KiB + /17/18S (2|25|36): objs=147 size=235B + /17/19N (2|25|36): objs=624 size=2.2KiB + /17/20S (2|25|36): objs=164 size=89B + /17/21N (2|25|36): objs=2121 size=8.79KiB + /17/22S (2|25|36): objs=151 size=161B + /17/23N (2|25|36): objs=306 size=758B + /17/24S (2|25|36): objs=153 size=237B + /17/25N (2|25|36): objs=7178 size=34.9KiB + /17/26S (2|25|36): objs=151 size=267B + /17/27N (2|25|36): objs=3473 size=15.1KiB + /17/28S (2|25|36): objs=154 size=240B + /17/29N (2|25|36): objs=1015 size=4.27KiB + /17/30S (2|25|36): objs=136 size=186B + /17/31N (2|25|36): objs=1665 size=6.79KiB + /17/32S (2|25|36): objs=168 size=321B + /17/33N (2|25|36): objs=3144 size=13.43KiB + /17/34S (2|25|36): objs=145 size=276B + /17/35N (2|25|36): objs=1346 size=5.65KiB + /18/0N (2|25|36): objs=40837 size=912.58KiB + /18/1N (2|25|36): objs=37611 size=849.19KiB + /18/2N (2|25|36): objs=42381 size=932.25KiB + /18/3N (2|25|36): objs=22417 size=225.88KiB + /18/4S (2|25|36): objs=153 size=229B + /18/5N (2|25|36): objs=2086 size=8.68KiB + /18/6S (2|25|36): objs=168 size=111B + /18/7N (2|25|36): objs=890 size=3.52KiB + /18/8S (2|25|36): objs=162 size=178B + /18/9N (2|25|36): objs=475 size=1.77KiB + /18/10S (2|25|36): objs=150 size=85B + /18/11N (2|25|36): objs=1175 size=4.8KiB + /18/12S (2|25|36): objs=135 size=222B + /18/13N (2|25|36): objs=469 size=1.57KiB + /18/14S (2|25|36): objs=139 size=171B + /18/15N (2|25|36): objs=331 size=1.06KiB + /18/16S (2|25|36): objs=148 size=273B + /18/17N (2|25|36): objs=853 size=3.38KiB + /18/18S (2|25|36): objs=166 size=224B + /18/19N (2|25|36): objs=437 size=1.53KiB + /18/20S (2|25|36): objs=162 size=131B + /18/21N (2|25|36): objs=457 size=1.72KiB + /18/22S (2|25|36): objs=157 size=96B + /18/23N (2|25|36): objs=1068 size=4.24KiB + /18/24S (2|25|36): objs=158 size=201B + /18/25N (2|25|36): objs=307 size=946B + /18/26S (2|25|36): objs=159 size=251B + /18/27N (2|25|36): objs=1798 size=7.62KiB + /18/28S (2|25|36): objs=149 size=307B + /18/29N (2|25|36): objs=1192 size=4.69KiB + /18/30S (2|25|36): objs=169 size=207B + /18/31S (2|25|36): objs=152 size=115B + /18/32S (2|25|36): objs=130 size=219B + /18/33N (2|25|36): objs=2238 size=9.18KiB + /18/34S (2|25|36): objs=135 size=204B + /18/35N (2|25|36): objs=2965 size=13.6KiB + /19/0N (2|25|36): objs=38075 size=799.16KiB + /19/1N (2|25|36): objs=36970 size=782.89KiB + /19/2N (2|25|36): objs=40859 size=908.46KiB + /19/3N (2|25|36): objs=5261 size=24.66KiB + /19/4S (2|25|36): objs=163 size=167B + /19/6S (2|25|36): objs=144 size=205B + /19/7N (2|25|36): objs=622 size=2.35KiB + /19/8S (2|25|36): objs=148 size=166B + /19/9N (2|25|36): objs=1121 size=4.39KiB + /19/10S (2|25|36): objs=165 size=225B + /19/11N (2|25|36): objs=7823 size=41.59KiB + /19/12S (2|25|36): objs=162 size=130B + /19/13N (2|25|36): objs=2854 size=11.99KiB + /19/14S (2|25|36): objs=168 size=311B + /19/16S (2|25|36): objs=149 size=256B + /19/17N (2|25|36): objs=435 size=1.68KiB + /19/18S (2|25|36): objs=143 size=153B + /19/19N (2|25|36): objs=435 size=1.46KiB + /19/20S (2|25|36): objs=161 size=193B + /19/21N (2|25|36): objs=5156 size=23.8KiB + /19/22S (2|25|36): objs=174 size=199B + /19/23N (2|25|36): objs=780 size=3.1KiB + /19/24S (2|25|36): objs=149 size=126B + /19/26S (2|25|36): objs=143 size=217B + /19/27N (2|25|36): objs=729 size=2.74KiB + /19/28S (2|25|36): objs=145 size=333B + /19/29N (2|25|36): objs=869 size=3.36KiB + /19/30S (2|25|36): objs=158 size=235B + /19/31N (2|25|36): objs=497 size=1.66KiB + /19/32S (2|25|36): objs=146 size=98B + /19/33N (2|25|36): objs=6222 size=31.79KiB + /19/34S (2|25|36): objs=149 size=213B + /19/35N (2|25|36): objs=1022 size=4.09KiB + /20/0N (2|25|36): objs=38692 size=815.48KiB + /20/1N (2|25|36): objs=41731 size=974.13KiB + /20/2N (2|25|36): objs=34591 size=629.25KiB + /20/3N (2|25|36): objs=15339 size=102.97KiB + /20/4S (2|25|36): objs=136 size=321B + /20/5N (2|25|36): objs=923 size=3.54KiB + /20/6S (2|25|36): objs=159 size=286B + /20/7N (2|25|36): objs=1531 size=6.37KiB + /20/8S (2|25|36): objs=170 size=87B + /20/9N (2|25|36): objs=611 size=1.99KiB + /20/10S (2|25|36): objs=152 size=202B + /20/11N (2|25|36): objs=3907 size=16.59KiB + /20/12S (2|25|36): objs=172 size=140B + /20/13N (2|25|36): objs=1073 size=4.17KiB + /20/14S (2|25|36): objs=135 size=144B + /20/15N (2|25|36): objs=1350 size=5.49KiB + /20/16S (2|25|36): objs=157 size=257B + /20/17N (2|25|36): objs=3583 size=15.85KiB + /20/18S (2|25|36): objs=188 size=228B + /20/19N (2|25|36): objs=281 size=953B + /20/20S (2|25|36): objs=155 size=256B + /20/21N (2|25|36): objs=574 size=1.97KiB + /20/22S (2|25|36): objs=144 size=157B + /20/23S (2|25|36): objs=140 size=229B + /20/24S (2|25|36): objs=178 size=111B + /20/25N (2|25|36): objs=2741 size=12.18KiB + /20/26S (2|25|36): objs=168 size=238B + /20/27N (2|25|36): objs=1602 size=6.7KiB + /20/28S (2|25|36): objs=152 size=195B + /20/30S (2|25|36): objs=168 size=223B + /20/31S (2|25|36): objs=170 size=336B + /20/32S (2|25|36): objs=168 size=295B + /20/33N (2|25|36): objs=2271 size=9.67KiB + /20/34S (2|25|36): objs=141 size=290B + /20/35N (2|25|36): objs=4482 size=20.5KiB + /21/0N (2|25|36): objs=39846 size=909.35KiB + /21/1N (2|25|36): objs=38781 size=893.05KiB + /21/2N (2|25|36): objs=37024 size=777.72KiB + /21/3N (2|25|36): objs=5817 size=29.63KiB + /21/4S (2|25|36): objs=155 size=100B + /21/5N (2|25|36): objs=1048 size=3.98KiB + /21/6S (2|25|36): objs=163 size=171B + /21/7N (2|25|36): objs=315 size=866B + /21/8S (2|25|36): objs=149 size=267B + /21/9N (2|25|36): objs=439 size=1.46KiB + /21/10S (2|25|36): objs=147 size=219B + /21/11N (2|25|36): objs=600 size=2.24KiB + /21/12S (2|25|36): objs=138 size=318B + /21/13N (2|25|36): objs=1741 size=7.55KiB + /21/14S (2|25|36): objs=156 size=107B + /21/15S (2|25|36): objs=157 size=303B + /21/16S (2|25|36): objs=143 size=311B + /21/17N (2|25|36): objs=2193 size=9.38KiB + /21/18S (2|25|36): objs=158 size=262B + /21/19N (2|25|36): objs=1629 size=6.64KiB + /21/20S (2|25|36): objs=146 size=140B + /21/21N (2|25|36): objs=4612 size=25.11KiB + /21/22S (2|25|36): objs=147 size=264B + /21/23N (2|25|36): objs=3283 size=14.09KiB + /21/24S (2|25|36): objs=154 size=190B + /21/25N (2|25|36): objs=437 size=1.68KiB + /21/26S (2|25|36): objs=167 size=321B + /21/27N (2|25|36): objs=5871 size=29.61KiB + /21/28S (2|25|36): objs=179 size=98B + /21/30S (2|25|36): objs=168 size=348B + /21/31N (2|25|36): objs=3349 size=14.33KiB + /21/32S (2|25|36): objs=150 size=306B + /21/33N (2|25|36): objs=448 size=1.67KiB + /21/34S (2|25|36): objs=139 size=295B + /21/35N (2|25|36): objs=3183 size=13.78KiB + /22/0N (2|25|36): objs=39922 size=956.91KiB + /22/1N (2|25|36): objs=38907 size=857.05KiB + /22/2N (2|25|36): objs=41372 size=955.63KiB + /22/3N (2|25|36): objs=2369 size=10.1KiB + /22/4S (2|25|36): objs=147 size=154B + /22/5N (2|25|36): objs=5199 size=23.65KiB + /22/6S (2|25|36): objs=148 size=224B + /22/7N (2|25|36): objs=1495 size=6.23KiB + /22/8S (2|25|36): objs=145 size=327B + /22/9N (2|25|36): objs=466 size=1.63KiB + /22/10S (2|25|36): objs=159 size=308B + /22/11N (2|25|36): objs=588 size=2.01KiB + /22/12S (2|25|36): objs=157 size=269B + /22/13N (2|25|36): objs=2565 size=11.27KiB + /22/14S (2|25|36): objs=144 size=205B + /22/15N (2|25|36): objs=289 size=1.01KiB + /22/16S (2|25|36): objs=163 size=113B + /22/17N (2|25|36): objs=1517 size=6.43KiB + /22/18S (2|25|36): objs=160 size=114B + /22/19N (2|25|36): objs=4776 size=21.4KiB + /22/20S (2|25|36): objs=130 size=223B + /22/21N (2|25|36): objs=3672 size=16.7KiB + /22/22S (2|25|36): objs=148 size=286B + /22/23N (2|25|36): objs=773 size=2.67KiB + /22/24S (2|25|36): objs=169 size=348B + /22/25S (2|25|36): objs=157 size=133B + /22/26S (2|25|36): objs=154 size=144B + /22/27N (2|25|36): objs=7893 size=39.59KiB + /22/28S (2|25|36): objs=179 size=266B + /22/29N (2|25|36): objs=971 size=3.89KiB + /22/30S (2|25|36): objs=185 size=152B + /22/32S (2|25|36): objs=150 size=146B + /22/33N (2|25|36): objs=284 size=901B + /22/34S (2|25|36): objs=147 size=172B + /22/35N (2|25|36): objs=1705 size=6.96KiB + /23/0N (2|25|36): objs=30322 size=449KiB + /23/1S (2|25|36): objs=145 size=316B + /23/2N (2|25|36): objs=12893 size=102.38KiB + /23/3N (2|25|36): objs=41428 size=1.14MiB + /23/4N (2|25|36): objs=35954 size=760.46KiB + /23/5S (2|25|36): objs=165 size=246B + /23/6N (2|25|36): objs=7286 size=34.75KiB + /23/7S (2|25|36): objs=128 size=215B + /23/8N (2|25|36): objs=1692 size=6.93KiB + /23/9N (2|25|36): objs=1093 size=4.47KiB + /23/10S (2|25|36): objs=142 size=193B + /23/11N (2|25|36): objs=1687 size=6.71KiB + /23/12S (2|25|36): objs=165 size=254B + /23/13N (2|25|36): objs=2268 size=9.51KiB + /23/14S (2|25|36): objs=171 size=323B + /23/15N (2|25|36): objs=625 size=2.44KiB + /23/16S (2|25|36): objs=138 size=131B + /23/17N (2|25|36): objs=1577 size=6.33KiB + /23/18S (2|25|36): objs=133 size=100B + /23/19N (2|25|36): objs=2368 size=10.36KiB + /23/20S (2|25|36): objs=126 size=184B + /23/21N (2|25|36): objs=7867 size=42.5KiB + /23/22S (2|25|36): objs=149 size=179B + /23/23N (2|25|36): objs=8461 size=45.56KiB + /23/24S (2|25|36): objs=170 size=321B + /23/25N (2|25|36): objs=6485 size=33.76KiB + /23/26S (2|25|36): objs=146 size=252B + /23/27N (2|25|36): objs=2466 size=10.57KiB + /23/28S (2|25|36): objs=135 size=263B + /23/29N (2|25|36): objs=294 size=783B + /23/30S (2|25|36): objs=148 size=240B + /23/31N (2|25|36): objs=2486 size=10.31KiB + /23/32S (2|25|36): objs=163 size=198B + /23/33S (2|25|36): objs=175 size=331B + /23/34S (2|25|36): objs=161 size=156B + /23/35N (2|25|36): objs=466 size=1.58KiB + /24/0N (2|25|36): objs=37406 size=832.44KiB + /24/1N (2|25|36): objs=37896 size=903.48KiB + /24/2N (2|25|36): objs=38386 size=764.92KiB + /24/3N (2|25|36): objs=5933 size=31.61KiB + /24/4S (2|25|36): objs=167 size=157B + /24/5N (2|25|36): objs=1355 size=5.43KiB + /24/6S (2|25|36): objs=133 size=315B + /24/7N (2|25|36): objs=892 size=3.26KiB + /24/8S (2|25|36): objs=163 size=255B + /24/9N (2|25|36): objs=1185 size=4.72KiB + /24/10S (2|25|36): objs=135 size=116B + /24/11S (2|25|36): objs=157 size=328B + /24/12S (2|25|36): objs=159 size=225B + /24/13N (2|25|36): objs=768 size=2.95KiB + /24/14S (2|25|36): objs=162 size=276B + /24/15N (2|25|36): objs=2660 size=11.61KiB + /24/16S (2|25|36): objs=137 size=219B + /24/17S (2|25|36): objs=166 size=145B + /24/18S (2|25|36): objs=169 size=221B + /24/19N (2|25|36): objs=4097 size=17.81KiB + /24/20S (2|25|36): objs=149 size=124B + /24/21N (2|25|36): objs=1470 size=5.92KiB + /24/22S (2|25|36): objs=166 size=87B + /24/23N (2|25|36): objs=6896 size=32.15KiB + /24/24S (2|25|36): objs=170 size=291B + /24/25N (2|25|36): objs=3652 size=17.65KiB + /24/26S (2|25|36): objs=146 size=119B + /24/27N (2|25|36): objs=927 size=3.85KiB + /24/28S (2|25|36): objs=167 size=139B + /24/29N (2|25|36): objs=996 size=3.87KiB + /24/30S (2|25|36): objs=146 size=147B + /24/31N (2|25|36): objs=1976 size=8.07KiB + /24/32S (2|25|36): objs=154 size=327B + /24/33N (2|25|36): objs=1662 size=6.81KiB + /24/34S (2|25|36): objs=141 size=99B + /25/0N (2|25|36): objs=44093 size=971.3KiB + /25/1N (2|25|36): objs=37423 size=794.59KiB + /25/2N (2|25|36): objs=36253 size=715.6KiB + /25/4S (2|25|36): objs=143 size=294B + /25/5N (2|25|36): objs=1240 size=4.81KiB + /25/6S (2|25|36): objs=147 size=138B + /25/7N (2|25|36): objs=4801 size=25.35KiB + /25/8S (2|25|36): objs=163 size=269B + /25/9N (2|25|36): objs=7156 size=34.78KiB + /25/10S (2|25|36): objs=134 size=281B + /25/11N (2|25|36): objs=4234 size=18.91KiB + /25/12S (2|25|36): objs=149 size=231B + /25/13N (2|25|36): objs=728 size=2.76KiB + /25/14S (2|25|36): objs=173 size=264B + /25/15N (2|25|36): objs=1227 size=4.75KiB + /25/16S (2|25|36): objs=147 size=111B + /25/17N (2|25|36): objs=1647 size=6.76KiB + /25/18S (2|25|36): objs=147 size=315B + /25/19N (2|25|36): objs=2937 size=12.17KiB + /25/20S (2|25|36): objs=135 size=262B + /25/22S (2|25|36): objs=128 size=285B + /25/23N (2|25|36): objs=6064 size=26.46KiB + /25/24S (2|25|36): objs=161 size=342B + /25/25S (2|25|36): objs=157 size=237B + /25/26S (2|25|36): objs=155 size=225B + /25/27N (2|25|36): objs=1868 size=7.54KiB + /25/28S (2|25|36): objs=169 size=103B + /25/29N (2|25|36): objs=1718 size=7.08KiB + /25/30S (2|25|36): objs=157 size=336B + /25/31N (2|25|36): objs=601 size=2.21KiB + /25/32S (2|25|36): objs=148 size=283B + /25/33N (2|25|36): objs=323 size=912B + /25/34S (2|25|36): objs=126 size=175B + /25/35N (2|25|36): objs=4133 size=18.3KiB + /26/0N (2|25|36): objs=39356 size=874.59KiB + /26/1N (2|25|36): objs=39494 size=949.14KiB + /26/2N (2|25|36): objs=36784 size=713.1KiB + /26/3N (2|25|36): objs=2099 size=8.99KiB + /26/4S (2|25|36): objs=162 size=329B + /26/5N (2|25|36): objs=3380 size=14.32KiB + /26/6S (2|25|36): objs=145 size=130B + /26/7N (2|25|36): objs=775 size=3KiB + /26/8S (2|25|36): objs=130 size=236B + /26/9N (2|25|36): objs=5601 size=27.89KiB + /26/10S (2|25|36): objs=157 size=219B + /26/11S (2|25|36): objs=166 size=144B + /26/12S (2|25|36): objs=160 size=338B + /26/13N (2|25|36): objs=634 size=2.28KiB + /26/14S (2|25|36): objs=145 size=189B + /26/15N (2|25|36): objs=599 size=2.13KiB + /26/16S (2|25|36): objs=155 size=154B + /26/17N (2|25|36): objs=4307 size=18.99KiB + /26/18S (2|25|36): objs=136 size=259B + /26/19N (2|25|36): objs=1700 size=6.92KiB + /26/20S (2|25|36): objs=160 size=245B + /26/21N (2|25|36): objs=2232 size=9.24KiB + /26/22S (2|25|36): objs=147 size=93B + /26/23N (2|25|36): objs=4178 size=19.71KiB + /26/24S (2|25|36): objs=148 size=322B + /26/25N (2|25|36): objs=453 size=1.45KiB + /26/26S (2|25|36): objs=159 size=114B + /26/27N (2|25|36): objs=948 size=3.57KiB + /26/28S (2|25|36): objs=149 size=88B + /26/29N (2|25|36): objs=1229 size=4.92KiB + /26/30S (2|25|36): objs=159 size=305B + /26/31N (2|25|36): objs=1548 size=6.3KiB + /26/32S (2|25|36): objs=145 size=160B + /26/33N (2|25|36): objs=1675 size=7.21KiB + /26/34S (2|25|36): objs=144 size=115B + /26/35N (2|25|36): objs=1382 size=5.64KiB + /27/0N (2|25|36): objs=41646 size=1.13MiB + /27/1N (2|25|36): objs=38639 size=802.69KiB + /27/2N (2|25|36): objs=34306 size=585.51KiB + /27/3S (2|25|36): objs=156 size=163B + /27/4N (2|25|36): objs=3517 size=16.95KiB + /27/5N (2|25|36): objs=292 size=727B + /27/6S (2|25|36): objs=170 size=287B + /27/7N (2|25|36): objs=6342 size=35.1KiB + /27/8S (2|25|36): objs=138 size=296B + /27/9N (2|25|36): objs=3075 size=13.21KiB + /27/10S (2|25|36): objs=166 size=343B + /27/11N (2|25|36): objs=3347 size=14.96KiB + /27/12S (2|25|36): objs=148 size=245B + /27/13N (2|25|36): objs=4456 size=20.63KiB + /27/14S (2|25|36): objs=144 size=245B + /27/15N (2|25|36): objs=3473 size=14.93KiB + /27/16S (2|25|36): objs=151 size=183B + /27/17N (2|25|36): objs=1071 size=4.16KiB + /27/18S (2|25|36): objs=149 size=184B + /27/19N (2|25|36): objs=2849 size=12.2KiB + /27/20S (2|25|36): objs=137 size=103B + /27/21N (2|25|36): objs=3525 size=15.71KiB + /27/22S (2|25|36): objs=159 size=260B + /27/24S (2|25|36): objs=142 size=134B + /27/25N (2|25|36): objs=6097 size=27.55KiB + /27/26S (2|25|36): objs=142 size=134B + /27/27N (2|25|36): objs=1360 size=5.5KiB + /27/28S (2|25|36): objs=132 size=123B + /27/29N (2|25|36): objs=797 size=2.85KiB + /27/30S (2|25|36): objs=145 size=256B + /27/31N (2|25|36): objs=2121 size=8.92KiB + /27/32S (2|25|36): objs=159 size=260B + /27/33N (2|25|36): objs=1435 size=5.96KiB + /27/34S (2|25|36): objs=144 size=179B + /27/35N (2|25|36): objs=463 size=1.84KiB + /28/0N (2|25|36): objs=38233 size=891.57KiB + /28/1N (2|25|36): objs=38991 size=950.83KiB + /28/2N (2|25|36): objs=38542 size=750.2KiB + /28/3N (2|25|36): objs=14175 size=87.94KiB + /28/4S (2|25|36): objs=148 size=191B + /28/5N (2|25|36): objs=2306 size=9.81KiB + /28/6S (2|25|36): objs=133 size=128B + /28/7N (2|25|36): objs=4597 size=22.61KiB + /28/8S (2|25|36): objs=146 size=329B + /28/9N (2|25|36): objs=1599 size=6.64KiB + /28/10S (2|25|36): objs=140 size=307B + /28/11N (2|25|36): objs=423 size=1.49KiB + /28/12S (2|25|36): objs=157 size=256B + /28/13S (2|25|36): objs=169 size=233B + /28/14S (2|25|36): objs=152 size=259B + /28/15S (2|25|36): objs=166 size=194B + /28/16S (2|25|36): objs=144 size=310B + /28/18S (2|25|36): objs=155 size=169B + /28/19N (2|25|36): objs=2926 size=12.25KiB + /28/20S (2|25|36): objs=130 size=279B + /28/21N (2|25|36): objs=573 size=2.21KiB + /28/22S (2|25|36): objs=153 size=261B + /28/23N (2|25|36): objs=3594 size=15.64KiB + /28/24S (2|25|36): objs=149 size=233B + /28/25S (2|25|36): objs=161 size=115B + /28/26S (2|25|36): objs=152 size=229B + /28/27N (2|25|36): objs=1097 size=4.45KiB + /28/28S (2|25|36): objs=169 size=121B + /28/29N (2|25|36): objs=6546 size=31.76KiB + /28/30S (2|25|36): objs=130 size=271B + /28/31N (2|25|36): objs=2674 size=12.67KiB + /28/32S (2|25|36): objs=168 size=218B + /28/33N (2|25|36): objs=1402 size=5.65KiB + /28/34S (2|25|36): objs=160 size=343B + /28/35N (2|25|36): objs=1528 size=6.15KiB + /29/0N (2|25|36): objs=40751 size=1.09MiB + /29/1N (2|25|36): objs=38569 size=867.67KiB + /29/2N (2|25|36): objs=41715 size=881.7KiB + /29/3N (2|25|36): objs=11302 size=63.18KiB + /29/4S (2|25|36): objs=154 size=206B + /29/5N (2|25|36): objs=1970 size=8.27KiB + /29/6S (2|25|36): objs=145 size=311B + /29/7N (2|25|36): objs=4410 size=20.68KiB + /29/8S (2|25|36): objs=143 size=297B + /29/9N (2|25|36): objs=939 size=3.42KiB + /29/10S (2|25|36): objs=147 size=149B + /29/11N (2|25|36): objs=1089 size=4.36KiB + /29/12S (2|25|36): objs=153 size=102B + /29/13N (2|25|36): objs=3544 size=15.53KiB + /29/14S (2|25|36): objs=131 size=286B + /29/15N (2|25|36): objs=970 size=3.75KiB + /29/16S (2|25|36): objs=158 size=105B + /29/17S (2|25|36): objs=144 size=314B + /29/18S (2|25|36): objs=137 size=136B + /29/19N (2|25|36): objs=788 size=2.84KiB + /29/20S (2|25|36): objs=153 size=274B + /29/21N (2|25|36): objs=2029 size=8.93KiB + /29/22S (2|25|36): objs=162 size=198B + /29/23N (2|25|36): objs=2756 size=12.67KiB + /29/24S (2|25|36): objs=169 size=330B + /29/25N (2|25|36): objs=2580 size=11.04KiB + /29/26S (2|25|36): objs=133 size=154B + /29/27N (2|25|36): objs=924 size=3.46KiB + /29/28S (2|25|36): objs=142 size=207B + /29/29S (2|25|36): objs=138 size=303B + /29/30S (2|25|36): objs=145 size=193B + /29/31N (2|25|36): objs=471 size=1.46KiB + /29/32S (2|25|36): objs=147 size=210B + /29/33N (2|25|36): objs=1930 size=8.26KiB + /29/34S (2|25|36): objs=172 size=300B + /29/35S (2|25|36): objs=166 size=255B + /30/0N (2|25|36): objs=34873 size=700.87KiB + /30/1N (2|25|36): objs=38705 size=821.99KiB + /30/2N (2|25|36): objs=40653 size=987.57KiB + /30/4S (2|25|36): objs=167 size=355B + /30/5S (2|25|36): objs=176 size=296B + /30/6S (2|25|36): objs=165 size=157B + /30/7N (2|25|36): objs=5930 size=25.1KiB + /30/8S (2|25|36): objs=143 size=300B + /30/9N (2|25|36): objs=469 size=1.62KiB + /30/10S (2|25|36): objs=135 size=139B + /30/11N (2|25|36): objs=1550 size=6.28KiB + /30/12S (2|25|36): objs=162 size=272B + /30/13N (2|25|36): objs=734 size=2.83KiB + /30/14S (2|25|36): objs=170 size=320B + /30/15N (2|25|36): objs=597 size=2.15KiB + /30/16S (2|25|36): objs=156 size=132B + /30/17N (2|25|36): objs=4546 size=20.14KiB + /30/18S (2|25|36): objs=154 size=113B + /30/19N (2|25|36): objs=295 size=1.05KiB + /30/20S (2|25|36): objs=149 size=200B + /30/21N (2|25|36): objs=747 size=2.81KiB + /30/22S (2|25|36): objs=141 size=110B + /30/23N (2|25|36): objs=1041 size=4.01KiB + /30/24S (2|25|36): objs=183 size=111B + /30/25N (2|25|36): objs=598 size=2.26KiB + /30/26S (2|25|36): objs=161 size=206B + /30/27N (2|25|36): objs=3862 size=18.75KiB + /30/28S (2|25|36): objs=138 size=153B + /30/29N (2|25|36): objs=2123 size=9.79KiB + /30/30S (2|25|36): objs=174 size=237B + /30/31N (2|25|36): objs=1226 size=4.84KiB + /30/32S (2|25|36): objs=140 size=133B + /30/33N (2|25|36): objs=5477 size=26.22KiB + /30/34S (2|25|36): objs=156 size=254B + /30/35N (2|25|36): objs=4668 size=20.83KiB + /31/0N (2|25|36): objs=36826 size=816.28KiB + /31/1N (2|25|36): objs=38544 size=809.86KiB + /31/2N (2|25|36): objs=35172 size=682.34KiB + /31/3S (2|25|36): objs=160 size=130B + /31/4N (2|25|36): objs=777 size=2.97KiB + /31/5N (2|25|36): objs=1883 size=7.81KiB + /31/6S (2|25|36): objs=162 size=284B + /31/7S (2|25|36): objs=156 size=256B + /31/8S (2|25|36): objs=149 size=134B + /31/9N (2|25|36): objs=7114 size=35.05KiB + /31/10S (2|25|36): objs=132 size=91B + /31/11N (2|25|36): objs=4529 size=19.61KiB + /31/12S (2|25|36): objs=155 size=162B + /31/13N (2|25|36): objs=3549 size=15.43KiB + /31/14S (2|25|36): objs=131 size=270B + /31/15N (2|25|36): objs=4208 size=21.37KiB + /31/16S (2|25|36): objs=157 size=96B + /31/17N (2|25|36): objs=2020 size=8.36KiB + /31/18S (2|25|36): objs=154 size=131B + /31/19N (2|25|36): objs=895 size=3.37KiB + /31/20S (2|25|36): objs=151 size=314B + /31/21N (2|25|36): objs=6627 size=31.67KiB + /31/22S (2|25|36): objs=168 size=297B + /31/23N (2|25|36): objs=1549 size=6.28KiB + /31/24S (2|25|36): objs=155 size=185B + /31/25N (2|25|36): objs=1527 size=6.06KiB + /31/26S (2|25|36): objs=139 size=182B + /31/27S (2|25|36): objs=153 size=222B + /31/28S (2|25|36): objs=141 size=310B + /31/29N (2|25|36): objs=309 size=1013B + /31/30S (2|25|36): objs=154 size=335B + /31/31N (2|25|36): objs=3065 size=13.45KiB + /31/32S (2|25|36): objs=137 size=289B + /31/33N (2|25|36): objs=480 size=1.65KiB + /31/34S (2|25|36): objs=154 size=173B + /31/35N (2|25|36): objs=968 size=3.79KiB + +com.milaboratory.util.sorting.HashSorterTest > test2 SKIPPED + +com.milaboratory.util.VersionInfoTest > test3 SKIPPED + +com.milaboratory.util.ByteStringTest > testSpeed1 STANDARD_OUT + Time per hash: 656ns + Addition to hash set (per operation): 2.63us + Hash set removal (per operation): 970ns + b + +com.milaboratory.util.JsonOverriderTest > test1 STANDARD_OUT + WARNING: unnecessary override -Ob= with the same value. + +com.milaboratory.util.CacheTest > test1 STANDARD_OUT + Cache misses:400 + Cache hits:800 + +com.milaboratory.primitivio.blocks.PrimitivOBlocksTest > benchmark1 SKIPPED + +com.milaboratory.primitivio.blocks.PrimitivOBlocksTest > test1 STANDARD_OUT + + ================== + High compression: false + Concurrency: 4 + File size: 6799510 + Write time: 690.28ms + + O. Stats: + Wall clock time: 692.09ms + Total CPU time: 924.22ms + User wait time: 564.83ms + Serialization time: 523.1ms (56.6%) + Checksum calculation time: 105.35ms (11.4%) + Compression time: 134.27ms (14.53%) + Total IO delay: 273.33ms + Concurrency overhead: 272.17ms + Uncompressed size: 18.44MiB (~2.08KiB per object) + Output size: 6.48MiB (~748B per object; compression = 35.17%) + IO speed: 23.75MiB/s + Concurrency adjusted uncompressed speed: 32.29MiB/s + Actual uncompressed speed: 26.64MiB/s + Actual speed: 9.37MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 748B + Blocks: 62 (~107.1KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + + I. Stats 1: + Wall clock time: 345.09ms + Total CPU time: 326.99ms + Serialization time: 170.26ms (52.07%) + Checksum calculation time: 74.68ms (22.84%) + Compression time: 75.9ms (23.21%) + Total IO delay: 160.14ms + Input size: 6.48MiB + Decompressed size: 18.44MiB (compression = 35.17%) + IO speed: 40.53MiB/s + Concurrency adjusted uncompressed speed: 152.37MiB/s + Actual uncompressed speed: 53.44MiB/s + Actual speed: 18.8MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 748B + Blocks: 62 (~107.1KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + + I. Stats 2: + Wall clock time: 816.94ms + Total CPU time: 643.52ms + Serialization time: 266.78ms (41.46%) + Checksum calculation time: 181.97ms (28.28%) + Compression time: 182.25ms (28.32%) + Total IO delay: 304.14ms + Input size: 12.97MiB + Decompressed size: 36.87MiB (compression = 35.17%) + IO speed: 42.66MiB/s + Concurrency adjusted uncompressed speed: 156.25MiB/s + Actual uncompressed speed: 45.19MiB/s + Actual speed: 15.89MiB/s + Objects: 18158 + Average object size uncompressed: 2.08KiB + Average object size compressed: 748B + Blocks: 124 (~107.1KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + + ================== + High compression: false + Concurrency: 4 + File size: 6791878 + Write time: 861.29ms + + O. Stats: + Wall clock time: 862.67ms + Total CPU time: 254.4ms + User wait time: 678.13ms + Serialization time: 102.72ms (40.38%) + Checksum calculation time: 71.97ms (28.29%) + Compression time: 76.13ms (29.93%) + Total IO delay: 560.93ms + Concurrency overhead: 12.83ms + Uncompressed size: 18.44MiB (~2.08KiB per object) + Output size: 6.48MiB (~748B per object; compression = 35.13%) + IO speed: 11.57MiB/s + Concurrency adjusted uncompressed speed: 85.36MiB/s + Actual uncompressed speed: 21.39MiB/s + Actual speed: 7.51MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 748B + Blocks: 20 (~331.63KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + + I. Stats 1: + Wall clock time: 295.46ms + Total CPU time: 300.62ms + Serialization time: 99.1ms (32.97%) + Checksum calculation time: 98.77ms (32.86%) + Compression time: 101.82ms (33.87%) + Total IO delay: 69.31ms + Input size: 6.48MiB + Decompressed size: 18.44MiB (compression = 35.13%) + IO speed: 93.87MiB/s + Concurrency adjusted uncompressed speed: 200.4MiB/s + Actual uncompressed speed: 62.5MiB/s + Actual speed: 21.96MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 748B + Blocks: 20 (~331.63KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + + I. Stats 2: + Wall clock time: 603.56ms + Total CPU time: 564.65ms + Serialization time: 180.63ms (31.99%) + Checksum calculation time: 195.75ms (34.67%) + Compression time: 186.68ms (33.06%) + Total IO delay: 121.92ms + Input size: 12.95MiB + Decompressed size: 36.87MiB (compression = 35.13%) + IO speed: 107.06MiB/s + Concurrency adjusted uncompressed speed: 215.64MiB/s + Actual uncompressed speed: 61.15MiB/s + Actual speed: 21.48MiB/s + Objects: 18158 + Average object size uncompressed: 2.08KiB + Average object size compressed: 748B + Blocks: 40 (~331.63KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + + ================== + High compression: false + Concurrency: 1 + File size: 6799510 + Write time: 418.29ms + + O. Stats: + Wall clock time: 420.7ms + Total CPU time: 232.36ms + User wait time: 385.65ms + Serialization time: 89.35ms (38.45%) + Checksum calculation time: 59.1ms (25.43%) + Compression time: 78.41ms (33.74%) + Total IO delay: 122.93ms + Concurrency overhead: 23.97ms + Uncompressed size: 18.44MiB (~2.08KiB per object) + Output size: 6.48MiB (~748B per object; compression = 35.17%) + IO speed: 53.15MiB/s + Concurrency adjusted uncompressed speed: 48.65MiB/s + Actual uncompressed speed: 43.9MiB/s + Actual speed: 15.44MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 748B + Blocks: 62 (~107.1KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + Checksum ok! + + I. Stats 1: + Wall clock time: 202.62ms + Total CPU time: 199.69ms + Serialization time: 56.39ms (28.24%) + Checksum calculation time: 68.95ms (34.53%) + Compression time: 68.68ms (34.39%) + Total IO delay: 89.82ms + Input size: 6.48MiB + Decompressed size: 18.44MiB (compression = 35.17%) + IO speed: 72.86MiB/s + Concurrency adjusted uncompressed speed: 63.8MiB/s + Actual uncompressed speed: 91.27MiB/s + Actual speed: 32.1MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 748B + Blocks: 62 (~107.1KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + + I. Stats 2: + Wall clock time: 479.68ms + Total CPU time: 388.08ms + Serialization time: 111.2ms (28.65%) + Checksum calculation time: 131.68ms (33.93%) + Compression time: 133.02ms (34.28%) + Total IO delay: 225.81ms + Input size: 12.97MiB + Decompressed size: 36.87MiB (compression = 35.17%) + IO speed: 57.64MiB/s + Concurrency adjusted uncompressed speed: 60.15MiB/s + Actual uncompressed speed: 76.98MiB/s + Actual speed: 27.08MiB/s + Objects: 18158 + Average object size uncompressed: 2.08KiB + Average object size compressed: 748B + Blocks: 124 (~107.1KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + + ================== + High compression: false + Concurrency: 1 + File size: 6791878 + Write time: 361.49ms + + O. Stats: + Wall clock time: 363.29ms + Total CPU time: 218.29ms + User wait time: 313.09ms + Serialization time: 83.71ms (38.35%) + Checksum calculation time: 61.87ms (28.34%) + Compression time: 68.81ms (31.52%) + Total IO delay: 68.76ms + Concurrency overhead: 11.61ms + Uncompressed size: 18.44MiB (~2.08KiB per object) + Output size: 6.48MiB (~748B per object; compression = 35.13%) + IO speed: 95.25MiB/s + Concurrency adjusted uncompressed speed: 61.87MiB/s + Actual uncompressed speed: 50.79MiB/s + Actual speed: 17.84MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 748B + Blocks: 20 (~331.63KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + Checksum ok! + + I. Stats 1: + Wall clock time: 288.66ms + Total CPU time: 290.89ms + Serialization time: 107.78ms (37.05%) + Checksum calculation time: 80.67ms (27.73%) + Compression time: 101.76ms (34.98%) + Total IO delay: 61.74ms + Input size: 6.48MiB + Decompressed size: 18.44MiB (compression = 35.13%) + IO speed: 106.18MiB/s + Concurrency adjusted uncompressed speed: 52.38MiB/s + Actual uncompressed speed: 64.02MiB/s + Actual speed: 22.49MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 748B + Blocks: 20 (~331.63KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + + I. Stats 2: + Wall clock time: 547.52ms + Total CPU time: 501.56ms + Serialization time: 168.73ms (33.64%) + Checksum calculation time: 145.66ms (29.04%) + Compression time: 185.73ms (37.03%) + Total IO delay: 123.89ms + Input size: 12.95MiB + Decompressed size: 36.87MiB (compression = 35.13%) + IO speed: 105.32MiB/s + Concurrency adjusted uncompressed speed: 59MiB/s + Actual uncompressed speed: 67.41MiB/s + Actual speed: 23.68MiB/s + Objects: 18158 + Average object size uncompressed: 2.08KiB + Average object size compressed: 748B + Blocks: 40 (~331.63KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + Pending / IO / Serde: 2 / 0 / 1 + Pending / IO / Serde: 1 / 0 / 3 + + ================== + High compression: true + Concurrency: 4 + File size: 4156299 + Write time: 5.33s + + O. Stats: + Wall clock time: 5.33s + Total CPU time: 14.12s + User wait time: 5.02s + Serialization time: 79.4ms (0.56%) + Checksum calculation time: 63.18ms (0.45%) + Compression time: 13.97s (98.89%) + Total IO delay: 170.85ms + Concurrency overhead: 99.55ms + Uncompressed size: 18.44MiB (~2.08KiB per object) + Output size: 3.96MiB (~457B per object; compression = 21.5%) + IO speed: 23.32MiB/s + Concurrency adjusted uncompressed speed: 5.02MiB/s + Actual uncompressed speed: 3.46MiB/s + Actual speed: 762.09KiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 457B + Blocks: 62 (~65.47KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + + I. Stats 1: + Wall clock time: 194.41ms + Total CPU time: 173.9ms + Serialization time: 55.86ms (32.12%) + Checksum calculation time: 56.87ms (32.7%) + Compression time: 56.42ms (32.44%) + Total IO delay: 107.86ms + Input size: 3.96MiB + Decompressed size: 18.44MiB (compression = 21.5%) + IO speed: 37.04MiB/s + Concurrency adjusted uncompressed speed: 263.38MiB/s + Actual uncompressed speed: 95.04MiB/s + Actual speed: 20.43MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 457B + Blocks: 62 (~65.47KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + + I. Stats 2: + Wall clock time: 464.24ms + Total CPU time: 366.62ms + Serialization time: 122.38ms (33.38%) + Checksum calculation time: 125.13ms (34.13%) + Compression time: 109.33ms (29.82%) + Total IO delay: 246.39ms + Input size: 7.93MiB + Decompressed size: 36.87MiB (compression = 21.5%) + IO speed: 32.23MiB/s + Concurrency adjusted uncompressed speed: 241.01MiB/s + Actual uncompressed speed: 79.47MiB/s + Actual speed: 17.09MiB/s + Objects: 18158 + Average object size uncompressed: 2.08KiB + Average object size compressed: 457B + Blocks: 124 (~65.47KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + Pending / IO / Serde: 2 / 0 / 2 + Pending / IO / Serde: 2 / 0 / 2 + Pending / IO / Serde: 3 / 0 / 1 + + ================== + High compression: true + Concurrency: 4 + File size: 4098671 + Write time: 6.84s + + O. Stats: + Wall clock time: 6.84s + Total CPU time: 11.42s + User wait time: 6.13s + Serialization time: 83.81ms (0.73%) + Checksum calculation time: 79.22ms (0.69%) + Compression time: 11.25s (98.54%) + Total IO delay: 76.15ms + Concurrency overhead: 11.65ms + Uncompressed size: 18.44MiB (~2.08KiB per object) + Output size: 3.91MiB (~451B per object; compression = 21.2%) + IO speed: 51.43MiB/s + Concurrency adjusted uncompressed speed: 6.39MiB/s + Actual uncompressed speed: 2.7MiB/s + Actual speed: 585.35KiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 451B + Blocks: 20 (~200.13KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + + I. Stats 1: + Wall clock time: 178.29ms + Total CPU time: 160.55ms + Serialization time: 43.81ms (27.28%) + Checksum calculation time: 62.14ms (38.7%) + Compression time: 53.87ms (33.55%) + Total IO delay: 21.73ms + Input size: 3.91MiB + Decompressed size: 18.44MiB (compression = 21.2%) + IO speed: 186.13MiB/s + Concurrency adjusted uncompressed speed: 409.71MiB/s + Actual uncompressed speed: 103.58MiB/s + Actual speed: 21.96MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 451B + Blocks: 20 (~200.13KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + + I. Stats 2: + Wall clock time: 440.49ms + Total CPU time: 344.74ms + Serialization time: 93.19ms (27.03%) + Checksum calculation time: 134.44ms (39%) + Compression time: 115.8ms (33.59%) + Total IO delay: 54.29ms + Input size: 7.82MiB + Decompressed size: 36.87MiB (compression = 21.2%) + IO speed: 144.77MiB/s + Concurrency adjusted uncompressed speed: 372.46MiB/s + Actual uncompressed speed: 83.8MiB/s + Actual speed: 17.77MiB/s + Objects: 18158 + Average object size uncompressed: 2.08KiB + Average object size compressed: 451B + Blocks: 40 (~200.13KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + Pending / IO / Serde: 0 / 0 / 1 + Pending / IO / Serde: 0 / 0 / 1 + Pending / IO / Serde: 0 / 0 / 1 + Pending / IO / Serde: 0 / 0 / 1 + Pending / IO / Serde: 0 / 0 / 0 + + ================== + High compression: true + Concurrency: 1 + File size: 4156299 + Write time: 9.95s + + O. Stats: + Wall clock time: 9.95s + Total CPU time: 9.78s + User wait time: 9.92s + Serialization time: 85.54ms (0.87%) + Checksum calculation time: 58.07ms (0.59%) + Compression time: 9.62s (98.4%) + Total IO delay: 127.4ms + Concurrency overhead: 14.05ms + Uncompressed size: 18.44MiB (~2.08KiB per object) + Output size: 3.96MiB (~457B per object; compression = 21.5%) + IO speed: 31.21MiB/s + Concurrency adjusted uncompressed speed: 1.86MiB/s + Actual uncompressed speed: 1.85MiB/s + Actual speed: 407.76KiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 457B + Blocks: 62 (~65.47KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + Checksum ok! + + I. Stats 1: + Wall clock time: 202.27ms + Total CPU time: 208.59ms + Serialization time: 74.56ms (35.74%) + Checksum calculation time: 66.95ms (32.1%) + Compression time: 64.36ms (30.86%) + Total IO delay: 58.59ms + Input size: 3.96MiB + Decompressed size: 18.44MiB (compression = 21.5%) + IO speed: 68.34MiB/s + Concurrency adjusted uncompressed speed: 69.05MiB/s + Actual uncompressed speed: 91.27MiB/s + Actual speed: 19.62MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 457B + Blocks: 62 (~65.47KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + + I. Stats 2: + Wall clock time: 430.6ms + Total CPU time: 387.22ms + Serialization time: 129.72ms (33.5%) + Checksum calculation time: 131.92ms (34.07%) + Compression time: 118.01ms (30.48%) + Total IO delay: 130.85ms + Input size: 7.93MiB + Decompressed size: 36.87MiB (compression = 21.5%) + IO speed: 60.98MiB/s + Concurrency adjusted uncompressed speed: 71.18MiB/s + Actual uncompressed speed: 85.75MiB/s + Actual speed: 18.44MiB/s + Objects: 18158 + Average object size uncompressed: 2.08KiB + Average object size compressed: 457B + Blocks: 124 (~65.47KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + Pending / IO / Serde: 0 / 0 / 1 + Pending / IO / Serde: 0 / 0 / 1 + Pending / IO / Serde: 0 / 0 / 1 + Pending / IO / Serde: 0 / 0 / 1 + Pending / IO / Serde: 0 / 0 / 1 + + ================== + High compression: true + Concurrency: 1 + File size: 4098671 + Write time: 10.48s + + O. Stats: + Wall clock time: 10.48s + Total CPU time: 10.39s + User wait time: 10.44s + Serialization time: 78.3ms (0.75%) + Checksum calculation time: 58.52ms (0.56%) + Compression time: 10.25s (98.64%) + Total IO delay: 38.37ms + Concurrency overhead: 3.14ms + Uncompressed size: 18.44MiB (~2.08KiB per object) + Output size: 3.91MiB (~451B per object; compression = 21.2%) + IO speed: 102.86MiB/s + Concurrency adjusted uncompressed speed: 1.77MiB/s + Actual uncompressed speed: 1.76MiB/s + Actual speed: 381.82KiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 451B + Blocks: 20 (~200.13KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + Checksum ok! + + I. Stats 1: + Wall clock time: 189.88ms + Total CPU time: 189.53ms + Serialization time: 54.35ms (28.68%) + Checksum calculation time: 74.87ms (39.5%) + Compression time: 59.35ms (31.32%) + Total IO delay: 25.36ms + Input size: 3.91MiB + Decompressed size: 18.44MiB (compression = 21.2%) + IO speed: 156.35MiB/s + Concurrency adjusted uncompressed speed: 86.15MiB/s + Actual uncompressed speed: 97.55MiB/s + Actual speed: 20.68MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 451B + Blocks: 20 (~200.13KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + + I. Stats 2: + Wall clock time: 432.66ms + Total CPU time: 380.61ms + Serialization time: 106.27ms (27.92%) + Checksum calculation time: 149.03ms (39.15%) + Compression time: 123.5ms (32.45%) + Total IO delay: 61.58ms + Input size: 7.82MiB + Decompressed size: 36.87MiB (compression = 21.2%) + IO speed: 128.16MiB/s + Concurrency adjusted uncompressed speed: 83.42MiB/s + Actual uncompressed speed: 85.36MiB/s + Actual speed: 18.1MiB/s + Objects: 18158 + Average object size uncompressed: 2.08KiB + Average object size compressed: 451B + Blocks: 40 (~200.13KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + +com.milaboratory.primitivio.blocks.PrimitivOBlocksTest > bigBlocks STANDARD_OUT + Pending / IO / Serde / Objs: 0 / 1 / 1 / 1000 + Pending / IO / Serde / Objs: 0 / 1 / 2 / 2000 + Pending / IO / Serde / Objs: 1 / 1 / 1 / 6000 + Pending / IO / Serde / Objs: 4 / 1 / 1 / 9000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 12000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 13000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 13000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 13000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 13000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 13000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 13000 + Pending / IO / Serde / Objs: 6 / 1 / 1 / 13000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 14000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 14000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 14000 + Pending / IO / Serde / Objs: 6 / 1 / 1 / 14000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 15000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 16000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 16000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 16000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 17000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 17000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 18000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 18000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 18000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 19000 + Gradle is still running, please be patient... + Pending / IO / Serde / Objs: 7 / 1 / 0 / 19000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 19000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 19000 + Pending / IO / Serde / Objs: 6 / 1 / 1 / 19000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 20000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 20000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 20000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 20000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 20000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 20000 + Pending / IO / Serde / Objs: 7 / 1 / 0 / 20000 + Pending / IO / Serde / Objs: 6 / 1 / 0 / 20000 + Pending / IO / Serde / Objs: 6 / 1 / 0 / 20000 + Pending / IO / Serde / Objs: 5 / 1 / 0 / 20000 + Pending / IO / Serde / Objs: 5 / 1 / 0 / 20000 + Pending / IO / Serde / Objs: 4 / 1 / 0 / 20000 + Pending / IO / Serde / Objs: 3 / 1 / 0 / 20000 + Pending / IO / Serde / Objs: 3 / 1 / 0 / 20000 + Pending / IO / Serde / Objs: 2 / 1 / 0 / 20000 + Pending / IO / Serde / Objs: 2 / 1 / 0 / 20000 + O. Stats: + Wall clock time: 1.55m + Total CPU time: 14.68s + User wait time: 51.53s + Serialization time: 2.27s (15.46%) + Checksum calculation time: 7.16s (48.77%) + Compression time: 2.01s (13.7%) + Total IO delay: 1.51m + Concurrency overhead: 12.83ms + Uncompressed size: 1.86GiB (~97.66KiB per object) + Output size: 1.86GiB (~97.66KiB per object; compression = 100%) + IO speed: 21MiB/s + Concurrency adjusted uncompressed speed: 144.46MiB/s + Actual uncompressed speed: 20.49MiB/s + Actual speed: 20.49MiB/s + Objects: 20000 + Average object size uncompressed: 97.66KiB + Average object size compressed: 97.66KiB + Blocks: 20 (~95.37MiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + +com.milaboratory.test.TestUtil > testLT STANDARD_OUT + Short tests. + No system env properties. WARNING: A terminally deprecated method in java.lang.System has been called WARNING: System::setSecurityManager has been called by org.gradle.api.internal.tasks.testing.worker.TestWorker (file:/usr/share/gradle/lib/plugins/gradle-testing-base-4.4.1.jar) +Gradle Test Executor 1 finished executing tests. WARNING: Please consider reporting this to the maintainers of org.gradle.api.internal.tasks.testing.worker.TestWorker WARNING: System::setSecurityManager will be removed in a future release -Finished generating test XML results (0.585 secs) into: /build/reproducible-path/milib-2.2.0+dfsg/build/test-results/test +Finished generating test XML results (0.704 secs) into: /build/reproducible-path/milib-2.2.0+dfsg/build/test-results/test Generating HTML test report... -Finished generating test html results (0.979 secs) into: /build/reproducible-path/milib-2.2.0+dfsg/build/reports/tests/test -:test (Thread[Task worker for ':',5,main]) completed. Took 23 mins 2.449 secs. +Finished generating test html results (0.743 secs) into: /build/reproducible-path/milib-2.2.0+dfsg/build/reports/tests/test +:test (Thread[Task worker for ':',5,main]) completed. Took 10 mins 7.293 secs. -BUILD SUCCESSFUL in 25m 14s +BUILD SUCCESSFUL in 11m 0s 5 actionable tasks: 3 executed, 2 up-to-date create-stamp debian/debhelper-build-stamp dh_prep @@ -5009,12 +5039,14 @@ dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: including full source code in upload I: copying local configuration +I: user script /srv/workspace/pbuilder/22285/tmp/hooks/B01_cleanup starting +I: user script /srv/workspace/pbuilder/22285/tmp/hooks/B01_cleanup finished I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env -I: removing directory /srv/workspace/pbuilder/31058 and its subdirectories -I: Current time: Fri May 17 08:31:39 -12 2024 -I: pbuilder-time-stamp: 1715977899 +I: removing directory /srv/workspace/pbuilder/22285 and its subdirectories +I: Current time: Sat May 18 10:52:17 +14 2024 +I: pbuilder-time-stamp: 1715979137