Diff of the two buildlogs: -- --- b1/build.log 2025-01-07 20:05:31.273713092 +0000 +++ b2/build.log 2025-01-07 20:10:16.500683280 +0000 @@ -1,6 +1,6 @@ I: pbuilder: network access will be disabled during build -I: Current time: Tue Jan 7 08:02:37 -12 2025 -I: pbuilder-time-stamp: 1736280157 +I: Current time: Tue Feb 10 16:28:34 +14 2026 +I: pbuilder-time-stamp: 1770690514 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/trixie-reproducible-base.tgz] I: copying local configuration @@ -28,52 +28,84 @@ dpkg-source: info: applying python3.12-syntax.patch I: Not using root during the build. I: Installing the build-deps -I: user script /srv/workspace/pbuilder/2555588/tmp/hooks/D02_print_environment starting +I: user script /srv/workspace/pbuilder/3391732/tmp/hooks/D01_modify_environment starting +debug: Running on codethink01-arm64. +I: Changing host+domainname to test build reproducibility +I: Adding a custom variable just for the fun of it... +I: Changing /bin/sh to bash +'/bin/sh' -> '/bin/bash' +lrwxrwxrwx 1 root root 9 Feb 10 02:28 /bin/sh -> /bin/bash +I: Setting pbuilder2's login shell to /bin/bash +I: Setting pbuilder2's GECOS to second user,second room,second work-phone,second home-phone,second other +I: user script /srv/workspace/pbuilder/3391732/tmp/hooks/D01_modify_environment finished +I: user script /srv/workspace/pbuilder/3391732/tmp/hooks/D02_print_environment starting I: set - BUILDDIR='/build/reproducible-path' - BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' - BUILDUSERNAME='pbuilder1' - BUILD_ARCH='arm64' - DEBIAN_FRONTEND='noninteractive' + BASH=/bin/sh + BASHOPTS=checkwinsize:cmdhist:complete_fullquote:extquote:force_fignore:globasciiranges:globskipdots:hostcomplete:interactive_comments:patsub_replacement:progcomp:promptvars:sourcepath + BASH_ALIASES=() + BASH_ARGC=() + BASH_ARGV=() + BASH_CMDS=() + BASH_LINENO=([0]="12" [1]="0") + BASH_LOADABLES_PATH=/usr/local/lib/bash:/usr/lib/bash:/opt/local/lib/bash:/usr/pkg/lib/bash:/opt/pkg/lib/bash:. + BASH_SOURCE=([0]="/tmp/hooks/D02_print_environment" [1]="/tmp/hooks/D02_print_environment") + BASH_VERSINFO=([0]="5" [1]="2" [2]="37" [3]="1" [4]="release" [5]="aarch64-unknown-linux-gnu") + BASH_VERSION='5.2.37(1)-release' + BUILDDIR=/build/reproducible-path + BUILDUSERGECOS='second user,second room,second work-phone,second home-phone,second other' + BUILDUSERNAME=pbuilder2 + BUILD_ARCH=arm64 + DEBIAN_FRONTEND=noninteractive DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=12 ' - DISTRIBUTION='trixie' - HOME='/root' - HOST_ARCH='arm64' + DIRSTACK=() + DISTRIBUTION=trixie + EUID=0 + FUNCNAME=([0]="Echo" [1]="main") + GROUPS=() + HOME=/root + HOSTNAME=i-capture-the-hostname + HOSTTYPE=aarch64 + HOST_ARCH=arm64 IFS=' ' - INVOCATION_ID='600936a513ea42ef8ec1c55fe43be5a1' - LANG='C' - LANGUAGE='en_US:en' - LC_ALL='C' - MAIL='/var/mail/root' - OPTIND='1' - PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' - PBCURRENTCOMMANDLINEOPERATION='build' - PBUILDER_OPERATION='build' - PBUILDER_PKGDATADIR='/usr/share/pbuilder' - PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' - PBUILDER_SYSCONFDIR='/etc' - PPID='2555588' - PS1='# ' - PS2='> ' + INVOCATION_ID=60b9f615ff904fcd9b0bc84074dcce03 + LANG=C + LANGUAGE=nl_BE:nl + LC_ALL=C + MACHTYPE=aarch64-unknown-linux-gnu + MAIL=/var/mail/root + OPTERR=1 + OPTIND=1 + OSTYPE=linux-gnu + PATH=/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path + PBCURRENTCOMMANDLINEOPERATION=build + PBUILDER_OPERATION=build + PBUILDER_PKGDATADIR=/usr/share/pbuilder + PBUILDER_PKGLIBDIR=/usr/lib/pbuilder + PBUILDER_SYSCONFDIR=/etc + PIPESTATUS=([0]="0") + POSIXLY_CORRECT=y + PPID=3391732 PS4='+ ' - PWD='/' - SHELL='/bin/bash' - SHLVL='2' - SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.H9BwPwEq/pbuilderrc_Fc48 --distribution trixie --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.H9BwPwEq/b1 --logfile b1/build.log presto_0.7.2-2.dsc' - SUDO_GID='109' - SUDO_UID='104' - SUDO_USER='jenkins' - TERM='unknown' - TZ='/usr/share/zoneinfo/Etc/GMT+12' - USER='root' - _='/usr/bin/systemd-run' - http_proxy='http://192.168.101.4:3128' + PWD=/ + SHELL=/bin/bash + SHELLOPTS=braceexpand:errexit:hashall:interactive-comments:posix + SHLVL=3 + SUDO_COMMAND='/usr/bin/timeout -k 24.1h 24h /usr/bin/ionice -c 3 /usr/bin/nice -n 11 /usr/bin/unshare --uts -- /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.H9BwPwEq/pbuilderrc_fjeL --distribution trixie --hookdir /etc/pbuilder/rebuild-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.H9BwPwEq/b2 --logfile b2/build.log presto_0.7.2-2.dsc' + SUDO_GID=109 + SUDO_UID=104 + SUDO_USER=jenkins + TERM=unknown + TZ=/usr/share/zoneinfo/Etc/GMT-14 + UID=0 + USER=root + _='I: set' + http_proxy=http://192.168.101.4:3128 I: uname -a - Linux codethink04-arm64 6.1.0-28-cloud-arm64 #1 SMP Debian 6.1.119-1 (2024-11-22) aarch64 GNU/Linux + Linux i-capture-the-hostname 6.1.0-28-cloud-arm64 #1 SMP Debian 6.1.119-1 (2024-11-22) aarch64 GNU/Linux I: ls -l /bin - lrwxrwxrwx 1 root root 7 Nov 22 14:40 /bin -> usr/bin -I: user script /srv/workspace/pbuilder/2555588/tmp/hooks/D02_print_environment finished + lrwxrwxrwx 1 root root 7 Nov 22 2024 /bin -> usr/bin +I: user script /srv/workspace/pbuilder/3391732/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy @@ -259,7 +291,7 @@ Get: 130 http://deb.debian.org/debian trixie/main arm64 python3-pandas all 2.2.3+dfsg-5 [3096 kB] Get: 131 http://deb.debian.org/debian trixie/main arm64 python3-scipy arm64 1.14.1-3 [18.5 MB] Get: 132 http://deb.debian.org/debian trixie/main arm64 vsearch arm64 2.29.1-1+b1 [410 kB] -Fetched 92.3 MB in 0s (185 MB/s) +Fetched 92.3 MB in 1s (135 MB/s) Preconfiguring packages ... Selecting previously unselected package libpython3.12-minimal:arm64. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20097 files and directories currently installed.) @@ -707,8 +739,8 @@ Setting up tzdata (2024b-4) ... Current default time zone: 'Etc/UTC' -Local time is now: Tue Jan 7 20:03:27 UTC 2025. -Universal Time is now: Tue Jan 7 20:03:27 UTC 2025. +Local time is now: Tue Feb 10 02:29:38 UTC 2026. +Universal Time is now: Tue Feb 10 02:29:38 UTC 2026. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up libpython3.13-minimal:arm64 (3.13.1-2) ... @@ -822,7 +854,11 @@ Building tag database... -> Finished parsing the build-deps I: Building the package -I: Running cd /build/reproducible-path/presto-0.7.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../presto_0.7.2-2_source.changes +I: user script /srv/workspace/pbuilder/3391732/tmp/hooks/A99_set_merged_usr starting +Not re-configuring usrmerge for trixie +I: user script /srv/workspace/pbuilder/3391732/tmp/hooks/A99_set_merged_usr finished +hostname: Name or service not known +I: Running cd /build/reproducible-path/presto-0.7.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-genchanges -S > ../presto_0.7.2-2_source.changes dpkg-buildpackage: info: source package presto dpkg-buildpackage: info: source version 0.7.2-2 dpkg-buildpackage: info: source distribution unstable @@ -1041,7 +1077,7 @@ {1: ['SEQ1', 'SEQ2', 'SEQ3'], 2: ['SEQ4', 'SEQ5']} ZERO_LENGTH> None -<- test_runCDHit() 0.022 +<- test_runCDHit() 0.051 -> test_runUClust() FULL_LENGTH> {1: ['SEQ1', 'SEQ2', 'SEQ3'], 2: ['SEQ4', 'SEQ5']} @@ -1049,7 +1085,7 @@ {1: ['SEQ1', 'SEQ2', 'SEQ3'], 2: ['SEQ4', 'SEQ5']} ZERO_LENGTH> None -<- test_runUClust() 0.024 +<- test_runUClust() 0.073 -> test_checkSeqEqual() DNA Equality> SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA @@ -1116,7 +1152,7 @@ OrderedDict({'ID': 'ERR346596.6', 'DESC': 'BS-DSFCONTROL04:4:000000000-A3F0Y:1:1101:13220:1649/1'}) <- test_convertSRAHeader() 0.000 -> test_calculateDistances() -<- test_calculateDistances() 0.002 +<- test_calculateDistances() 0.001 -> test_countMismatches() <- test_countMismatches() 0.001 -> test_initializeMismatchDictionary() @@ -1375,7 +1411,7 @@ GAPS> 0 ERROR> 1.000000 -<- test_localAlignment() 0.030 +<- test_localAlignment() 0.049 -> test_maskSeq() TEST CUT> ID> SEQ|PRIMER=A|BARCODE=CCA @@ -1465,7 +1501,7 @@ GAPS> 0 ERROR> 1.000000 -<- test_scoreAlignment() 0.007 +<- test_scoreAlignment() 0.015 -> test_calculateSetError() REF> CGGCGTAA 0.4347826086956522 REF> NNNNNNNN 1.0 @@ -1668,7 +1704,7 @@ test_deletionUnify (tests.test_UnifyHeaders.TestConvertHeaders.test_deletionUnify) ... ok ---------------------------------------------------------------------- -Ran 40 tests in 0.120s +Ran 40 tests in 0.238s OK (skipped=6) @@ -2026,7 +2062,7 @@ WEIGHT> 8 ERROR> 0.250000 -<- test_scoreSeqPair() 0.006 +<- test_scoreSeqPair() 0.014 -> test_weightDNA() DNA Weight> SEQ1> 8 @@ -2162,7 +2198,7 @@ {1: ['SEQ1', 'SEQ2', 'SEQ3'], 2: ['SEQ4', 'SEQ5']} ZERO_LENGTH> None -<- test_runCDHit() 0.038 +<- test_runCDHit() 0.058 -> test_runUClust() FULL_LENGTH> {1: ['SEQ1', 'SEQ2', 'SEQ3'], 2: ['SEQ4', 'SEQ5']} @@ -2170,7 +2206,7 @@ {1: ['SEQ1', 'SEQ2', 'SEQ3'], 2: ['SEQ4', 'SEQ5']} ZERO_LENGTH> None -<- test_runUClust() 0.026 +<- test_runUClust() 0.036 -> test_checkSeqEqual() DNA Equality> SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA @@ -2496,7 +2532,7 @@ GAPS> 0 ERROR> 1.000000 -<- test_localAlignment() 0.031 +<- test_localAlignment() 0.040 -> test_maskSeq() TEST CUT> ID> SEQ|PRIMER=A|BARCODE=CCA @@ -2586,7 +2622,7 @@ GAPS> 0 ERROR> 1.000000 -<- test_scoreAlignment() 0.008 +<- test_scoreAlignment() 0.018 -> test_calculateSetError() REF> CGGCGTAA 0.4347826086956522 REF> NNNNNNNN 1.0 @@ -2789,7 +2825,7 @@ test_deletionUnify (tests.test_UnifyHeaders.TestConvertHeaders.test_deletionUnify) ... ok ---------------------------------------------------------------------- -Ran 40 tests in 0.143s +Ran 40 tests in 0.194s OK (skipped=6) @@ -3147,7 +3183,7 @@ WEIGHT> 8 ERROR> 0.250000 -<- test_scoreSeqPair() 0.013 +<- test_scoreSeqPair() 0.006 -> test_weightDNA() DNA Weight> SEQ1> 8 @@ -3487,12 +3523,14 @@ dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration +I: user script /srv/workspace/pbuilder/3391732/tmp/hooks/B01_cleanup starting +I: user script /srv/workspace/pbuilder/3391732/tmp/hooks/B01_cleanup finished I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env -I: removing directory /srv/workspace/pbuilder/2555588 and its subdirectories -I: Current time: Tue Jan 7 08:05:30 -12 2025 -I: pbuilder-time-stamp: 1736280330 +I: removing directory /srv/workspace/pbuilder/3391732 and its subdirectories +I: Current time: Tue Feb 10 16:33:15 +14 2026 +I: pbuilder-time-stamp: 1770690795