Diff of the two buildlogs: -- --- b1/build.log 2024-04-28 11:59:13.576455903 +0000 +++ b2/build.log 2024-04-28 12:01:29.302676708 +0000 @@ -1,6 +1,6 @@ I: pbuilder: network access will be disabled during build -I: Current time: Sat Apr 27 23:56:45 -12 2024 -I: pbuilder-time-stamp: 1714305405 +I: Current time: Sun Jun 1 08:22:16 +14 2025 +I: pbuilder-time-stamp: 1748715736 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/trixie-reproducible-base.tgz] I: copying local configuration @@ -25,52 +25,84 @@ dpkg-source: info: unpacking presto_0.7.2-1.debian.tar.xz I: Not using root during the build. I: Installing the build-deps -I: user script /srv/workspace/pbuilder/2559778/tmp/hooks/D02_print_environment starting +I: user script /srv/workspace/pbuilder/1589516/tmp/hooks/D01_modify_environment starting +debug: Running on codethink01-arm64. +I: Changing host+domainname to test build reproducibility +I: Adding a custom variable just for the fun of it... +I: Changing /bin/sh to bash +'/bin/sh' -> '/bin/bash' +lrwxrwxrwx 1 root root 9 May 31 18:22 /bin/sh -> /bin/bash +I: Setting pbuilder2's login shell to /bin/bash +I: Setting pbuilder2's GECOS to second user,second room,second work-phone,second home-phone,second other +I: user script /srv/workspace/pbuilder/1589516/tmp/hooks/D01_modify_environment finished +I: user script /srv/workspace/pbuilder/1589516/tmp/hooks/D02_print_environment starting I: set - BUILDDIR='/build/reproducible-path' - BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' - BUILDUSERNAME='pbuilder1' - BUILD_ARCH='arm64' - DEBIAN_FRONTEND='noninteractive' + BASH=/bin/sh + BASHOPTS=checkwinsize:cmdhist:complete_fullquote:extquote:force_fignore:globasciiranges:globskipdots:hostcomplete:interactive_comments:patsub_replacement:progcomp:promptvars:sourcepath + BASH_ALIASES=() + BASH_ARGC=() + BASH_ARGV=() + BASH_CMDS=() + BASH_LINENO=([0]="12" [1]="0") + BASH_LOADABLES_PATH=/usr/local/lib/bash:/usr/lib/bash:/opt/local/lib/bash:/usr/pkg/lib/bash:/opt/pkg/lib/bash:. + BASH_SOURCE=([0]="/tmp/hooks/D02_print_environment" [1]="/tmp/hooks/D02_print_environment") + BASH_VERSINFO=([0]="5" [1]="2" [2]="21" [3]="1" [4]="release" [5]="aarch64-unknown-linux-gnu") + BASH_VERSION='5.2.21(1)-release' + BUILDDIR=/build/reproducible-path + BUILDUSERGECOS='second user,second room,second work-phone,second home-phone,second other' + BUILDUSERNAME=pbuilder2 + BUILD_ARCH=arm64 + DEBIAN_FRONTEND=noninteractive DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=12 ' - DISTRIBUTION='trixie' - HOME='/root' - HOST_ARCH='arm64' + DIRSTACK=() + DISTRIBUTION=trixie + EUID=0 + FUNCNAME=([0]="Echo" [1]="main") + GROUPS=() + HOME=/root + HOSTNAME=i-capture-the-hostname + HOSTTYPE=aarch64 + HOST_ARCH=arm64 IFS=' ' - INVOCATION_ID='195e18d08bdc49428360bbbacf18a720' - LANG='C' - LANGUAGE='en_US:en' - LC_ALL='C' - MAIL='/var/mail/root' - OPTIND='1' - PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' - PBCURRENTCOMMANDLINEOPERATION='build' - PBUILDER_OPERATION='build' - PBUILDER_PKGDATADIR='/usr/share/pbuilder' - PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' - PBUILDER_SYSCONFDIR='/etc' - PPID='2559778' - PS1='# ' - PS2='> ' + INVOCATION_ID=643ef8738f084e9d9cb4728ae5b6b5ec + LANG=C + LANGUAGE=nl_BE:nl + LC_ALL=C + MACHTYPE=aarch64-unknown-linux-gnu + MAIL=/var/mail/root + OPTERR=1 + OPTIND=1 + OSTYPE=linux-gnu + PATH=/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path + PBCURRENTCOMMANDLINEOPERATION=build + PBUILDER_OPERATION=build + PBUILDER_PKGDATADIR=/usr/share/pbuilder + PBUILDER_PKGLIBDIR=/usr/lib/pbuilder + PBUILDER_SYSCONFDIR=/etc + PIPESTATUS=([0]="0") + POSIXLY_CORRECT=y + PPID=1589516 PS4='+ ' - PWD='/' - SHELL='/bin/bash' - SHLVL='2' - SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.0tTUT605/pbuilderrc_T3Sn --distribution trixie --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.0tTUT605/b1 --logfile b1/build.log presto_0.7.2-1.dsc' - SUDO_GID='109' - SUDO_UID='104' - SUDO_USER='jenkins' - TERM='unknown' - TZ='/usr/share/zoneinfo/Etc/GMT+12' - USER='root' - _='/usr/bin/systemd-run' - http_proxy='http://192.168.101.4:3128' + PWD=/ + SHELL=/bin/bash + SHELLOPTS=braceexpand:errexit:hashall:interactive-comments:posix + SHLVL=3 + SUDO_COMMAND='/usr/bin/timeout -k 24.1h 24h /usr/bin/ionice -c 3 /usr/bin/nice -n 11 /usr/bin/unshare --uts -- /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.0tTUT605/pbuilderrc_MVV1 --distribution trixie --hookdir /etc/pbuilder/rebuild-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.0tTUT605/b2 --logfile b2/build.log presto_0.7.2-1.dsc' + SUDO_GID=109 + SUDO_UID=104 + SUDO_USER=jenkins + TERM=unknown + TZ=/usr/share/zoneinfo/Etc/GMT-14 + UID=0 + USER=root + _='I: set' + http_proxy=http://192.168.101.4:3128 I: uname -a - Linux codethink02-arm64 6.1.0-20-cloud-arm64 #1 SMP Debian 6.1.85-1 (2024-04-11) aarch64 GNU/Linux + Linux i-capture-the-hostname 6.1.0-20-cloud-arm64 #1 SMP Debian 6.1.85-1 (2024-04-11) aarch64 GNU/Linux I: ls -l /bin - lrwxrwxrwx 1 root root 7 Apr 21 07:15 /bin -> usr/bin -I: user script /srv/workspace/pbuilder/2559778/tmp/hooks/D02_print_environment finished + lrwxrwxrwx 1 root root 7 May 26 17:47 /bin -> usr/bin +I: user script /srv/workspace/pbuilder/1589516/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy @@ -243,7 +275,7 @@ Get: 117 http://deb.debian.org/debian trixie/main arm64 python3-pandas all 2.1.4+dfsg-5 [3015 kB] Get: 118 http://deb.debian.org/debian trixie/main arm64 python3-scipy arm64 1.11.4-6 [17.5 MB] Get: 119 http://deb.debian.org/debian trixie/main arm64 vsearch arm64 2.27.1-1 [382 kB] -Fetched 91.9 MB in 1s (181 MB/s) +Fetched 91.9 MB in 0s (212 MB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package libpython3.11-minimal:arm64. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19940 files and directories currently installed.) @@ -643,8 +675,8 @@ Setting up tzdata (2024a-3) ... Current default time zone: 'Etc/UTC' -Local time is now: Sun Apr 28 11:57:33 UTC 2024. -Universal Time is now: Sun Apr 28 11:57:33 UTC 2024. +Local time is now: Sat May 31 18:22:40 UTC 2025. +Universal Time is now: Sat May 31 18:22:40 UTC 2025. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up libfontenc1:arm64 (1:1.1.8-1) ... @@ -753,7 +785,11 @@ Building tag database... -> Finished parsing the build-deps I: Building the package -I: Running cd /build/reproducible-path/presto-0.7.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../presto_0.7.2-1_source.changes +I: user script /srv/workspace/pbuilder/1589516/tmp/hooks/A99_set_merged_usr starting +Not re-configuring usrmerge for trixie +I: user script /srv/workspace/pbuilder/1589516/tmp/hooks/A99_set_merged_usr finished +hostname: Name or service not known +I: Running cd /build/reproducible-path/presto-0.7.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-genchanges -S > ../presto_0.7.2-1_source.changes dpkg-buildpackage: info: source package presto dpkg-buildpackage: info: source version 0.7.2-1 dpkg-buildpackage: info: source distribution unstable @@ -987,7 +1023,7 @@ {1: ['SEQ1', 'SEQ2', 'SEQ3'], 2: ['SEQ4', 'SEQ5']} ZERO_LENGTH> None -<- test_runCDHit() 0.041 +<- test_runCDHit() 0.023 -> test_runUClust() FULL_LENGTH> {1: ['SEQ1', 'SEQ2', 'SEQ3'], 2: ['SEQ4', 'SEQ5']} @@ -995,7 +1031,7 @@ {1: ['SEQ1', 'SEQ2', 'SEQ3'], 2: ['SEQ4', 'SEQ5']} ZERO_LENGTH> None -<- test_runUClust() 0.052 +<- test_runUClust() 0.051 -> test_checkSeqEqual() DNA Equality> SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA @@ -1064,7 +1100,7 @@ -> test_calculateDistances() <- test_calculateDistances() 0.001 -> test_countMismatches() -<- test_countMismatches() 0.001 +<- test_countMismatches() 0.002 -> test_initializeMismatchDictionary() <- test_initializeMismatchDictionary() 0.000 -> test_getFileType() @@ -1321,7 +1357,7 @@ GAPS> 0 ERROR> 1.000000 -<- test_localAlignment() 0.040 +<- test_localAlignment() 0.039 -> test_maskSeq() TEST CUT> ID> SEQ|PRIMER=A|BARCODE=CCA @@ -1339,7 +1375,7 @@ ID> SEQ|PRIMER=A|BARCODE=CCA SEQ> CCACGTTTTAGTAATTAATA -<- test_maskSeq() 0.001 +<- test_maskSeq() 0.002 -> test_scoreAlignment() SEQ1> SEQ> CCACGTTTTAGTAATTAATA @@ -1411,7 +1447,7 @@ GAPS> 0 ERROR> 1.000000 -<- test_scoreAlignment() 0.007 +<- test_scoreAlignment() 0.009 -> test_calculateSetError() REF> CGGCGTAA 0.4347826086956522 REF> NNNNNNNN 1.0 @@ -1613,7 +1649,7 @@ test_deletionUnify (tests.test_UnifyHeaders.TestConvertHeaders.test_deletionUnify) ... ok ---------------------------------------------------------------------- -Ran 40 tests in 0.184s +Ran 40 tests in 0.143s OK (skipped=6) SEQ6> NNNNNNAA @@ -1972,7 +2008,7 @@ WEIGHT> 8 ERROR> 0.250000 -<- test_scoreSeqPair() 0.005 +<- test_scoreSeqPair() 0.006 -> test_weightDNA() DNA Weight> SEQ1> 8 @@ -2106,7 +2142,7 @@ {1: ['SEQ1', 'SEQ2', 'SEQ3'], 2: ['SEQ4', 'SEQ5']} ZERO_LENGTH> None -<- test_runCDHit() 0.044 +<- test_runCDHit() 0.022 -> test_runUClust() FULL_LENGTH> {1: ['SEQ1', 'SEQ2', 'SEQ3'], 2: ['SEQ4', 'SEQ5']} @@ -2114,7 +2150,7 @@ {1: ['SEQ1', 'SEQ2', 'SEQ3'], 2: ['SEQ4', 'SEQ5']} ZERO_LENGTH> None -<- test_runUClust() 0.056 +<- test_runUClust() 0.050 -> test_checkSeqEqual() DNA Equality> SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA @@ -2183,7 +2219,7 @@ -> test_calculateDistances() <- test_calculateDistances() 0.001 -> test_countMismatches() -<- test_countMismatches() 0.001 +<- test_countMismatches() 0.003 -> test_initializeMismatchDictionary() <- test_initializeMismatchDictionary() 0.000 -> test_getFileType() @@ -2440,7 +2476,7 @@ GAPS> 0 ERROR> 1.000000 -<- test_localAlignment() 0.044 +<- test_localAlignment() 0.045 -> test_maskSeq() TEST CUT> ID> SEQ|PRIMER=A|BARCODE=CCA @@ -2715,7 +2751,7 @@ test_deletionUnify (tests.test_UnifyHeaders.TestConvertHeaders.test_deletionUnify) ... ok ---------------------------------------------------------------------- -Ran 40 tests in 0.181s +Ran 40 tests in 0.149s OK (skipped=6) SEQ6> NNNNNNAA @@ -3091,7 +3127,7 @@ WEIGHT> 8 ERROR> 0.250000 -<- test_scoreSeqPair() 0.005 +<- test_scoreSeqPair() 0.006 -> test_weightDNA() DNA Weight> SEQ1> 8 @@ -3117,7 +3153,7 @@ ID> SEQ5|BARCODE=CCCC|SAMPLE=S2 -> SEQ5|BARCODE=CCCC|SAMPLE=S1 ID> SEQ6|BARCODE=GGGG|SAMPLE=S2 -> SEQ6|BARCODE=GGGG|SAMPLE=S2 ID> SEQ7|BARCODE=GGGG|SAMPLE=S2 -> SEQ7|BARCODE=GGGG|SAMPLE=S2 -<- test_consensusUnify() 0.000 +<- test_consensusUnify() 0.001 -> test_deletionUnify() ID> SEQ0|BARCODE=AAAA|SAMPLE=S1 -> False ID> SEQ1|BARCODE=AAAA|SAMPLE=S1 -> False @@ -3444,12 +3480,14 @@ dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: including full source code in upload I: copying local configuration +I: user script /srv/workspace/pbuilder/1589516/tmp/hooks/B01_cleanup starting +I: user script /srv/workspace/pbuilder/1589516/tmp/hooks/B01_cleanup finished I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env -I: removing directory /srv/workspace/pbuilder/2559778 and its subdirectories -I: Current time: Sat Apr 27 23:59:12 -12 2024 -I: pbuilder-time-stamp: 1714305552 +I: removing directory /srv/workspace/pbuilder/1589516 and its subdirectories +I: Current time: Sun Jun 1 08:24:28 +14 2025 +I: pbuilder-time-stamp: 1748715868