Diff of the two buildlogs:

--
--- b1/build.log	2021-07-08 23:39:17.878778330 +0000
+++ b2/build.log	2021-07-08 23:57:39.573178633 +0000
@@ -1,6 +1,6 @@
 I: pbuilder: network access will be disabled during build
-I: Current time: Wed Aug 10 17:41:29 -12 2022
-I: pbuilder-time-stamp: 1660196489
+I: Current time: Fri Jul  9 13:39:20 +14 2021
+I: pbuilder-time-stamp: 1625787560
 I: Building the build Environment
 I: extracting base tarball [/var/cache/pbuilder/bullseye-reproducible-base.tgz]
 I: copying local configuration
@@ -16,8 +16,8 @@
 I: copying [./bowtie_1.3.0+dfsg1-1.debian.tar.xz]
 I: Extracting source
 gpgv: unknown type of key resource 'trustedkeys.kbx'
-gpgv: keyblock resource '/tmp/dpkg-verify-sig.Bgr9IO9J/trustedkeys.kbx': General error
-gpgv: Signature made Tue Oct 13 00:02:00 2020 -12
+gpgv: keyblock resource '/tmp/dpkg-verify-sig.pUU0Dbmx/trustedkeys.kbx': General error
+gpgv: Signature made Wed Oct 14 02:02:00 2020 +14
 gpgv:                using RSA key F1F007320A035541F0A663CA578A0494D1C646D1
 gpgv:                issuer "tille@debian.org"
 gpgv: Can't check signature: No public key
@@ -36,135 +36,169 @@
 dpkg-source: info: applying popcnt_capability.patch
 I: Not using root during the build.
 I: Installing the build-deps
-I: user script /srv/workspace/pbuilder/14012/tmp/hooks/D02_print_environment starting
+I: user script /srv/workspace/pbuilder/12243/tmp/hooks/D01_modify_environment starting
+debug: Running on codethink10-arm64.
+I: Changing host+domainname to test build reproducibility
+I: Adding a custom variable just for the fun of it...
+I: Changing /bin/sh to bash
+Removing 'diversion of /bin/sh to /bin/sh.distrib by dash'
+Adding 'diversion of /bin/sh to /bin/sh.distrib by bash'
+Removing 'diversion of /usr/share/man/man1/sh.1.gz to /usr/share/man/man1/sh.distrib.1.gz by dash'
+Adding 'diversion of /usr/share/man/man1/sh.1.gz to /usr/share/man/man1/sh.distrib.1.gz by bash'
+I: Setting pbuilder2's login shell to /bin/bash
+I: Setting pbuilder2's GECOS to second user,second room,second work-phone,second home-phone,second other
+I: user script /srv/workspace/pbuilder/12243/tmp/hooks/D01_modify_environment finished
+I: user script /srv/workspace/pbuilder/12243/tmp/hooks/D02_print_environment starting
 I: set
-  BUILDDIR='/build'
-  BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other'
-  BUILDUSERNAME='pbuilder1'
-  BUILD_ARCH='arm64'
-  DEBIAN_FRONTEND='noninteractive'
+  BASH=/bin/sh
+  BASHOPTS=checkwinsize:cmdhist:complete_fullquote:extquote:force_fignore:globasciiranges:hostcomplete:interactive_comments:progcomp:promptvars:sourcepath
+  BASH_ALIASES=()
+  BASH_ARGC=()
+  BASH_ARGV=()
+  BASH_CMDS=()
+  BASH_LINENO=([0]="12" [1]="0")
+  BASH_SOURCE=([0]="/tmp/hooks/D02_print_environment" [1]="/tmp/hooks/D02_print_environment")
+  BASH_VERSINFO=([0]="5" [1]="1" [2]="4" [3]="1" [4]="release" [5]="aarch64-unknown-linux-gnu")
+  BASH_VERSION='5.1.4(1)-release'
+  BUILDDIR=/build
+  BUILDUSERGECOS='second user,second room,second work-phone,second home-phone,second other'
+  BUILDUSERNAME=pbuilder2
+  BUILD_ARCH=arm64
+  DEBIAN_FRONTEND=noninteractive
   DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all,-fixfilepath parallel=8'
-  DISTRIBUTION=''
-  HOME='/var/lib/jenkins'
-  HOST_ARCH='arm64'
+  DIRSTACK=()
+  DISTRIBUTION=
+  EUID=0
+  FUNCNAME=([0]="Echo" [1]="main")
+  GROUPS=()
+  HOME=/var/lib/jenkins
+  HOSTNAME=i-capture-the-hostname
+  HOSTTYPE=aarch64
+  HOST_ARCH=arm64
   IFS=' 	
   '
-  LANG='C'
-  LANGUAGE='en_US:en'
-  LC_ALL='C'
-  MAIL='/var/mail/root'
-  OPTIND='1'
-  PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games'
-  PBCURRENTCOMMANDLINEOPERATION='build'
-  PBUILDER_OPERATION='build'
-  PBUILDER_PKGDATADIR='/usr/share/pbuilder'
-  PBUILDER_PKGLIBDIR='/usr/lib/pbuilder'
-  PBUILDER_SYSCONFDIR='/etc'
-  PPID='14012'
-  PS1='# '
-  PS2='> '
+  LANG=C
+  LANGUAGE=nl_BE:nl
+  LC_ALL=C
+  MACHTYPE=aarch64-unknown-linux-gnu
+  MAIL=/var/mail/root
+  OPTERR=1
+  OPTIND=1
+  OSTYPE=linux-gnu
+  PATH=/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path
+  PBCURRENTCOMMANDLINEOPERATION=build
+  PBUILDER_OPERATION=build
+  PBUILDER_PKGDATADIR=/usr/share/pbuilder
+  PBUILDER_PKGLIBDIR=/usr/lib/pbuilder
+  PBUILDER_SYSCONFDIR=/etc
+  PIPESTATUS=([0]="0")
+  POSIXLY_CORRECT=y
+  PPID=12243
   PS4='+ '
-  PWD='/'
-  SHELL='/bin/bash'
-  SHLVL='2'
-  SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/tmp.iIpQeQg7Dr/pbuilderrc_hKKL --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/bullseye-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/tmp.iIpQeQg7Dr/b1 --logfile b1/build.log bowtie_1.3.0+dfsg1-1.dsc'
-  SUDO_GID='117'
-  SUDO_UID='110'
-  SUDO_USER='jenkins'
-  TERM='unknown'
-  TZ='/usr/share/zoneinfo/Etc/GMT+12'
-  USER='root'
-  USERNAME='root'
-  _='/usr/bin/systemd-run'
-  http_proxy='http://192.168.101.16:3128'
+  PWD=/
+  SHELL=/bin/bash
+  SHELLOPTS=braceexpand:errexit:hashall:interactive-comments:posix
+  SHLVL=3
+  SUDO_COMMAND='/usr/bin/timeout -k 24.1h 24h /usr/bin/ionice -c 3 /usr/bin/nice -n 11 /usr/bin/unshare --uts -- /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/tmp.iIpQeQg7Dr/pbuilderrc_rHfi --hookdir /etc/pbuilder/rebuild-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/bullseye-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/tmp.iIpQeQg7Dr/b2 --logfile b2/build.log --extrapackages usrmerge bowtie_1.3.0+dfsg1-1.dsc'
+  SUDO_GID=117
+  SUDO_UID=110
+  SUDO_USER=jenkins
+  TERM=unknown
+  TZ=/usr/share/zoneinfo/Etc/GMT-14
+  UID=0
+  USER=root
+  USERNAME=root
+  _='I: set'
+  http_proxy=http://192.168.101.16:3128
 I: uname -a
-  Linux codethink11-arm64 4.15.0-147-generic #151-Ubuntu SMP Fri Jun 18 19:18:37 UTC 2021 aarch64 GNU/Linux
+  Linux i-capture-the-hostname 4.15.0-147-generic #151-Ubuntu SMP Fri Jun 18 19:18:37 UTC 2021 aarch64 GNU/Linux
 I: ls -l /bin
   total 5252
-  -rwxr-xr-x 1 root root 1282512 Jun 21  2021 bash
-  -rwxr-xr-x 3 root root   34808 Jul 20  2020 bunzip2
-  -rwxr-xr-x 3 root root   34808 Jul 20  2020 bzcat
-  lrwxrwxrwx 1 root root       6 Jul 20  2020 bzcmp -> bzdiff
-  -rwxr-xr-x 1 root root    2225 Jul 20  2020 bzdiff
-  lrwxrwxrwx 1 root root       6 Jul 20  2020 bzegrep -> bzgrep
-  -rwxr-xr-x 1 root root    4877 Sep  4  2019 bzexe
-  lrwxrwxrwx 1 root root       6 Jul 20  2020 bzfgrep -> bzgrep
-  -rwxr-xr-x 1 root root    3775 Jul 20  2020 bzgrep
-  -rwxr-xr-x 3 root root   34808 Jul 20  2020 bzip2
-  -rwxr-xr-x 1 root root   14264 Jul 20  2020 bzip2recover
-  lrwxrwxrwx 1 root root       6 Jul 20  2020 bzless -> bzmore
-  -rwxr-xr-x 1 root root    1297 Jul 20  2020 bzmore
-  -rwxr-xr-x 1 root root   39832 Sep 22  2020 cat
-  -rwxr-xr-x 1 root root   64512 Sep 22  2020 chgrp
-  -rwxr-xr-x 1 root root   60368 Sep 22  2020 chmod
-  -rwxr-xr-x 1 root root   64528 Sep 22  2020 chown
-  -rwxr-xr-x 1 root root  138896 Sep 22  2020 cp
-  -rwxr-xr-x 1 root root  129544 Dec 10  2020 dash
-  -rwxr-xr-x 1 root root  101384 Sep 22  2020 date
-  -rwxr-xr-x 1 root root   80984 Sep 22  2020 dd
-  -rwxr-xr-x 1 root root   89824 Sep 22  2020 df
-  -rwxr-xr-x 1 root root  143088 Sep 22  2020 dir
-  -rwxr-xr-x 1 root root   76152 Feb  7  2021 dmesg
-  lrwxrwxrwx 1 root root       8 Nov  6  2019 dnsdomainname -> hostname
-  lrwxrwxrwx 1 root root       8 Nov  6  2019 domainname -> hostname
-  -rwxr-xr-x 1 root root   35632 Sep 22  2020 echo
-  -rwxr-xr-x 1 root root      28 Nov  9  2020 egrep
-  -rwxr-xr-x 1 root root   31512 Sep 22  2020 false
-  -rwxr-xr-x 1 root root      28 Nov  9  2020 fgrep
-  -rwxr-xr-x 1 root root   64856 Feb  7  2021 findmnt
-  -rwsr-xr-x 1 root root   34824 Feb 26  2021 fusermount
-  -rwxr-xr-x 1 root root  178400 Nov  9  2020 grep
-  -rwxr-xr-x 2 root root    2346 Mar  2  2021 gunzip
-  -rwxr-xr-x 1 root root    6376 Mar  2  2021 gzexe
-  -rwxr-xr-x 1 root root   93744 Mar  2  2021 gzip
-  -rwxr-xr-x 1 root root   18440 Nov  6  2019 hostname
-  -rwxr-xr-x 1 root root   68720 Sep 22  2020 ln
-  -rwxr-xr-x 1 root root   52720 Feb  7  2020 login
-  -rwxr-xr-x 1 root root  143088 Sep 22  2020 ls
-  -rwxr-xr-x 1 root root  161960 Feb  7  2021 lsblk
-  -rwxr-xr-x 1 root root   85200 Sep 22  2020 mkdir
-  -rwxr-xr-x 1 root root   68744 Sep 22  2020 mknod
-  -rwxr-xr-x 1 root root   43976 Sep 22  2020 mktemp
-  -rwxr-xr-x 1 root root   51368 Feb  7  2021 more
-  -rwsr-xr-x 1 root root   51360 Feb  7  2021 mount
-  -rwxr-xr-x 1 root root   14496 Feb  7  2021 mountpoint
-  -rwxr-xr-x 1 root root  134808 Sep 22  2020 mv
-  lrwxrwxrwx 1 root root       8 Nov  6  2019 nisdomainname -> hostname
-  lrwxrwxrwx 1 root root      14 Apr 18  2021 pidof -> /sbin/killall5
-  -rwxr-xr-x 1 root root   35720 Sep 22  2020 pwd
-  lrwxrwxrwx 1 root root       4 Jun 21  2021 rbash -> bash
-  -rwxr-xr-x 1 root root   43872 Sep 22  2020 readlink
-  -rwxr-xr-x 1 root root   68592 Sep 22  2020 rm
-  -rwxr-xr-x 1 root root   43880 Sep 22  2020 rmdir
-  -rwxr-xr-x 1 root root   19208 Sep 27  2020 run-parts
-  -rwxr-xr-x 1 root root  114016 Dec 22  2018 sed
-  lrwxrwxrwx 1 root root       4 Aug 10 03:47 sh -> dash
-  -rwxr-xr-x 1 root root   35656 Sep 22  2020 sleep
-  -rwxr-xr-x 1 root root   72640 Sep 22  2020 stty
-  -rwsr-xr-x 1 root root   67776 Feb  7  2021 su
-  -rwxr-xr-x 1 root root   35672 Sep 22  2020 sync
-  -rwxr-xr-x 1 root root  535768 Feb 16  2021 tar
-  -rwxr-xr-x 1 root root   10568 Sep 27  2020 tempfile
-  -rwxr-xr-x 1 root root   89120 Sep 22  2020 touch
-  -rwxr-xr-x 1 root root   31512 Sep 22  2020 true
-  -rwxr-xr-x 1 root root   14264 Feb 26  2021 ulockmgr_server
-  -rwsr-xr-x 1 root root   30880 Feb  7  2021 umount
-  -rwxr-xr-x 1 root root   35640 Sep 22  2020 uname
-  -rwxr-xr-x 2 root root    2346 Mar  2  2021 uncompress
-  -rwxr-xr-x 1 root root  143088 Sep 22  2020 vdir
-  -rwxr-xr-x 1 root root   59584 Feb  7  2021 wdctl
-  lrwxrwxrwx 1 root root       8 Nov  6  2019 ypdomainname -> hostname
-  -rwxr-xr-x 1 root root    1984 Mar  2  2021 zcat
-  -rwxr-xr-x 1 root root    1678 Mar  2  2021 zcmp
-  -rwxr-xr-x 1 root root    5880 Mar  2  2021 zdiff
-  -rwxr-xr-x 1 root root      29 Mar  2  2021 zegrep
-  -rwxr-xr-x 1 root root      29 Mar  2  2021 zfgrep
-  -rwxr-xr-x 1 root root    2081 Mar  2  2021 zforce
-  -rwxr-xr-x 1 root root    7585 Mar  2  2021 zgrep
-  -rwxr-xr-x 1 root root    2206 Mar  2  2021 zless
-  -rwxr-xr-x 1 root root    1842 Mar  2  2021 zmore
-  -rwxr-xr-x 1 root root    4553 Mar  2  2021 znew
-I: user script /srv/workspace/pbuilder/14012/tmp/hooks/D02_print_environment finished
+  -rwxr-xr-x 1 root root 1282512 Jun 22 16:26 bash
+  -rwxr-xr-x 3 root root   34808 Jul 21  2020 bunzip2
+  -rwxr-xr-x 3 root root   34808 Jul 21  2020 bzcat
+  lrwxrwxrwx 1 root root       6 Jul 21  2020 bzcmp -> bzdiff
+  -rwxr-xr-x 1 root root    2225 Jul 21  2020 bzdiff
+  lrwxrwxrwx 1 root root       6 Jul 21  2020 bzegrep -> bzgrep
+  -rwxr-xr-x 1 root root    4877 Sep  5  2019 bzexe
+  lrwxrwxrwx 1 root root       6 Jul 21  2020 bzfgrep -> bzgrep
+  -rwxr-xr-x 1 root root    3775 Jul 21  2020 bzgrep
+  -rwxr-xr-x 3 root root   34808 Jul 21  2020 bzip2
+  -rwxr-xr-x 1 root root   14264 Jul 21  2020 bzip2recover
+  lrwxrwxrwx 1 root root       6 Jul 21  2020 bzless -> bzmore
+  -rwxr-xr-x 1 root root    1297 Jul 21  2020 bzmore
+  -rwxr-xr-x 1 root root   39832 Sep 23  2020 cat
+  -rwxr-xr-x 1 root root   64512 Sep 23  2020 chgrp
+  -rwxr-xr-x 1 root root   60368 Sep 23  2020 chmod
+  -rwxr-xr-x 1 root root   64528 Sep 23  2020 chown
+  -rwxr-xr-x 1 root root  138896 Sep 23  2020 cp
+  -rwxr-xr-x 1 root root  129544 Dec 11  2020 dash
+  -rwxr-xr-x 1 root root  101384 Sep 23  2020 date
+  -rwxr-xr-x 1 root root   80984 Sep 23  2020 dd
+  -rwxr-xr-x 1 root root   89824 Sep 23  2020 df
+  -rwxr-xr-x 1 root root  143088 Sep 23  2020 dir
+  -rwxr-xr-x 1 root root   76152 Feb  8 04:38 dmesg
+  lrwxrwxrwx 1 root root       8 Nov  8  2019 dnsdomainname -> hostname
+  lrwxrwxrwx 1 root root       8 Nov  8  2019 domainname -> hostname
+  -rwxr-xr-x 1 root root   35632 Sep 23  2020 echo
+  -rwxr-xr-x 1 root root      28 Nov 10  2020 egrep
+  -rwxr-xr-x 1 root root   31512 Sep 23  2020 false
+  -rwxr-xr-x 1 root root      28 Nov 10  2020 fgrep
+  -rwxr-xr-x 1 root root   64856 Feb  8 04:38 findmnt
+  -rwsr-xr-x 1 root root   34824 Feb 27 06:12 fusermount
+  -rwxr-xr-x 1 root root  178400 Nov 10  2020 grep
+  -rwxr-xr-x 2 root root    2346 Mar  3 13:30 gunzip
+  -rwxr-xr-x 1 root root    6376 Mar  3 13:30 gzexe
+  -rwxr-xr-x 1 root root   93744 Mar  3 13:30 gzip
+  -rwxr-xr-x 1 root root   18440 Nov  8  2019 hostname
+  -rwxr-xr-x 1 root root   68720 Sep 23  2020 ln
+  -rwxr-xr-x 1 root root   52720 Feb  8  2020 login
+  -rwxr-xr-x 1 root root  143088 Sep 23  2020 ls
+  -rwxr-xr-x 1 root root  161960 Feb  8 04:38 lsblk
+  -rwxr-xr-x 1 root root   85200 Sep 23  2020 mkdir
+  -rwxr-xr-x 1 root root   68744 Sep 23  2020 mknod
+  -rwxr-xr-x 1 root root   43976 Sep 23  2020 mktemp
+  -rwxr-xr-x 1 root root   51368 Feb  8 04:38 more
+  -rwsr-xr-x 1 root root   51360 Feb  8 04:38 mount
+  -rwxr-xr-x 1 root root   14496 Feb  8 04:38 mountpoint
+  -rwxr-xr-x 1 root root  134808 Sep 23  2020 mv
+  lrwxrwxrwx 1 root root       8 Nov  8  2019 nisdomainname -> hostname
+  lrwxrwxrwx 1 root root      14 Apr 19 05:38 pidof -> /sbin/killall5
+  -rwxr-xr-x 1 root root   35720 Sep 23  2020 pwd
+  lrwxrwxrwx 1 root root       4 Jun 22 16:26 rbash -> bash
+  -rwxr-xr-x 1 root root   43872 Sep 23  2020 readlink
+  -rwxr-xr-x 1 root root   68592 Sep 23  2020 rm
+  -rwxr-xr-x 1 root root   43880 Sep 23  2020 rmdir
+  -rwxr-xr-x 1 root root   19208 Sep 28  2020 run-parts
+  -rwxr-xr-x 1 root root  114016 Dec 23  2018 sed
+  lrwxrwxrwx 1 root root       4 Jul  9 13:39 sh -> bash
+  lrwxrwxrwx 1 root root       4 Jul  7 23:24 sh.distrib -> dash
+  -rwxr-xr-x 1 root root   35656 Sep 23  2020 sleep
+  -rwxr-xr-x 1 root root   72640 Sep 23  2020 stty
+  -rwsr-xr-x 1 root root   67776 Feb  8 04:38 su
+  -rwxr-xr-x 1 root root   35672 Sep 23  2020 sync
+  -rwxr-xr-x 1 root root  535768 Feb 17 23:55 tar
+  -rwxr-xr-x 1 root root   10568 Sep 28  2020 tempfile
+  -rwxr-xr-x 1 root root   89120 Sep 23  2020 touch
+  -rwxr-xr-x 1 root root   31512 Sep 23  2020 true
+  -rwxr-xr-x 1 root root   14264 Feb 27 06:12 ulockmgr_server
+  -rwsr-xr-x 1 root root   30880 Feb  8 04:38 umount
+  -rwxr-xr-x 1 root root   35640 Sep 23  2020 uname
+  -rwxr-xr-x 2 root root    2346 Mar  3 13:30 uncompress
+  -rwxr-xr-x 1 root root  143088 Sep 23  2020 vdir
+  -rwxr-xr-x 1 root root   59584 Feb  8 04:38 wdctl
+  lrwxrwxrwx 1 root root       8 Nov  8  2019 ypdomainname -> hostname
+  -rwxr-xr-x 1 root root    1984 Mar  3 13:30 zcat
+  -rwxr-xr-x 1 root root    1678 Mar  3 13:30 zcmp
+  -rwxr-xr-x 1 root root    5880 Mar  3 13:30 zdiff
+  -rwxr-xr-x 1 root root      29 Mar  3 13:30 zegrep
+  -rwxr-xr-x 1 root root      29 Mar  3 13:30 zfgrep
+  -rwxr-xr-x 1 root root    2081 Mar  3 13:30 zforce
+  -rwxr-xr-x 1 root root    7585 Mar  3 13:30 zgrep
+  -rwxr-xr-x 1 root root    2206 Mar  3 13:30 zless
+  -rwxr-xr-x 1 root root    1842 Mar  3 13:30 zmore
+  -rwxr-xr-x 1 root root    4553 Mar  3 13:30 znew
+I: user script /srv/workspace/pbuilder/12243/tmp/hooks/D02_print_environment finished
  -> Attempting to satisfy build-dependencies
  -> Creating pbuilder-satisfydepends-dummy package
 Package: pbuilder-satisfydepends-dummy
@@ -269,7 +303,7 @@
 Get: 53 http://deb.debian.org/debian bullseye/main arm64 libtbb-dev arm64 2020.3-1 [313 kB]
 Get: 54 http://deb.debian.org/debian bullseye/main arm64 libtest-deep-perl all 1.130-1 [49.3 kB]
 Get: 55 http://deb.debian.org/debian bullseye/main arm64 zlib1g-dev arm64 1:1.2.11.dfsg-2 [189 kB]
-Fetched 24.3 MB in 1s (47.7 MB/s)
+Fetched 24.3 MB in 0s (53.3 MB/s)
 debconf: delaying package configuration, since apt-utils is not installed
 Selecting previously unselected package bsdextrautils.
 (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 19646 files and directories currently installed.)
@@ -506,8 +540,45 @@
 Writing extended state information...
 Building tag database...
  -> Finished parsing the build-deps
+Reading package lists...
+Building dependency tree...
+Reading state information...
+The following additional packages will be installed:
+  libfile-find-rule-perl libnumber-compare-perl libtext-glob-perl
+The following NEW packages will be installed:
+  libfile-find-rule-perl libnumber-compare-perl libtext-glob-perl usrmerge
+0 upgraded, 4 newly installed, 0 to remove and 0 not upgraded.
+Need to get 59.5 kB of archives.
+After this operation, 157 kB of additional disk space will be used.
+Get:1 http://deb.debian.org/debian bullseye/main arm64 libnumber-compare-perl all 0.03-1.1 [6956 B]
+Get:2 http://deb.debian.org/debian bullseye/main arm64 libtext-glob-perl all 0.11-1 [8888 B]
+Get:3 http://deb.debian.org/debian bullseye/main arm64 libfile-find-rule-perl all 0.34-1 [30.6 kB]
+Get:4 http://deb.debian.org/debian bullseye/main arm64 usrmerge all 25 [13.0 kB]
+debconf: delaying package configuration, since apt-utils is not installed
+Fetched 59.5 kB in 0s (2876 kB/s)
+Selecting previously unselected package libnumber-compare-perl.
+(Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 22679 files and directories currently installed.)
+Preparing to unpack .../libnumber-compare-perl_0.03-1.1_all.deb ...
+Unpacking libnumber-compare-perl (0.03-1.1) ...
+Selecting previously unselected package libtext-glob-perl.
+Preparing to unpack .../libtext-glob-perl_0.11-1_all.deb ...
+Unpacking libtext-glob-perl (0.11-1) ...
+Selecting previously unselected package libfile-find-rule-perl.
+Preparing to unpack .../libfile-find-rule-perl_0.34-1_all.deb ...
+Unpacking libfile-find-rule-perl (0.34-1) ...
+Selecting previously unselected package usrmerge.
+Preparing to unpack .../archives/usrmerge_25_all.deb ...
+Unpacking usrmerge (25) ...
+Setting up libtext-glob-perl (0.11-1) ...
+Setting up libnumber-compare-perl (0.03-1.1) ...
+Setting up libfile-find-rule-perl (0.34-1) ...
+Setting up usrmerge (25) ...
+The system has been successfully converted.
+Processing triggers for man-db (2.9.4-2) ...
+Not building database; man-db/auto-update is not 'true'.
 I: Building the package
-I: Running cd /build/bowtie-1.3.0+dfsg1/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S  > ../bowtie_1.3.0+dfsg1-1_source.changes
+hostname: Temporary failure in name resolution
+I: Running cd /build/bowtie-1.3.0+dfsg1/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-genchanges -S  > ../bowtie_1.3.0+dfsg1-1_source.changes
 dpkg-buildpackage: info: source package bowtie
 dpkg-buildpackage: info: source version 1.3.0+dfsg1-1
 dpkg-buildpackage: info: source distribution unstable
@@ -718,10 +789,10 @@
 ./bowtie    -F 10,9 -S --quiet -a .simple_tests.tmp  .simple_tests
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 2
-# reads with at least one alignment: 2 (100.00%)
+# reads with at least one alignment: 2 (@HD	VN:1.0	SO:unsorted
+100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 2 alignments
-@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests"
 seq1_0	0	0	1	255	10M	*	0	0	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
@@ -735,10 +806,10 @@
 # reads processed: 3
 # reads with at least one alignment: 3 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00@SQ	SN:0	LN:19
-%)
-Reported 3 alignments
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests"
+# reads that failed to align: @SQ	SN:0	LN:19
+0 (0.00%)
+Reported 3 alignments@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests"
+
 seq1_0	0	0	1	255	10M	*	0	0	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 seq2_0	0	0	1	255	10M	*	0	0	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 seq2_9	0	0	10	255	10M	*	0	0	CAGTATCTGA	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
@@ -749,12 +820,12 @@
 ./bowtie    -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp  .simple_tests
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+@HD	VN:1.0	SO:unsorted
+# reads with at least one alignment: 1 (@SQ	SN:0	LN:19
 100.00%)
-# reads that failed to align: 0 (0.00%)@SQ	SN:0	LN:19
-
+# reads that failed to align: 0 (@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests"
+0.00%)
 Reported 1 alignments
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests"
 seq1_0	0	0	1	255	10M	*	0	0	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 FASTA-continuous 4 (fw:1, sam:1)
 References:
@@ -763,13 +834,13 @@
 ./bowtie    -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp  .simple_tests
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-@SQ	SN:0	LN:19
+@HD	VN:1.0	SO:unsorted
+# reads with at least one alignment: 1 (@SQ	SN:0	LN:19
 100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 alignments
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests"
-seq1_9	0	0	10	255	10M	*	0	0	CAGTATCTGA	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
+# reads that failed to align: 0@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests"
+ (0.00%)
+Reported 1 alignmentsseq1_9	0	0	10	255	10M	*	0	0	CAGTATCTGA	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
+
 FASTA-continuous 5 (fw:1, sam:1)
 References:
 >0
@@ -777,12 +848,12 @@
 ./bowtie    -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp  .simple_tests
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 alignments
 @HD	VN:1.0	SO:unsorted
-@SQ	SN:0	LN:19
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests"
+# reads with at least one alignment: 1 (@SQ	SN:0	LN:19
+100.00%)
+# reads that failed to align: 0 (0.00%)@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests"
+
+Reported 1 alignments
 seq2_0	0	0	1	255	10M	*	0	0	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 FASTA-continuous 6 (fw:1, sam:1)
 References:
@@ -792,12 +863,12 @@
 ./bowtie    -F 10,1 -S --quiet -a .simple_tests.tmp  .simple_tests
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 3
-# reads with at least one alignment: 3 (@HD	VN:1.0	SO:unsorted
+@HD	VN:1.0	SO:unsorted
+# reads with at least one alignment: 3 (@SQ	SN:0	LN:12
 100.00%)
-# reads that failed to align: 0 (0.00@SQ	SN:0	LN:12
-%)
-Reported 3 alignments
+# reads that failed to align: 0 (0.00%)
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests"
+Reported 3 alignments
 seq1_0	0	0	1	255	10M	*	0	0	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 seq1_1	0	0	2	255	10M	*	0	0	GCATCGATCA	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 seq1_2	0	0	3	255	10M	*	0	0	CATCGATCAG	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
@@ -809,14 +880,14 @@
 ./bowtie    --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII
 
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-@SQ	SN:0	LN:19
+# reads processed: 1@HD	VN:1.0	SO:unsorted
+
+# reads with at least one alignment: 1 (@SQ	SN:0	LN:19
+@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII"
 100.00%)
-# reads that failed to align: 0 (@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII"
-0.00%)
+# reads that failed to align: 0	0	0	3	255	12M	*	0	0	CATCGATCAGTA	IIIIIIIIIIII	XA:i:0	MD:Z:12	NM:i:0	XM:i:2
+0 (0.00%)
 Reported 1 alignments
-0	0	0	3	255	12M	*	0	0	CATCGATCAGTA	IIIIIIIIIIII	XA:i:0	MD:Z:12	NM:i:0	XM:i:2
 Cline 8 (fw:1, sam:1)
 References:
 >0
@@ -824,11 +895,11 @@
 ./bowtie    --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 0 (0.00%)
-# reads that failed to align: 1 (100.00%)
+# reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
+0.00%)
+# reads that failed to align: 1 (@SQ	SN:0	LN:19
+100.00%)
 No alignments
-@HD	VN:1.0	SO:unsorted
-@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII"
 0	4	*	0	0	*	*	0	0			XM:i:0
 Cline 9 (fw:1, sam:1)
@@ -838,11 +909,11 @@
 ./bowtie    -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 0
-# reads with at least one alignment: 0 (0.00%)
+@HD	VN:1.0	SO:unsorted
+# reads with at least one alignment: 0 (0.00@SQ	SN:0	LN:19
+%)
 # reads that failed to align: 0 (0.00%)
 No alignments
-@HD	VN:1.0	SO:unsorted
-@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII"
 Cline multiread 2 (fw:1, sam:1)
 References:
@@ -855,8 +926,8 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00@SQ	SN:0	LN:19
-%)
+# reads that failed to align: @SQ	SN:0	LN:19
+0 (0.00%)
 Reported 1 alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII"
 0	0	0	3	255	16M	*	0	0	CATCGATCAGTATCTG	IIIIIIIIIIIIIIII	XA:i:0	MD:Z:16	NM:i:0	XM:i:2
@@ -869,11 +940,11 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 2
 # reads with at least one alignment: 2 (@HD	VN:1.0	SO:unsorted
-100.00@SQ	SN:0	LN:19
-%)
+100.00%)
 # reads that failed to align: 0 (0.00%)
-Reported 2 alignments@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG"
-
+Reported 2 alignments
+@SQ	SN:0	LN:19
+@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG"
 0	0	0	3	255	16M	*	0	0	CATCGATCAGTATCTG	IIIIIIIIIIIIIIII	XA:i:0	MD:Z:16	NM:i:0	XM:i:2
 1	0	0	4	255	15M	*	0	0	ATCGATCAGTATCTG	IIIIIIIIIIIIIII	XA:i:0	MD:Z:15	NM:i:0	XM:i:2
 Cline paired 2 (fw:1, sam:1)
@@ -885,12 +956,12 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00@SQ	SN:0	LN:19
-%)
-# reads that failed to align: 0 (0.00%)
+@SQ	SN:0	LN:19
+100.00%)
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII"
-Reported 1 paired-end alignments
-1	163	0	1	255	10M	=	9	19	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
+# reads that failed to align: 0 (0.00%)
+Reported 1	163	0	1	255	10M	=	9	19	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
+1 paired-end alignments
 1	83	0	9	255	11M	=	1	-19	TCAAAAACTGA	IIIIIIIIIII	XA:i:0	MD:Z:11	NM:i:0	XM:i:2
 Cline paired 3 (fw:1, sam:1)
 References:
@@ -898,13 +969,13 @@
 AGCATCGATCAAAAACTGA
 ./bowtie    -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+# reads processed: 1@HD	VN:1.0	SO:unsorted
+
+# reads with at least one alignment: 1 (@SQ	SN:0	LN:19
 100.00%)
 # reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
-@SQ	SN:0	LN:19
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII"
+Reported 1@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII"
+ paired-end alignments
 0	99	0	1	255	10M	=	9	19	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 0	147	0	9	255	11M	=	1	-19	TCAAAAACTGA	IIIIIIIIIII	XA:i:0	MD:Z:11	NM:i:0	XM:i:2
 Cline paired 4 (fw:1, sam:1)
@@ -913,13 +984,13 @@
 AGCATCGATCAAAAACTGA
 ./bowtie    -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
+# reads processed: 1@HD	VN:1.0	SO:unsorted
+
+# reads with at least one alignment: 0 (@SQ	SN:0	LN:19
 0.00%)
-# reads that failed to align: 1 (100.00%)
-@SQ	SN:0	LN:19
+# reads that failed to align: 1 (100.00%)@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII"
+
 No alignments
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII"
 0	77	*	0	0	*	*	0	0			XM:i:0
 0	141	*	0	0	*	*	0	0	GATCAA	IIIIII	XM:i:0
 Fastq 7 (fw:1, sam:1)
@@ -930,11 +1001,11 @@
 ./bowtie    --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
-# reads that failed to align: 0 (0.00%)
+# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+100.00%)
+# reads that failed to align: @SQ	SN:0	LN:19
+0 (0.00%)
 Reported 1 alignments
-@HD	VN:1.0	SO:unsorted
-@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq"
 r0	0	0	3	255	12M	*	0	0	CATCGATCAGTA	IIIIIIIIIIII	XA:i:0	MD:Z:12	NM:i:0	XM:i:2
 Fastq 8 (fw:1, sam:1)
@@ -944,11 +1015,11 @@
 ./bowtie    --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 0 (0.00%)
-# reads that failed to align: 1 (100.00%)
+# reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
+0.00%)
+# reads that failed to align: 1 (@SQ	SN:0	LN:19
+100.00%)
 No alignments
-@HD	VN:1.0	SO:unsorted
-@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq"
 r0	4	*	0	0	*	*	0	0			XM:i:0
 Fastq 9 (fw:1, sam:1)
@@ -959,11 +1030,11 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 0
 # reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
-0.00@SQ	SN:0	LN:19
-%)
-# reads that failed to align: 0 (0.00%)@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq"
-
+0.00%)
+# reads that failed to align: 0 (0.00%)
 No alignments
+@SQ	SN:0	LN:19
+@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq"
 Fastq multiread 2 (fw:1, sam:1)
 References:
 >0
@@ -971,12 +1042,12 @@
 ./bowtie    -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
+# reads with at least one alignment: 1@HD	VN:1.0	SO:unsorted
+ (100.00%)@SQ	SN:0	LN:19
+
 # reads that failed to align: 0 (0.00%)
-Reported 1 alignments
-@SQ	SN:0	LN:19
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq"
+Reported @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq"
+1 alignments
 r0	0	0	3	255	16M	*	0	0	CATCGATCAGTATCTG	IIIIIIIIIIIIIIII	XA:i:0	MD:Z:16	NM:i:0	XM:i:2
 Fastq multiread 3 (fw:1, sam:1)
 References:
@@ -987,9 +1058,9 @@
 # reads processed: 2
 # reads with at least one alignment: 2 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0@SQ	SN:0	LN:19
- (0.00%)
+# reads that failed to align: 0 (0.00%)
 Reported 2 alignments
+@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq"
 r0	0	0	3	255	16M	*	0	0	CATCGATCAGTATCTG	IIIIIIIIIIIIIIII	XA:i:0	MD:Z:16	NM:i:0	XM:i:2
 r1	0	0	4	255	15M	*	0	0	ATCGATCAGTATCTG	IIIIIIIIIIIIIII	XA:i:0	MD:Z:15	NM:i:0	XM:i:2
@@ -1018,9 +1089,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1@SQ	SN:0	LN:19
- paired-end alignments
+# reads that failed to align: 0 (0.00@SQ	SN:0	LN:19
+%)
+Reported 1 paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	1	255	10M	=	9	19	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 r0	147	0	9	255	11M	=	1	-19	TCAAAAACTGA	IIIIIIIIIII	XA:i:0	MD:Z:11	NM:i:0	XM:i:2
@@ -1031,11 +1102,11 @@
 ./bowtie    -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 0 (0.00%)
-# reads that failed to align: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
-No alignments
-@SQ	SN:0	LN:19
+# reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
+0.00%)
+# reads that failed to align: 1 (100.00%)
+No alignments@SQ	SN:0	LN:19
+
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	77	*	0	0	*	*	0	0			XM:i:0
 r0	141	*	0	0	*	*	0	0	GATCAA	IIIIII	XM:i:0
@@ -1049,9 +1120,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 alignments@SQ	SN:0	LN:19
-
+# reads that failed to align: @SQ	SN:0	LN:19
+0 (0.00%)
+Reported 1 alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
 r0	0	0	3	255	12M	*	0	0	CATCGATCAGTA	IIIIIIIIIIII	XA:i:0	MD:Z:12	NM:i:0	XM:i:2
 Fasta 8 (fw:1, sam:1)
@@ -1062,11 +1133,11 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
 # reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
-0.00%)
-# reads that failed to align: 1 (100.00%)@SQ	SN:0	LN:19
-
-No alignments
+0.00@SQ	SN:0	LN:19
+%)
+# reads that failed to align: 1 (100.00%)
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
+No alignments
 r0	4	*	0	0	*	*	0	0			XM:i:0
 Fasta 9 (fw:1, sam:1)
 References:
@@ -1074,23 +1145,23 @@
 AGCATCGATCAGTATCTGA
 ./bowtie    -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 0
-# reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
+# reads processed: 0@HD	VN:1.0	SO:unsorted
+
+# reads with at least one alignment: 0 (@SQ	SN:0	LN:19
 0.00%)
 # reads that failed to align: 0 (0.00%)
-No alignments
-@SQ	SN:0	LN:19
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
+No alignments@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
+
 Fasta multiread 2 (fw:1, sam:1)
 References:
 >0
 AGCATCGATCAGTATCTGA
 ./bowtie    -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)@SQ	SN:0	LN:19
+# reads processed: 1@HD	VN:1.0	SO:unsorted
 
+# reads with at least one alignment: 1 (100.00%)
+@SQ	SN:0	LN:19
 # reads that failed to align: 0 (0.00%)
 Reported 1 alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
@@ -1102,12 +1173,12 @@
 ./bowtie    -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 2
-# reads with at least one alignment: 2 (@HD	VN:1.0	SO:unsorted
-100.00%)
+# reads with at least one alignment: @HD	VN:1.0	SO:unsorted
+2 (100.00@SQ	SN:0	LN:19
+%)
 # reads that failed to align: 0 (0.00%)
-Reported 2 alignments
-@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
+Reported 2 alignments
 r0	0	0	3	255	16M	*	0	0	CATCGATCAGTATCTG	IIIIIIIIIIIIIIII	XA:i:0	MD:Z:16	NM:i:0	XM:i:2
 r1	0	0	4	255	15M	*	0	0	ATCGATCAGTATCTG	IIIIIIIIIIIIIII	XA:i:0	MD:Z:15	NM:i:0	XM:i:2
 Fasta paired 2 (fw:1, sam:1)
@@ -1134,9 +1205,9 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
-# reads that failed to align: 0 (0.00%)@SQ	SN:0	LN:19
-
+100.00@SQ	SN:0	LN:19
+%)
+# reads that failed to align: 0 (0.00%)
 Reported 1 paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa"
 r0	99	0	1	255	10M	=	9	19	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
@@ -1148,11 +1219,11 @@
 ./bowtie    -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
-0.00%)
-# reads that failed to align: 1 (100.00%)
+# reads with at least one alignment: @HD	VN:1.0	SO:unsorted
+0 (0.00%)
+# reads that failed to align: 1 (@SQ	SN:0	LN:19
+100.00%)
 No alignments
-@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa"
 0	77	*	0	0	*	*	0	0			XM:i:0
 0	141	*	0	0	*	*	0	0	GATCAA	IIIIII	XM:i:0
@@ -1166,8 +1237,8 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00@SQ	SN:0	LN:19
-%)
+# reads that failed to align: 0 (0.00%)@SQ	SN:0	LN:19
+
 Reported 1 alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw"
 0	0	0	3	255	12M	*	0	0	CATCGATCAGTA	IIIIIIIIIIII	XA:i:0	MD:Z:12	NM:i:0	XM:i:2
@@ -1178,12 +1249,12 @@
 ./bowtie    --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
-0.00%)
+@HD	VN:1.0	SO:unsorted
+# reads with at least one alignment: 0 (0.00%)@SQ	SN:0	LN:19
+
 # reads that failed to align: 1 (100.00%)
-@SQ	SN:0	LN:19
-No alignments
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw"
+No alignments@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw"
+
 0	4	*	0	0	*	*	0	0			XM:i:0
 Raw 9 (fw:1, sam:1)
 References:
@@ -1192,11 +1263,11 @@
 ./bowtie    -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 0
-# reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
-0.00%)
-# reads that failed to align: 0 (0.00%)
+@HD	VN:1.0	SO:unsorted
+# reads with at least one alignment: 0 (0.00%)
+# reads that failed to align: 0 (0.00@SQ	SN:0	LN:19
+%)
 No alignments
-@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw"
 Raw multiread 2 (fw:1, sam:1)
 References:
@@ -1206,11 +1277,11 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00@SQ	SN:0	LN:19
-%)
+100.00%)
 # reads that failed to align: 0 (0.00%)
+Reported 1@SQ	SN:0	LN:19
+ alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw"
-Reported 1 alignments
 0	0	0	3	255	16M	*	0	0	CATCGATCAGTATCTG	IIIIIIIIIIIIIIII	XA:i:0	MD:Z:16	NM:i:0	XM:i:2
 Raw multiread 3 (fw:1, sam:1)
 References:
@@ -1219,12 +1290,12 @@
 ./bowtie    -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 2
-# reads with at least one alignment: 2 (@HD	VN:1.0	SO:unsorted
-100.00%)
+@HD	VN:1.0	SO:unsorted
+# reads with at least one alignment: 2 (100.00@SQ	SN:0	LN:19
+%)
 # reads that failed to align: 0 (0.00%)
-Reported 2 alignments
-@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw"
+Reported 2 alignments
 0	0	0	3	255	16M	*	0	0	CATCGATCAGTATCTG	IIIIIIIIIIIIIIII	XA:i:0	MD:Z:16	NM:i:0	XM:i:2
 1	0	0	4	255	15M	*	0	0	ATCGATCAGTATCTG	IIIIIIIIIIIIIII	XA:i:0	MD:Z:15	NM:i:0	XM:i:2
 Raw paired 2 (fw:1, sam:1)
@@ -1237,9 +1308,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
+# reads that failed to align: 0 (0.00%)@SQ	SN:0	LN:19
+
 Reported 1 paired-end alignments
-@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw"
 1	163	0	1	255	10M	=	9	19	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 1	83	0	9	255	11M	=	1	-19	TCAAAAACTGA	IIIIIIIIIII	XA:i:0	MD:Z:11	NM:i:0	XM:i:2
@@ -1252,9 +1323,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00@SQ	SN:0	LN:19
-%)
-Reported 1 paired-end alignments
+# reads that failed to align: 0 (0.00%)
+Reported 1 paired-end alignments@SQ	SN:0	LN:19
+
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw"
 0	99	0	1	255	10M	=	9	19	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 0	147	0	9	255	11M	=	1	-19	TCAAAAACTGA	IIIIIIIIIII	XA:i:0	MD:Z:11	NM:i:0	XM:i:2
@@ -1267,9 +1338,9 @@
 # reads processed: 1
 # reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
 0.00%)
-# reads that failed to align: 1 (100.00%)@SQ	SN:0	LN:19
+# reads that failed to align: 1 (100.00%)
+No alignments@SQ	SN:0	LN:19
 
-No alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw"
 0	77	*	0	0	*	*	0	0			XM:i:0
 0	141	*	0	0	*	*	0	0	GATCAA	IIIIII	XM:i:0
@@ -1280,13 +1351,13 @@
 ./bowtie-build  --quiet  .simple_tests.pl.fa .simple_tests.tmp
 ./bowtie    --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+# reads processed: 1@HD	VN:1.0	SO:unsorted
+
+# reads with at least one alignment: 1 (@SQ	SN:0	LN:19
 100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported @SQ	SN:0	LN:19
-1 alignments
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
+# reads that failed to align: 0 (0.00%)@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
+
+Reported 1 alignments
 r0	0	0	3	255	12M	*	0	0	CATCGATCAGTA	IIIIIIIIIIII	XA:i:0	MD:Z:12	NM:i:0	XM:i:2
 Tabbed 8 (fw:1, sam:1)
 References:
@@ -1309,25 +1380,25 @@
 ./bowtie    -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 0
-# reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
+# reads with at least one alignment: 0@HD	VN:1.0	SO:unsorted
+ (@SQ	SN:0	LN:19
 0.00%)
-# reads that failed to align: 0 (0.00%)@SQ	SN:0	LN:19
-
-No alignments
+# reads that failed to align: 0 (0.00%)
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
+No alignments
 Tabbed multiread 2 (fw:1, sam:1)
 References:
 >0
 AGCATCGATCAGTATCTGA
 ./bowtie    -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+# reads processed: @HD	VN:1.0	SO:unsorted
+1
+# reads with at least one alignment: 1 (@SQ	SN:0	LN:19
 100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1@SQ	SN:0	LN:19
- alignments
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
+# reads that failed to align: 0 (@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
+0.00%)
+Reported 1 alignments
 r0	0	0	3	255	16M	*	0	0	CATCGATCAGTATCTG	IIIIIIIIIIIIIIII	XA:i:0	MD:Z:16	NM:i:0	XM:i:2
 Tabbed multiread 3 (fw:1, sam:1)
 References:
@@ -1354,9 +1425,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-@SQ	SN:0	LN:19
 # reads that failed to align: 0 (0.00%)
 Reported 1 paired-end alignments
+@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
 r1	163	0	1	255	10M	=	9	19	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 r1	83	0	9	255	11M	=	1	-19	TCAAAAACTGA	IIIIIIIIIII	XA:i:0	MD:Z:11	NM:i:0	XM:i:2
@@ -1370,8 +1441,8 @@
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
 # reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
 @SQ	SN:0	LN:19
+Reported 1 paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
 r0	99	0	1	255	10M	=	9	19	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 r0	147	0	9	255	11M	=	1	-19	TCAAAAACTGA	IIIIIIIIIII	XA:i:0	MD:Z:11	NM:i:0	XM:i:2
@@ -1384,8 +1455,8 @@
 # reads processed: 1
 # reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
 0.00%)
-# reads that failed to align: 1 (@SQ	SN:0	LN:19
-100.00%)
+# reads that failed to align: 1 (100.00@SQ	SN:0	LN:19
+%)
 No alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
 r0	77	*	0	0	*	*	0	0			XM:i:0
@@ -1399,9 +1470,9 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00@SQ	SN:0	LN:25
-%)
-# reads that failed to align: 0 (0.00%)
+100.00%)
+# reads that failed to align: 0 (0.00%)@SQ	SN:0	LN:25
+
 Reported 1 paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq"
 r0	99	0	3	255	8M	=	17	21	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -1415,9 +1486,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (@SQ	SN:0	LN:25
-0.00%)
-Reported 1 paired-end alignments
+# reads that failed to align: 0 (0.00%)
+Reported 1@SQ	SN:0	LN:25
+ paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	3	255	8M	=	17	21	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	147	0	17	255	7M	=	3	-21	TAGATGG	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
@@ -1431,8 +1502,8 @@
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
 # reads that failed to align: 0 (0.00%)
-Reported @SQ	SN:0	LN:25
-1 paired-end alignments
+@SQ	SN:0	LN:25
+Reported 1 paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	17	21	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	83	0	17	255	7M	=	3	-21	TAGATGG	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
@@ -1444,11 +1515,11 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
+100.00%)@SQ	SN:0	LN:25
+
 # reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
-@SQ	SN:0	LN:25
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
+Reported 1 paired-end alignments@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
+
 r0	99	0	3	255	8M	=	17	21	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	147	0	17	255	7M	=	3	-21	TAGATGG	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
 Paired-end 1 (fw:0, sam:1)
@@ -1460,10 +1531,10 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
-@SQ	SN:0	LN:25
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
+# reads that failed to align: @SQ	SN:0	LN:25
+0 (0.00%)
+Reported 1 paired-end alignments@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
+
 r0	163	0	3	255	8M	=	17	21	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	83	0	17	255	7M	=	3	-21	TAGATGG	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
 Paired-end 2 (fw:1, sam:1)
@@ -1474,11 +1545,11 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
+100.00@SQ	SN:0	LN:25
+%)
 # reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
-@SQ	SN:0	LN:25
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
+Reported @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
+1 paired-end alignments
 r0	99	0	3	255	8M	=	12	16	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	147	0	12	255	7M	=	3	-16	TTTTATA	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
 Paired-end 2 (fw:0, sam:1)
@@ -1488,12 +1559,12 @@
 ./bowtie    -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+@HD	VN:1.0	SO:unsorted
+# reads with at least one alignment: 1 (@SQ	SN:0	LN:25
 100.00%)
 # reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
-@SQ	SN:0	LN:25
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
+Reported @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
+1 paired-end alignments
 r0	163	0	3	255	8M	=	12	16	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	83	0	12	255	7M	=	3	-16	TTTTATA	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
 Paired-end 2 (fw:1, sam:1)
@@ -1506,8 +1577,8 @@
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
 # reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
 @SQ	SN:0	LN:25
+Reported 1 paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	3	255	8M	=	12	16	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	147	0	12	255	7M	=	3	-16	TTTTATA	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
@@ -1518,10 +1589,10 @@
 ./bowtie    -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
-# reads that failed to align: @SQ	SN:0	LN:25
-0 (0.00%)
+# reads with at least one alignment: @HD	VN:1.0	SO:unsorted
+1 (100.00%)
+@SQ	SN:0	LN:25
+# reads that failed to align: 0 (0.00%)
 Reported 1 paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	12	16	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -1535,9 +1606,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
+# reads that failed to align: 0 (@SQ	SN:0	LN:25
+0.00%)
 Reported 1 paired-end alignments
-@SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	3	255	8M	=	8	12	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	147	0	8	255	7M	=	3	-12	AAGCTTT	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
@@ -1548,11 +1619,11 @@
 ./bowtie    -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
-# reads that failed to align: 0 (0.00%)
+# reads with at least one alignment: 1@HD	VN:1.0	SO:unsorted
+ (100.00%)
+# reads that failed to align: 0 (@SQ	SN:0	LN:25
+0.00%)
 Reported 1 paired-end alignments
-@SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	8	12	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	83	0	8	255	7M	=	3	-12	AAGCTTT	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
@@ -1562,12 +1633,12 @@
 AAAACGAAAGCTTTTATAGATGGGG
 ./bowtie    -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
-# reads that failed to align: 0 (0.00%)
+# reads processed: @HD	VN:1.0	SO:unsorted
+1
+# reads with at least one alignment: 1 (100.00%)
+# reads that failed to align: 0 (@SQ	SN:0	LN:25
+0.00%)
 Reported 1 paired-end alignments
-@SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	3	255	8M	=	8	12	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	147	0	8	255	7M	=	3	-12	AAGCTTT	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
@@ -1577,13 +1648,13 @@
 AAAACGAAAGCTTTTATAGATGGGG
 ./bowtie    -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
+# reads processed: 1@HD	VN:1.0	SO:unsorted
+
+# reads with at least one alignment: 1 (100.00@SQ	SN:0	LN:25
+%)
 # reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
-@SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
+Reported 1 paired-end alignments
 r0	163	0	3	255	8M	=	8	12	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	83	0	8	255	7M	=	3	-12	AAGCTTT	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
 Paired-end 4, containment excluded (fw:1, sam:1)
@@ -1608,11 +1679,11 @@
 ./bowtie    -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
-0.00%)
-# reads that failed to align: 1 (100.00%)
+# reads with at least one alignment: @HD	VN:1.0	SO:unsorted
+0 (0.00%)
+# reads that failed to align: 1 (@SQ	SN:0	LN:25
+100.00%)
 No alignments
-@SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	77	*	0	0	*	*	0	0	CTTTCGT	IIIIIII	XM:i:0
 r0	141	*	0	0	*	*	0	0	AACGAAAG	IIIIIIII	XM:i:0
@@ -1625,9 +1696,9 @@
 # reads processed: 1
 # reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
 0.00%)
-# reads that failed to align: 1 (100.00%)
-No alignments@SQ	SN:0	LN:25
-
+# reads that failed to align: 1 (@SQ	SN:0	LN:25
+100.00%)
+No alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	77	*	0	0	*	*	0	0	AACGAAAG	IIIIIIII	XM:i:0
 r0	141	*	0	0	*	*	0	0	CTTTCGT	IIIIIII	XM:i:0
@@ -1653,12 +1724,12 @@
 ./bowtie    --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+@HD	VN:1.0	SO:unsorted
+# reads with at least one alignment: 1 (@SQ	SN:0	LN:25
 100.00%)
-# reads that failed to align: 0 (@SQ	SN:0	LN:25
-0.00%)
-Reported 1 paired-end alignments
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
+# reads that failed to align: 0 (0.00%)
+Reported @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
+1 paired-end alignments
 r0	99	0	3	255	8M	=	4	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	147	0	4	255	7M	=	3	-8	ACGAAAG	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
 Paired-end 5, allow contain (fw:0, sam:1)
@@ -1671,8 +1742,8 @@
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
 # reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
-@SQ	SN:0	LN:25
+Reported @SQ	SN:0	LN:25
+1 paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	4	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	83	0	4	255	7M	=	3	-8	ACGAAAG	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
@@ -1683,13 +1754,13 @@
 ./bowtie    --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+# reads with at least one alignment: @HD	VN:1.0	SO:unsorted
+1 (@SQ	SN:0	LN:25
 100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
-@SQ	SN:0	LN:25
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
-r0	99	0	3	255	8M	=	4	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
+# reads that failed to align: 0@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
+ (0.00%)
+Reported 1r0	99	0	3	255	8M	=	4	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
+ paired-end alignments
 r0	147	0	4	255	7M	=	3	-8	ACGAAAG	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
 Paired-end 5, allow contain (fw:0, sam:1)
 References:
@@ -1697,14 +1768,14 @@
 AAAACGAAAGCTTTTATAGATGGGG
 ./bowtie    --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+# reads processed: 1@HD	VN:1.0	SO:unsorted
+
+# reads with at least one alignment: 1 (@SQ	SN:0	LN:25
 100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
-@SQ	SN:0	LN:25
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
+# reads that failed to align: 0 (@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	4	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
+0.00%)
+Reported 1 paired-end alignments
 r0	83	0	4	255	7M	=	3	-8	ACGAAAG	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
 Paired-end 6, allow contain (fw:1, sam:1)
 References:
@@ -1731,8 +1802,8 @@
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
 # reads that failed to align: 0 (0.00%)
-@SQ	SN:0	LN:25
-Reported 1 paired-end alignments
+Reported 1@SQ	SN:0	LN:25
+ paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	83	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -1761,8 +1832,8 @@
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
 # reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
 @SQ	SN:0	LN:25
+Reported 1 paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	83	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -1791,8 +1862,8 @@
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
 # reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
-@SQ	SN:0	LN:25
+Reported 1@SQ	SN:0	LN:25
+ paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	83	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -1803,12 +1874,12 @@
 ./bowtie    --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+@HD	VN:1.0	SO:unsorted
+# reads with at least one alignment: 1 (@SQ	SN:0	LN:25
 100.00%)
-# reads that failed to align: 0 (0.00%)
+# reads that failed to align: 0 (0.00%)@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
+
 Reported 1 paired-end alignments
-@SQ	SN:0	LN:25
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	147	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 Paired-end 7, allow contain (fw:0, sam:1)
@@ -1821,8 +1892,8 @@
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
 # reads that failed to align: 0 (0.00%)
-@SQ	SN:0	LN:25
 Reported 1 paired-end alignments
+@SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	83	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -1851,8 +1922,8 @@
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
 # reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
-@SQ	SN:0	LN:25
+Reported 1@SQ	SN:0	LN:25
+ paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	67	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	131	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -1864,11 +1935,11 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)@SQ	SN:0	LN:25
-
-# reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
-
+100.00%)
+# reads that failed to align: 0 (@SQ	SN:0	LN:25
+0.00%)
+Reported 1 paired-end alignments
+@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	67	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	131	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 Paired-end 8, allow contain (fw:0, sam:1)
@@ -1878,10 +1949,10 @@
 ./bowtie    --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
+# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 paired-end alignments
-@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	67	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -1895,9 +1966,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
+# reads that failed to align: 0@SQ	SN:0	LN:25
+ (0.00%)
 Reported 1 paired-end alignments
-@SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	67	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	131	0	3	255	8M	=	3	8	AACGATAG	IIIIIIII	XA:i:1	MD:Z:5A2	NM:i:1	XM:i:2
@@ -1910,8 +1981,8 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
-@SQ	SN:0	LN:25
+# reads that failed to align: 0 (0.00@SQ	SN:0	LN:25
+%)
 Reported 1 paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	67	0	3	255	8M	=	3	8	AACGATAG	IIIIIIII	XA:i:1	MD:Z:5A2	NM:i:1	XM:i:2
@@ -1923,11 +1994,11 @@
 ./bowtie    --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
-# reads that failed to align: 0 (0.00%)
+# reads with at least one alignment: 1@HD	VN:1.0	SO:unsorted
+ (100.00%)
+# reads that failed to align: @SQ	SN:0	LN:25
+0 (0.00%)
 Reported 1 paired-end alignments
-@SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	67	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	131	0	3	255	8M	=	3	8	AACGATAG	IIIIIIII	XA:i:1	MD:Z:5A2	NM:i:1	XM:i:2
@@ -1955,10 +2026,10 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
+100.00@SQ	SN:0	LN:16
+%)
 # reads that failed to align: 0 (0.00%)
 Reported 2 alignments
-@SQ	SN:0	LN:16
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	0	0	1	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:3
 r0	0	0	9	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:3
@@ -1972,9 +2043,9 @@
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
 # reads that failed to align: @SQ	SN:0	LN:16
-0 (0.00%)
+0 (0.00%)@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
+
 Reported 2 alignments
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	16	0	9	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:3
 r0	16	0	1	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:3
 Checking -m, 1 (fw:1, sam:1)
@@ -1986,8 +2057,8 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00@SQ	SN:0	LN:16
-%)
+100.00%)
+@SQ	SN:0	LN:16
 # reads that failed to align: 0 (0.00%)
 Reported 2 alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
@@ -2002,9 +2073,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
+# reads that failed to align: 0@SQ	SN:0	LN:16
+ (0.00%)
 Reported 2 alignments
-@SQ	SN:0	LN:16
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	16	0	9	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:3
 r0	16	0	1	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:3
@@ -2018,9 +2089,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
+@SQ	SN:0	LN:24
 # reads that failed to align: 0 (0.00%)
-# reads with alignments suppressed due to -m: 1 (@SQ	SN:0	LN:24
-100.00%)
+# reads with alignments suppressed due to -m: 1 (100.00%)
 No alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
 Checking -m, 2 (fw:0, sam:1)
@@ -2030,11 +2101,11 @@
 ./bowtie    -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
+# reads with at least one alignment: 1@HD	VN:1.0	SO:unsorted
+ (100.00%)
 # reads that failed to align: 0 (0.00%)
-# reads with alignments suppressed due to -m: 1 (100.00@SQ	SN:0	LN:24
-%)
+# reads with alignments suppressed due to -m: 1 (@SQ	SN:0	LN:24
+100.00%)
 No alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
 Checking -m, 2 (fw:1, sam:1)
@@ -2045,12 +2116,12 @@
 ./bowtie    -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
+# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+100.00%)
 # reads that failed to align: 0 (0.00%)
-# reads with alignments suppressed due to -m: 1 (100.00%)
+# reads with alignments suppressed due to -m: @SQ	SN:0	LN:24
+1 (100.00%)
 No alignments
-@HD	VN:1.0	SO:unsorted
-@SQ	SN:0	LN:24
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
 Checking -m, 2 (fw:0, sam:1)
 References:
@@ -2062,8 +2133,8 @@
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
 # reads that failed to align: 0 (0.00%)
-# reads with alignments suppressed due to -m: 1 (100.00@SQ	SN:0	LN:24
-%)
+# reads with alignments suppressed due to -m: @SQ	SN:0	LN:24
+1 (100.00%)
 No alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
 Checking edits 1 (fw:1, sam:1)
@@ -2077,8 +2148,8 @@
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
 # reads that failed to align: 0 (0.00%)
-Reported 1 alignments
-@SQ	SN:0	LN:8
+Reported 1 alignments@SQ	SN:0	LN:8
+
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	0	0	1	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:2	MD:Z:3C0C3	NM:i:2	XM:i:2
 Checking edits 1 (fw:0, sam:1)
@@ -2090,8 +2161,8 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: @SQ	SN:0	LN:8
-0 (0.00%)
+# reads that failed to align: 0 (0.00%)
+@SQ	SN:0	LN:8
 Reported 1 alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	16	0	1	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:2	MD:Z:3C0C3	NM:i:2	XM:i:2
@@ -2105,9 +2176,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 alignments@SQ	SN:0	LN:8
-
+# reads that failed to align: 0 (@SQ	SN:0	LN:8
+0.00%)
+Reported 1 alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	0	0	1	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:2	MD:Z:3C0C3	NM:i:2	XM:i:2
 Checking edits 1 (fw:0, sam:1)
@@ -2117,11 +2188,11 @@
 ./bowtie    -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
+# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+100.00@SQ	SN:0	LN:8
+%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 alignments
-@HD	VN:1.0	SO:unsorted
-@SQ	SN:0	LN:8
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	16	0	1	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:2	MD:Z:3C0C3	NM:i:2	XM:i:2
 Checking edits 2 (fw:1, sam:1)
@@ -2133,11 +2204,11 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
+100.00@SQ	SN:0	LN:8
+%)
 # reads that failed to align: 0 (0.00%)
-Reported 1 alignments
-@SQ	SN:0	LN:8
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
+Reported 1 alignments@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
+
 r0	16	0	1	255	8M	*	0	0	TTGCCCGT	IIIIIIII	XA:i:2	MD:Z:3T0T3	NM:i:2	XM:i:2
 Checking edits 2 (fw:0, sam:1)
 References:
@@ -2148,8 +2219,8 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0@SQ	SN:0	LN:8
- (0.00%)
+# reads that failed to align: 0 (@SQ	SN:0	LN:8
+0.00%)
 Reported 1 alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	0	0	1	255	8M	*	0	0	TTGCCCGT	IIIIIIII	XA:i:2	MD:Z:3T0T3	NM:i:2	XM:i:2
@@ -2162,11 +2233,11 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+@SQ	SN:0	LN:8
 100.00%)
 # reads that failed to align: 0 (0.00%)
-Reported 1 alignments
-@SQ	SN:0	LN:8
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
+Reported 1 alignments
 r0	16	0	1	255	8M	*	0	0	TTGCCCGT	IIIIIIII	XA:i:2	MD:Z:3T0T3	NM:i:2	XM:i:2
 Checking edits 2 (fw:0, sam:1)
 References:
@@ -2176,11 +2247,11 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+@SQ	SN:0	LN:8
 100.00%)
-# reads that failed to align: 0@SQ	SN:0	LN:8
- (0.00%)
-Reported 1 alignments
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
+# reads that failed to align: 0 (0.00%)
+Reported 1 alignments@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
+
 r0	0	0	1	255	8M	*	0	0	TTGCCCGT	IIIIIIII	XA:i:2	MD:Z:3T0T3	NM:i:2	XM:i:2
 Checking edits 3 (fw:1, sam:1)
 References:
@@ -2192,9 +2263,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported @SQ	SN:0	LN:8
-1 alignments
+# reads that failed to align: 0 (0.00@SQ	SN:0	LN:8
+%)
+Reported 1 alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	0	0	3	255	4M	*	0	0	GTTC	IIII	XA:i:0	MD:Z:4	NM:i:0	XM:i:2
 Checking edits 3 (fw:0, sam:1)
@@ -2204,13 +2275,13 @@
 ./bowtie    -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: @HD	VN:1.0	SO:unsorted
-1@SQ	SN:0	LN:8
- (@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
-r0	16	0	3	255	4M	*	0	0	GTTC	IIII	XA:i:0	MD:Z:4	NM:i:0	XM:i:2
+# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
+# reads that failed to align: 0 (0.00@SQ	SN:0	LN:8
+%)
 Reported 1 alignments
+@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
+r0	16	0	3	255	4M	*	0	0	GTTC	IIII	XA:i:0	MD:Z:4	NM:i:0	XM:i:2
 Checking edits 3 (fw:1, sam:1)
 References:
 >0
@@ -2220,9 +2291,9 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-@SQ	SN:0	LN:8
 100.00%)
-# reads that failed to align: 0 (0.00%)
+# reads that failed to align: 0 (@SQ	SN:0	LN:8
+0.00%)
 Reported 1 alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	0	0	3	255	4M	*	0	0	GTTC	IIII	XA:i:0	MD:Z:4	NM:i:0	XM:i:2
@@ -2233,11 +2304,11 @@
 ./bowtie    -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
+# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+@SQ	SN:0	LN:8
+100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 alignments
-@HD	VN:1.0	SO:unsorted
-@SQ	SN:0	LN:8
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	16	0	3	255	4M	*	0	0	GTTC	IIII	XA:i:0	MD:Z:4	NM:i:0	XM:i:2
 FASTA-continuous 1 (fw:1, sam:1)
@@ -2249,11 +2320,11 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 2
 # reads with at least one alignment: 2 (@HD	VN:1.0	SO:unsorted
-100.00%)
+100.00@SQ	SN:0	LN:19
+%)
 # reads that failed to align: 0 (0.00%)
-Reported 2 alignments@SQ	SN:0	LN:19
-
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests"
+Reported 2@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests"
+ alignments
 seq1_0	0	0	1	255	10M	*	0	0	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 seq1_9	0	0	10	255	10M	*	0	0	CAGTATCTGA	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 FASTA-continuous 2 (fw:1, sam:1)
@@ -2264,11 +2335,11 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 3
 # reads with at least one alignment: 3 (@HD	VN:1.0	SO:unsorted
-100.00@SQ	SN:0	LN:19
-%)
+100.00%)@SQ	SN:0	LN:19
+
 # reads that failed to align: 0 (0.00%)
-Reported 3 alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests"
+Reported 3 alignments
 seq1_0	0	0	1	255	10M	*	0	0	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 seq2_0	0	0	1	255	10M	*	0	0	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 seq2_9	0	0	10	255	10M	*	0	0	CAGTATCTGA	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
@@ -2281,8 +2352,8 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: @SQ	SN:0	LN:19
-0 (0.00%)
+# reads that failed to align: 0 (@SQ	SN:0	LN:19
+0.00%)
 Reported 1 alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests"
 seq1_0	0	0	1	255	10M	*	0	0	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
@@ -2293,11 +2364,11 @@
 ./bowtie   --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp  .simple_tests
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
-# reads that failed to align: 0 (0.00%)
+# reads with at least one alignment: 1@HD	VN:1.0	SO:unsorted
+ (100.00%)
+# reads that failed to align: @SQ	SN:0	LN:19
+0 (0.00%)
 Reported 1 alignments
-@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests"
 seq1_9	0	0	10	255	10M	*	0	0	CAGTATCTGA	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 FASTA-continuous 5 (fw:1, sam:1)
@@ -2322,11 +2393,11 @@
 ./bowtie   --large-index -F 10,1 -S --quiet -a .simple_tests.tmp  .simple_tests
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 3
-# reads with at least one alignment: 3 (100.00%)
-# reads that failed to align: 0 (0.00%)
+# reads with at least one alignment: 3 (@HD	VN:1.0	SO:unsorted
+100.00%)
+# reads that failed to align: 0 (@SQ	SN:0	LN:12
+0.00%)
 Reported 3 alignments
-@HD	VN:1.0	SO:unsorted
-@SQ	SN:0	LN:12
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests"
 seq1_0	0	0	1	255	10M	*	0	0	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 seq1_1	0	0	2	255	10M	*	0	0	GCATCGATCA	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
@@ -2340,12 +2411,12 @@
 
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
+# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+100.00@SQ	SN:0	LN:19
+%)
 # reads that failed to align: 0 (0.00%)
-Reported 1 alignments
-@HD	VN:1.0	SO:unsorted
-@SQ	SN:0	LN:19
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII"
+Reported @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII"
+1 alignments
 0	0	0	3	255	12M	*	0	0	CATCGATCAGTA	IIIIIIIIIIII	XA:i:0	MD:Z:12	NM:i:0	XM:i:2
 Cline 8 (fw:1, sam:1)
 References:
@@ -2368,11 +2439,11 @@
 ./bowtie   --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 0
-# reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
-0.00%)
+# reads with at least one alignment: @HD	VN:1.0	SO:unsorted
+0 (0.00%)
 # reads that failed to align: 0 (0.00%)
-No alignments@SQ	SN:0	LN:19
-
+No alignments
+@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII"
 Cline multiread 2 (fw:1, sam:1)
 References:
@@ -2383,11 +2454,11 @@
 
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
-# reads that failed to align: 0 (0.00@SQ	SN:0	LN:19
-%)
-Reported 1 alignments
+# reads with at least one alignment: @HD	VN:1.0	SO:unsorted
+1 (100.00%)
+# reads that failed to align: 0 (0.00%)
+Reported 1 alignments@SQ	SN:0	LN:19
+
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII"
 0	0	0	3	255	16M	*	0	0	CATCGATCAGTATCTG	IIIIIIIIIIIIIIII	XA:i:0	MD:Z:16	NM:i:0	XM:i:2
 Cline multiread 3 (fw:1, sam:1)
@@ -2400,9 +2471,9 @@
 # reads processed: 2
 # reads with at least one alignment: 2 (@HD	VN:1.0	SO:unsorted
 100.00%)
+@SQ	SN:0	LN:19
 # reads that failed to align: 0 (0.00%)
 Reported 2 alignments
-@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG"
 0	0	0	3	255	16M	*	0	0	CATCGATCAGTATCTG	IIIIIIIIIIIIIIII	XA:i:0	MD:Z:16	NM:i:0	XM:i:2
 1	0	0	4	255	15M	*	0	0	ATCGATCAGTATCTG	IIIIIIIIIIIIIII	XA:i:0	MD:Z:15	NM:i:0	XM:i:2
@@ -2416,9 +2487,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments@SQ	SN:0	LN:19
-
+# reads that failed to align: 0 (@SQ	SN:0	LN:19
+0.00%)
+Reported 1 paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII"
 1	163	0	1	255	10M	=	9	19	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 1	83	0	9	255	11M	=	1	-19	TCAAAAACTGA	IIIIIIIIIII	XA:i:0	MD:Z:11	NM:i:0	XM:i:2
@@ -2431,8 +2502,8 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
-@SQ	SN:0	LN:19
+# reads that failed to align: 0 (@SQ	SN:0	LN:19
+0.00%)
 Reported 1 paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII"
 0	99	0	1	255	10M	=	9	19	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
@@ -2462,9 +2533,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
+# reads that failed to align: 0 (0.00@SQ	SN:0	LN:19
+%)
 Reported 1 alignments
-@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq"
 r0	0	0	3	255	12M	*	0	0	CATCGATCAGTA	IIIIIIIIIIII	XA:i:0	MD:Z:12	NM:i:0	XM:i:2
 Fastq 8 (fw:1, sam:1)
@@ -2490,8 +2561,8 @@
 # reads processed: 0
 # reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
 0.00%)
-# reads that failed to align: 0 (0.00@SQ	SN:0	LN:19
-%)
+# reads that failed to align: 0 (@SQ	SN:0	LN:19
+0.00%)
 No alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq"
 Fastq multiread 2 (fw:1, sam:1)
@@ -2531,11 +2602,11 @@
 ./bowtie   --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
+# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+100.00%)
 # reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
-@HD	VN:1.0	SO:unsorted
-@SQ	SN:0	LN:19
+Reported 1@SQ	SN:0	LN:19
+ paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r1	163	0	1	255	10M	=	9	19	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 r1	83	0	9	255	11M	=	1	-19	TCAAAAACTGA	IIIIIIIIIII	XA:i:0	MD:Z:11	NM:i:0	XM:i:2
@@ -2564,8 +2635,8 @@
 # reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
 0.00%)
 # reads that failed to align: 1 (100.00%)
-No alignments
-@SQ	SN:0	LN:19
+No alignments@SQ	SN:0	LN:19
+
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	77	*	0	0	*	*	0	0			XM:i:0
 r0	141	*	0	0	*	*	0	0	GATCAA	IIIIII	XM:i:0
@@ -2578,8 +2649,8 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00@SQ	SN:0	LN:19
-%)
+100.00%)
+@SQ	SN:0	LN:19
 # reads that failed to align: 0 (0.00%)
 Reported 1 alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
@@ -2607,9 +2678,9 @@
 # reads processed: 0
 # reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
 0.00%)
-# reads that failed to align: 0 (0.00%)@SQ	SN:0	LN:19
-
+# reads that failed to align: 0 (0.00%)
 No alignments
+@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
 Fasta multiread 2 (fw:1, sam:1)
 References:
@@ -2620,9 +2691,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (@SQ	SN:0	LN:19
-0.00%)
+# reads that failed to align: 0 (0.00%)
 Reported 1 alignments
+@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
 r0	0	0	3	255	16M	*	0	0	CATCGATCAGTATCTG	IIIIIIIIIIIIIIII	XA:i:0	MD:Z:16	NM:i:0	XM:i:2
 Fasta multiread 3 (fw:1, sam:1)
@@ -2635,8 +2706,8 @@
 # reads with at least one alignment: 2 (@HD	VN:1.0	SO:unsorted
 100.00%)
 # reads that failed to align: 0 (0.00%)
-Reported 2@SQ	SN:0	LN:19
- alignments
+Reported 2 alignments
+@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
 r0	0	0	3	255	16M	*	0	0	CATCGATCAGTATCTG	IIIIIIIIIIIIIIII	XA:i:0	MD:Z:16	NM:i:0	XM:i:2
 r1	0	0	4	255	15M	*	0	0	ATCGATCAGTATCTG	IIIIIIIIIIIIIII	XA:i:0	MD:Z:15	NM:i:0	XM:i:2
@@ -2651,8 +2722,8 @@
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
 # reads that failed to align: 0 (0.00%)
-Reported @SQ	SN:0	LN:19
-1 paired-end alignments
+Reported 1 paired-end alignments
+@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa"
 r1	163	0	1	255	9M	=	9	19	AGCATCGAT	IIIIIIIII	XA:i:0	MD:Z:9	NM:i:0	XM:i:2
 r1	83	0	9	255	11M	=	1	-19	TCAAAAACTGA	IIIIIIIIIII	XA:i:0	MD:Z:11	NM:i:0	XM:i:2
@@ -2666,8 +2737,8 @@
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
 # reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments@SQ	SN:0	LN:19
-
+Reported 1 paired-end alignments
+@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa"
 r0	99	0	1	255	10M	=	9	19	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 r0	147	0	9	255	11M	=	1	-19	TCAAAAACTGA	IIIIIIIIIII	XA:i:0	MD:Z:11	NM:i:0	XM:i:2
@@ -2680,9 +2751,9 @@
 # reads processed: 1
 # reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
 0.00%)
-# reads that failed to align: 1 (@SQ	SN:0	LN:19
-100.00%)
+# reads that failed to align: 1 (100.00%)
 No alignments
+@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa"
 0	77	*	0	0	*	*	0	0			XM:i:0
 0	141	*	0	0	*	*	0	0	GATCAA	IIIIII	XM:i:0
@@ -2694,10 +2765,10 @@
 ./bowtie   --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
+# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 alignments
-@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw"
 0	0	0	3	255	12M	*	0	0	CATCGATCAGTA	IIIIIIIIIIII	XA:i:0	MD:Z:12	NM:i:0	XM:i:2
@@ -2711,8 +2782,8 @@
 # reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
 0.00%)
 # reads that failed to align: 1 (100.00%)
-No alignments@SQ	SN:0	LN:19
-
+No alignments
+@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw"
 0	4	*	0	0	*	*	0	0			XM:i:0
 Raw 9 (fw:1, sam:1)
@@ -2737,9 +2808,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00@SQ	SN:0	LN:19
-%)
+# reads that failed to align: 0 (0.00%)
 Reported 1 alignments
+@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw"
 0	0	0	3	255	16M	*	0	0	CATCGATCAGTATCTG	IIIIIIIIIIIIIIII	XA:i:0	MD:Z:16	NM:i:0	XM:i:2
 Raw multiread 3 (fw:1, sam:1)
@@ -2751,9 +2822,9 @@
 # reads processed: 2
 # reads with at least one alignment: 2 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (@SQ	SN:0	LN:19
-0.00%)
+# reads that failed to align: 0 (0.00%)
 Reported 2 alignments
+@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw"
 0	0	0	3	255	16M	*	0	0	CATCGATCAGTATCTG	IIIIIIIIIIIIIIII	XA:i:0	MD:Z:16	NM:i:0	XM:i:2
 1	0	0	4	255	15M	*	0	0	ATCGATCAGTATCTG	IIIIIIIIIIIIIII	XA:i:0	MD:Z:15	NM:i:0	XM:i:2
@@ -2825,10 +2896,10 @@
 ./bowtie   --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 0 (0.00%)
+# reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
+0.00%)
 # reads that failed to align: 1 (100.00%)
 No alignments
-@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
 r0	4	*	0	0	*	*	0	0			XM:i:0
@@ -2838,13 +2909,13 @@
 AGCATCGATCAGTATCTGA
 ./bowtie   --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: @HD	VN:1.0	SO:unsorted
-0
-# reads with at least one alignment: 0 (@SQ	SN:0	LN:19
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
+# reads processed: 0
+# reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
 0.00%)
 # reads that failed to align: 0 (0.00%)
 No alignments
+@SQ	SN:0	LN:19
+@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
 Tabbed multiread 2 (fw:1, sam:1)
 References:
 >0
@@ -2900,8 +2971,8 @@
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
 # reads that failed to align: 0 (0.00%)
-@SQ	SN:0	LN:19
 Reported 1 paired-end alignments
+@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
 r0	99	0	1	255	10M	=	9	19	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 r0	147	0	9	255	11M	=	1	-19	TCAAAAACTGA	IIIIIIIIIII	XA:i:0	MD:Z:11	NM:i:0	XM:i:2
@@ -2914,9 +2985,9 @@
 # reads processed: 1
 # reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
 0.00%)
-# reads that failed to align: 1 (100.00%)
+# reads that failed to align: 1 (100.00%)@SQ	SN:0	LN:19
+
 No alignments
-@SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
 r0	77	*	0	0	*	*	0	0			XM:i:0
 r0	141	*	0	0	*	*	0	0	GATCAA	IIIIII	XM:i:0
@@ -2931,8 +3002,8 @@
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
 # reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
 @SQ	SN:0	LN:25
+Reported 1 paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq"
 r0	99	0	3	255	8M	=	17	21	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	147	0	17	255	7M	=	3	-21	TAGATGG	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
@@ -2943,10 +3014,10 @@
 ./bowtie   --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
+# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 paired-end alignments
-@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	3	255	8M	=	17	21	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -2960,9 +3031,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
+# reads that failed to align: 0 (0.00@SQ	SN:0	LN:25
+%)
 Reported 1 paired-end alignments
-@SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	17	21	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	83	0	17	255	7M	=	3	-21	TAGATGG	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
@@ -2975,9 +3046,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
+# reads that failed to align: 0 (@SQ	SN:0	LN:25
+0.00%)
 Reported 1 paired-end alignments
-@SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	3	255	8M	=	17	21	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	147	0	17	255	7M	=	3	-21	TAGATGG	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
@@ -2991,8 +3062,8 @@
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
 # reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments@SQ	SN:0	LN:25
-
+Reported @SQ	SN:0	LN:25
+1 paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	17	21	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	83	0	17	255	7M	=	3	-21	TAGATGG	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
@@ -3004,10 +3075,10 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00@SQ	SN:0	LN:25
-%)
+100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 paired-end alignments
+@SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	3	255	8M	=	12	16	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	147	0	12	255	7M	=	3	-16	TTTTATA	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
@@ -3020,9 +3091,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments@SQ	SN:0	LN:25
-
+# reads that failed to align: 0 (0.00@SQ	SN:0	LN:25
+%)
+Reported 1 paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	12	16	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	83	0	12	255	7M	=	3	-16	TTTTATA	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
@@ -3033,10 +3104,10 @@
 ./bowtie   --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
+# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 paired-end alignments
-@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	3	255	8M	=	12	16	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -3048,10 +3119,10 @@
 ./bowtie   --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
+# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 paired-end alignments
-@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	12	16	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -3066,8 +3137,8 @@
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
 # reads that failed to align: 0 (0.00%)
-Reported @SQ	SN:0	LN:25
-1 paired-end alignments
+Reported 1 paired-end alignments@SQ	SN:0	LN:25
+
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	3	255	8M	=	8	12	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	147	0	8	255	7M	=	3	-12	AAGCTTT	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
@@ -3080,9 +3151,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
+# reads that failed to align: 0@SQ	SN:0	LN:25
+ (0.00%)
 Reported 1 paired-end alignments
-@SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	8	12	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	83	0	8	255	7M	=	3	-12	AAGCTTT	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
@@ -3095,9 +3166,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
+# reads that failed to align: 0 (@SQ	SN:0	LN:25
+0.00%)
 Reported 1 paired-end alignments
-@SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	3	255	8M	=	8	12	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	147	0	8	255	7M	=	3	-12	AAGCTTT	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
@@ -3125,9 +3196,9 @@
 # reads processed: 1
 # reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
 0.00%)
-# reads that failed to align: 1 (@SQ	SN:0	LN:25
-100.00%)
+# reads that failed to align: 1 (100.00%)
 No alignments
+@SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	77	*	0	0	*	*	0	0	AACGAAAG	IIIIIIII	XM:i:0
 r0	141	*	0	0	*	*	0	0	CTTTCGT	IIIIIII	XM:i:0
@@ -3140,9 +3211,9 @@
 # reads processed: 1
 # reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
 0.00%)
-# reads that failed to align: 1 (100.00%)
+# reads that failed to align: 1 (@SQ	SN:0	LN:25
+100.00%)
 No alignments
-@SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	77	*	0	0	*	*	0	0	CTTTCGT	IIIIIII	XM:i:0
 r0	141	*	0	0	*	*	0	0	AACGAAAG	IIIIIIII	XM:i:0
@@ -3155,8 +3226,8 @@
 # reads processed: 1
 # reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
 0.00%)
-# reads that failed to align: 1 (@SQ	SN:0	LN:25
-100.00%)
+# reads that failed to align: 1 (100.00%)
+@SQ	SN:0	LN:25
 No alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	77	*	0	0	*	*	0	0	AACGAAAG	IIIIIIII	XM:i:0
@@ -3170,9 +3241,9 @@
 # reads processed: 1
 # reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
 0.00%)
-# reads that failed to align: 1 (100.00@SQ	SN:0	LN:25
-%)
+# reads that failed to align: 1 (100.00%)
 No alignments
+@SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	77	*	0	0	*	*	0	0	CTTTCGT	IIIIIII	XM:i:0
 r0	141	*	0	0	*	*	0	0	AACGAAAG	IIIIIIII	XM:i:0
@@ -3200,9 +3271,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments@SQ	SN:0	LN:25
-
+# reads that failed to align: 0 (0.00@SQ	SN:0	LN:25
+%)
+Reported 1 paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	4	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	83	0	4	255	7M	=	3	-8	ACGAAAG	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
@@ -3213,8 +3284,8 @@
 ./bowtie   --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (100.00%)@HD	VN:1.0	SO:unsorted
-
+# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 paired-end alignments
 @SQ	SN:0	LN:25
@@ -3228,12 +3299,12 @@
 ./bowtie   --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: @HD	VN:1.0	SO:unsorted
-1 (100.00@SQ	SN:0	LN:25
-%)
-# reads that failed to align: 0 (0.00%)
-Reported 1@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
- paired-end alignments
+# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+100.00%)
+# reads that failed to align: @SQ	SN:0	LN:25
+0 (0.00%)
+Reported 1 paired-end alignments
+@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	4	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	83	0	4	255	7M	=	3	-8	ACGAAAG	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
 Paired-end 6, allow contain (fw:1, sam:1)
@@ -3276,8 +3347,8 @@
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
 # reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
-@SQ	SN:0	LN:25
+Reported 1 paired-end alignments@SQ	SN:0	LN:25
+
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	147	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -3290,9 +3361,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1@SQ	SN:0	LN:25
- paired-end alignments
+# reads that failed to align: 0 (0.00@SQ	SN:0	LN:25
+%)
+Reported 1 paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	83	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -3305,9 +3376,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported @SQ	SN:0	LN:25
-1 paired-end alignments
+# reads that failed to align: 0 (0.00@SQ	SN:0	LN:25
+%)
+Reported 1 paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	147	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -3320,9 +3391,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
+# reads that failed to align: 0 (0.00@SQ	SN:0	LN:25
+%)
 Reported 1 paired-end alignments
-@SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	83	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -3335,9 +3406,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
+@SQ	SN:0	LN:25
 # reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments@SQ	SN:0	LN:25
-
+Reported 1 paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	147	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -3351,8 +3422,8 @@
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
 # reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
-@SQ	SN:0	LN:25
+Reported 1 paired-end alignments@SQ	SN:0	LN:25
+
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	83	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -3363,10 +3434,10 @@
 ./bowtie   --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
-# reads that failed to align: 0 (@SQ	SN:0	LN:25
-0.00%)
+# reads with at least one alignment: 1@HD	VN:1.0	SO:unsorted
+ (100.00%)
+# reads that failed to align: 0 (0.00@SQ	SN:0	LN:25
+%)
 Reported 1 paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	67	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -3380,9 +3451,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00@SQ	SN:0	LN:25
-%)
-Reported 1 paired-end alignments
+# reads that failed to align: 0 (0.00%)
+Reported 1@SQ	SN:0	LN:25
+ paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	67	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	131	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -3395,9 +3466,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0@SQ	SN:0	LN:25
- (0.00%)
-Reported 1 paired-end alignments
+# reads that failed to align: 0 (0.00%)
+Reported 1@SQ	SN:0	LN:25
+ paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	67	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	131	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -3425,9 +3496,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (@SQ	SN:0	LN:25
-0.00%)
+# reads that failed to align: 0 (0.00%)
 Reported 1 paired-end alignments
+@SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	67	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	131	0	3	255	8M	=	3	8	AACGATAG	IIIIIIII	XA:i:1	MD:Z:5A2	NM:i:1	XM:i:2
@@ -3453,11 +3524,11 @@
 ./bowtie   --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments@SQ	SN:0	LN:25
+# reads with at least one alignment: 1@HD	VN:1.0	SO:unsorted
+ (100.00%)@SQ	SN:0	LN:25
 
+# reads that failed to align: 0 (0.00%)
+Reported 1 paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	67	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	131	0	3	255	8M	=	3	8	AACGATAG	IIIIIIII	XA:i:1	MD:Z:5A2	NM:i:1	XM:i:2
@@ -3468,11 +3539,11 @@
 ./bowtie   --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments@SQ	SN:0	LN:25
-
+# reads with at least one alignment: 1@HD	VN:1.0	SO:unsorted
+ (100.00%)
+# reads that failed to align: 0 (0.00@SQ	SN:0	LN:25
+%)
+Reported 1 paired-end alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	67	0	3	255	8M	=	3	8	AACGATAG	IIIIIIII	XA:i:1	MD:Z:5A2	NM:i:1	XM:i:2
 r0	131	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -3486,9 +3557,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
+@SQ	SN:0	LN:16
 # reads that failed to align: 0 (0.00%)
-Reported 2@SQ	SN:0	LN:16
- alignments
+Reported 2 alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	0	0	9	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:3
 r0	0	0	1	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:3
@@ -3501,10 +3572,10 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 2 alignments
-@SQ	SN:0	LN:16
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
+# reads that failed to align: 0 (0.00%)@SQ	SN:0	LN:16
+
+Reported 2 alignments@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
+
 r0	16	0	1	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:3
 r0	16	0	9	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:3
 Checking -m, 1 (fw:1, sam:1)
@@ -3518,8 +3589,8 @@
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
 # reads that failed to align: 0 (0.00%)
-Reported 2 alignments
 @SQ	SN:0	LN:16
+Reported 2 alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	0	0	9	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:3
 r0	0	0	1	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:3
@@ -3532,9 +3603,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00%)
+# reads that failed to align: 0 (@SQ	SN:0	LN:16
+0.00%)
 Reported 2 alignments
-@SQ	SN:0	LN:16
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	16	0	1	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:3
 r0	16	0	9	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:3
@@ -3548,10 +3619,10 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00@SQ	SN:0	LN:24
-%)
+# reads that failed to align: 0 (0.00%)
 # reads with alignments suppressed due to -m: 1 (100.00%)
 No alignments
+@SQ	SN:0	LN:24
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
 Checking -m, 2 (fw:0, sam:1)
 References:
@@ -3590,12 +3661,12 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00@SQ	SN:0	LN:24
-%)
-# reads that failed to align: 0 (0.00%)
-# reads with alignments suppressed due to -m: 1 (@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
 100.00%)
+# reads that failed to align: 0 (0.00%)
+# reads with alignments suppressed due to -m: @SQ	SN:0	LN:24
+1 (100.00%)
 No alignments
+@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
 Checking edits 1 (fw:1, sam:1)
 References:
 >0
@@ -3605,10 +3676,10 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00@SQ	SN:0	LN:8
-%)
+100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 alignments
+@SQ	SN:0	LN:8
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	0	0	1	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:2	MD:Z:3C0C3	NM:i:2	XM:i:2
 Checking edits 1 (fw:0, sam:1)
@@ -3620,8 +3691,8 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: @SQ	SN:0	LN:8
-0 (0.00%)
+# reads that failed to align: 0 (@SQ	SN:0	LN:8
+0.00%)
 Reported 1 alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	16	0	1	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:2	MD:Z:3C0C3	NM:i:2	XM:i:2
@@ -3635,9 +3706,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00@SQ	SN:0	LN:8
-%)
-Reported 1 alignments
+# reads that failed to align: 0 (0.00%)
+Reported 1 alignments@SQ	SN:0	LN:8
+
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	0	0	1	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:2	MD:Z:3C0C3	NM:i:2	XM:i:2
 Checking edits 1 (fw:0, sam:1)
@@ -3646,12 +3717,12 @@
 TTGCCCGT
 ./bowtie   --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+# reads processed: @HD	VN:1.0	SO:unsorted
+1
+# reads with at least one alignment: 1 (@SQ	SN:0	LN:8
 100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 alignments
-@SQ	SN:0	LN:8
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	16	0	1	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:2	MD:Z:3C0C3	NM:i:2	XM:i:2
 Checking edits 2 (fw:1, sam:1)
@@ -3664,11 +3735,11 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (@SQ	SN:0	LN:8
+# reads that failed to align: 0 (0.00%)
+Reported @SQ	SN:0	LN:8
+1 alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
-0.00%)
-Reported 1 alignmentsr0	16	0	1	255	8M	*	0	0	TTGCCCGT	IIIIIIII	XA:i:2	MD:Z:3T0T3	NM:i:2	XM:i:2
-
+r0	16	0	1	255	8M	*	0	0	TTGCCCGT	IIIIIIII	XA:i:2	MD:Z:3T0T3	NM:i:2	XM:i:2
 Checking edits 2 (fw:0, sam:1)
 References:
 >0
@@ -3678,8 +3749,8 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: @SQ	SN:0	LN:8
-0 (0.00%)
+# reads that failed to align: 0 (0.00%)
+@SQ	SN:0	LN:8
 Reported 1 alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	0	0	1	255	8M	*	0	0	TTGCCCGT	IIIIIIII	XA:i:2	MD:Z:3T0T3	NM:i:2	XM:i:2
@@ -3721,11 +3792,11 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-@SQ	SN:0	LN:8
 100.00%)
-# reads that failed to align: 0 (0.00%)@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
-
+# reads that failed to align: 0 (0.00%)
 Reported 1 alignments
+@SQ	SN:0	LN:8
+@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	0	0	3	255	4M	*	0	0	GTTC	IIII	XA:i:0	MD:Z:4	NM:i:0	XM:i:2
 Checking edits 3 (fw:0, sam:1)
 References:
@@ -3751,9 +3822,9 @@
 # reads processed: 1
 # reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 100.00%)
-# reads that failed to align: 0 (0.00@SQ	SN:0	LN:8
-%)
-Reported 1 alignments
+# reads that failed to align: 0 (0.00%)
+Reported 1@SQ	SN:0	LN:8
+ alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	0	0	3	255	4M	*	0	0	GTTC	IIII	XA:i:0	MD:Z:4	NM:i:0	XM:i:2
 Checking edits 3 (fw:0, sam:1)
@@ -3880,8 +3951,8 @@
    dh_gencontrol
    dh_md5sums
    dh_builddeb
-dpkg-deb: building package 'bowtie-dbgsym' in '../bowtie-dbgsym_1.3.0+dfsg1-1_arm64.deb'.
 dpkg-deb: building package 'bowtie' in '../bowtie_1.3.0+dfsg1-1_arm64.deb'.
+dpkg-deb: building package 'bowtie-dbgsym' in '../bowtie-dbgsym_1.3.0+dfsg1-1_arm64.deb'.
 dpkg-deb: building package 'bowtie-examples' in '../bowtie-examples_1.3.0+dfsg1-1_all.deb'.
  dpkg-genbuildinfo --build=binary
  dpkg-genchanges --build=binary >../bowtie_1.3.0+dfsg1-1_arm64.changes
@@ -3890,12 +3961,14 @@
 dpkg-buildpackage: info: binary-only upload (no source included)
 dpkg-genchanges: info: including full source code in upload
 I: copying local configuration
+I: user script /srv/workspace/pbuilder/12243/tmp/hooks/B01_cleanup starting
+I: user script /srv/workspace/pbuilder/12243/tmp/hooks/B01_cleanup finished
 I: unmounting dev/ptmx filesystem
 I: unmounting dev/pts filesystem
 I: unmounting dev/shm filesystem
 I: unmounting proc filesystem
 I: unmounting sys filesystem
 I: cleaning the build env 
-I: removing directory /srv/workspace/pbuilder/14012 and its subdirectories
-I: Current time: Wed Aug 10 18:02:13 -12 2022
-I: pbuilder-time-stamp: 1660197733
+I: removing directory /srv/workspace/pbuilder/12243 and its subdirectories
+I: Current time: Fri Jul  9 13:57:36 +14 2021
+I: pbuilder-time-stamp: 1625788656