| Offset 1, 3 lines modified | Offset 1, 3 lines modified | ||
| 1 | ·25add2f20e8e656c0fdc29a671a5b04d·11333884·debug·optional·tvc-dbgsym_5.0.3+git20151221.80e144e+dfsg-5_i386.deb | ||
| 2 | · | 1 | ·d202f40ba0ad11bfa003c8efbf25bcbe·11472488·debug·optional·tvc-dbgsym_5.0.3+git20151221.80e144e+dfsg-5_i386.deb |
| 2 | ·04cfdfc505d6cebd07f7725413d4b571·1126700·science·optional·tvc_5.0.3+git20151221.80e144e+dfsg-5_i386.deb | ||
| Offset 1, 3 lines modified | Offset 1, 3 lines modified | ||
| 1 | -rw-r--r--···0········0········0········4·2022-09-05·17:20:03.000000·debian-binary | 1 | -rw-r--r--···0········0········0········4·2022-09-05·17:20:03.000000·debian-binary |
| 2 | -rw-r--r--···0········0········0·····1680·2022-09-05·17:20:03.000000·control.tar.xz | 2 | -rw-r--r--···0········0········0·····1680·2022-09-05·17:20:03.000000·control.tar.xz |
| 3 | -rw-r--r--···0········0········0··11 | 3 | -rw-r--r--···0········0········0··1124828·2022-09-05·17:20:03.000000·data.tar.xz |
| Offset 1, 12 lines modified | Offset 1, 12 lines modified | ||
| 1 | Package:·tvc | 1 | Package:·tvc |
| 2 | Version:·5.0.3+git20151221.80e144e+dfsg-5 | 2 | Version:·5.0.3+git20151221.80e144e+dfsg-5 |
| 3 | Architecture:·i386 | 3 | Architecture:·i386 |
| 4 | Maintainer:·Debian·Med·Packaging·Team·<debian-med-packaging@lists.alioth.debian.org> | 4 | Maintainer:·Debian·Med·Packaging·Team·<debian-med-packaging@lists.alioth.debian.org> |
| 5 | Installed-Size:·34 | 5 | Installed-Size:·3463 |
| 6 | Depends:·libarmadillo11·(>=·1:11.4.2+dfsg),·libbamtools2.5.2·(>=·2.5.2+dfsg),·libc6·(>=·2.34),·libdisorder0·(>=·0.0.2),·libgcc-s1·(>=·3.0),·libjsoncpp25·(>=·1.9.5),·libsmithwaterman0·(>=·0.0+git20160702.2610e25),·libstdc++6·(>=·11),·zlib1g·(>=·1:1.1.4),·python3 | 6 | Depends:·libarmadillo11·(>=·1:11.4.2+dfsg),·libbamtools2.5.2·(>=·2.5.2+dfsg),·libc6·(>=·2.34),·libdisorder0·(>=·0.0.2),·libgcc-s1·(>=·3.0),·libjsoncpp25·(>=·1.9.5),·libsmithwaterman0·(>=·0.0+git20160702.2610e25),·libstdc++6·(>=·11),·zlib1g·(>=·1:1.1.4),·python3 |
| 7 | Section:·science | 7 | Section:·science |
| 8 | Priority:·optional | 8 | Priority:·optional |
| 9 | Homepage:·http://ioncommunity.thermofisher.com | 9 | Homepage:·http://ioncommunity.thermofisher.com |
| 10 | Description:·genetic·variant·caller·for·Ion·Torrent·sequencing·platforms | 10 | Description:·genetic·variant·caller·for·Ion·Torrent·sequencing·platforms |
| 11 | ·Torrent·Variant·Caller·(TVC)·is·a·genetic·variant·caller·for | 11 | ·Torrent·Variant·Caller·(TVC)·is·a·genetic·variant·caller·for |
| 12 | ·Ion·Torrent·sequencing·platforms,·and·is·specially·optimized·to·exploit·the | 12 | ·Ion·Torrent·sequencing·platforms,·and·is·specially·optimized·to·exploit·the |
| Offset 1, 13 lines modified | Offset 1, 13 lines modified | ||
| 1 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./ | 1 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./ |
| 2 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/ | 2 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/ |
| 3 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/bin/ | 3 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/bin/ |
| 4 | -rwxr-xr-x···0·root·········(0)·root·········(0)··12 | 4 | -rwxr-xr-x···0·root·········(0)·root·········(0)··1232808·2022-09-05·17:20:03.000000·./usr/bin/tvc |
| 5 | -rwxr-xr-x···0·root·········(0)·root·········(0)···22 | 5 | -rwxr-xr-x···0·root·········(0)·root·········(0)···223440·2022-09-05·17:20:03.000000·./usr/bin/tvcassembly |
| 6 | -rwxr-xr-x···0·root·········(0)·root·········(0)···64 | 6 | -rwxr-xr-x···0·root·········(0)·root·········(0)···641572·2022-09-05·17:20:03.000000·./usr/bin/tvcutils |
| 7 | -rwxr-xr-x···0·root·········(0)·root·········(0)····12985·2022-09-05·17:20:03.000000·./usr/bin/variant_caller_pipeline.py | 7 | -rwxr-xr-x···0·root·········(0)·root·········(0)····12985·2022-09-05·17:20:03.000000·./usr/bin/variant_caller_pipeline.py |
| 8 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/share/ | 8 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/share/ |
| 9 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/share/TVC/ | 9 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/share/TVC/ |
| 10 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/share/TVC/examples/ | 10 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/share/TVC/examples/ |
| 11 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/share/TVC/examples/example1/ | 11 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/share/TVC/examples/example1/ |
| 12 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/share/TVC/examples/example1/expected/ | 12 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/share/TVC/examples/example1/expected/ |
| 13 | -rw-r--r--···0·root·········(0)·root·········(0)·····6876·2015-12-21·20:38:06.000000·./usr/share/TVC/examples/example1/expected/TSVC_variants.vcf | 13 | -rw-r--r--···0·root·········(0)·root·········(0)·····6876·2015-12-21·20:38:06.000000·./usr/share/TVC/examples/example1/expected/TSVC_variants.vcf |
| Offset 4, 17 lines modified | Offset 4, 17 lines modified | ||
| 4 | ··Data:······························2's·complement,·little·endian | 4 | ··Data:······························2's·complement,·little·endian |
| 5 | ··Version:···························1·(current) | 5 | ··Version:···························1·(current) |
| 6 | ··OS/ABI:····························UNIX·-·GNU | 6 | ··OS/ABI:····························UNIX·-·GNU |
| 7 | ··ABI·Version:·······················0 | 7 | ··ABI·Version:·······················0 |
| 8 | ··Type:······························DYN·(Position-Independent·Executable·file) | 8 | ··Type:······························DYN·(Position-Independent·Executable·file) |
| 9 | ··Machine:···························Intel·80386 | 9 | ··Machine:···························Intel·80386 |
| 10 | ··Version:···························0x1 | 10 | ··Version:···························0x1 |
| 11 | ··Entry·point·address:···············0x2 | 11 | ··Entry·point·address:···············0x2b1b0 |
| 12 | ··Start·of·program·headers:··········52·(bytes·into·file) | 12 | ··Start·of·program·headers:··········52·(bytes·into·file) |
| 13 | ··Start·of·section·headers:··········12 | 13 | ··Start·of·section·headers:··········1231608·(bytes·into·file) |
| 14 | ··Flags:·····························0x0 | 14 | ··Flags:·····························0x0 |
| 15 | ··Size·of·this·header:···············52·(bytes) | 15 | ··Size·of·this·header:···············52·(bytes) |
| 16 | ··Size·of·program·headers:···········32·(bytes) | 16 | ··Size·of·program·headers:···········32·(bytes) |
| 17 | ··Number·of·program·headers:·········11 | 17 | ··Number·of·program·headers:·········11 |
| 18 | ··Size·of·section·headers:···········40·(bytes) | 18 | ··Size·of·section·headers:···········40·(bytes) |
| 19 | ··Number·of·section·headers:·········30 | 19 | ··Number·of·section·headers:·········30 |
| 20 | ··Section·header·string·table·index:·29 | 20 | ··Section·header·string·table·index:·29 |
| Offset 1, 26 lines modified | Offset 1, 26 lines modified | ||
| 1 | Elf·file·type·is·DYN·(Position-Independent·Executable·file) | 1 | Elf·file·type·is·DYN·(Position-Independent·Executable·file) |
| 2 | Entry·point·0x2 | 2 | Entry·point·0x2b1b0 |
| 3 | There·are·11·program·headers,·starting·at·offset·52 | 3 | There·are·11·program·headers,·starting·at·offset·52 |
| 4 | Program·Headers: | 4 | Program·Headers: |
| 5 | ··Type···········Offset···VirtAddr···PhysAddr···FileSiz·MemSiz··Flg·Align | 5 | ··Type···········Offset···VirtAddr···PhysAddr···FileSiz·MemSiz··Flg·Align |
| 6 | ··PHDR···········0x000034·0x00000034·0x00000034·0x00160·0x00160·R···0x4 | 6 | ··PHDR···········0x000034·0x00000034·0x00000034·0x00160·0x00160·R···0x4 |
| 7 | ··INTERP·········0x000194·0x00000194·0x00000194·0x00013·0x00013·R···0x1 | 7 | ··INTERP·········0x000194·0x00000194·0x00000194·0x00013·0x00013·R···0x1 |
| 8 | ······[Requesting·program·interpreter:·/lib/ld-linux.so.2] | 8 | ······[Requesting·program·interpreter:·/lib/ld-linux.so.2] |
| 9 | ··LOAD···········0x000000·0x00000000·0x00000000·0x1d | 9 | ··LOAD···········0x000000·0x00000000·0x00000000·0x1d8f4·0x1d8f4·R···0x1000 |
| 10 | ··LOAD···········0x01e000·0x0001e000·0x0001e000·0xd | 10 | ··LOAD···········0x01e000·0x0001e000·0x0001e000·0xd6338·0xd6338·R·E·0x1000 |
| 11 | ··LOAD···········0x0f | 11 | ··LOAD···········0x0f5000·0x000f5000·0x000f5000·0x36b3b·0x36b3b·R···0x1000 |
| 12 | ··LOAD···········0x12 | 12 | ··LOAD···········0x12bda0·0x0012cda0·0x0012cda0·0x00bc0·0x00bfc·RW··0x1000 |
| 13 | ··DYNAMIC········0x12 | 13 | ··DYNAMIC········0x12be3c·0x0012ce3c·0x0012ce3c·0x00138·0x00138·RW··0x4 |
| 14 | ··NOTE···········0x0001a8·0x000001a8·0x000001a8·0x00044·0x00044·R···0x4 | 14 | ··NOTE···········0x0001a8·0x000001a8·0x000001a8·0x00044·0x00044·R···0x4 |
| 15 | ··GNU_EH_FRAME···0x | 15 | ··GNU_EH_FRAME···0x100384·0x00100384·0x00100384·0x02f64·0x02f64·R···0x4 |
| 16 | ··GNU_STACK······0x000000·0x00000000·0x00000000·0x00000·0x00000·RW··0x10 | 16 | ··GNU_STACK······0x000000·0x00000000·0x00000000·0x00000·0x00000·RW··0x10 |
| 17 | ··GNU_RELRO······0x12 | 17 | ··GNU_RELRO······0x12bda0·0x0012cda0·0x0012cda0·0x00260·0x00260·R···0x1 |
| 18 | ·Section·to·Segment·mapping: | 18 | ·Section·to·Segment·mapping: |
| 19 | ··Segment·Sections... | 19 | ··Segment·Sections... |
| 20 | ···00····· | 20 | ···00····· |
| 21 | ···01·····.interp· | 21 | ···01·····.interp· |
| 22 | ···02·····.interp·.note.gnu.build-id·.note.ABI-tag·.gnu.hash·.dynsym·.dynstr·.gnu.version·.gnu.version_r·.rel.dyn·.rel.plt· | 22 | ···02·····.interp·.note.gnu.build-id·.note.ABI-tag·.gnu.hash·.dynsym·.dynstr·.gnu.version·.gnu.version_r·.rel.dyn·.rel.plt· |
| 23 | ···03·····.init·.plt·.plt.got·.text·.fini· | 23 | ···03·····.init·.plt·.plt.got·.text·.fini· |
| Offset 1, 39 lines modified | Offset 1, 39 lines modified | ||
| 1 | There·are·30·section·headers,·starting·at·offset·0x12 | 1 | There·are·30·section·headers,·starting·at·offset·0x12caf8: |
| 2 | Section·Headers: | 2 | Section·Headers: |
| 3 | ··[Nr]·Name··············Type············Addr·····Off····Size···ES·Flg·Lk·Inf·Al | 3 | ··[Nr]·Name··············Type············Addr·····Off····Size···ES·Flg·Lk·Inf·Al |
| 4 | ··[·0]···················NULL············00000000·000000·000000·00······0···0··0 | 4 | ··[·0]···················NULL············00000000·000000·000000·00······0···0··0 |
| 5 | ··[·1]·.interp···········PROGBITS········00000194·000194·000013·00···A··0···0··1 | 5 | ··[·1]·.interp···········PROGBITS········00000194·000194·000013·00···A··0···0··1 |
| 6 | ··[·2]·.note.gnu.build-id·NOTE············000001a8·0001a8·000024·00···A··0···0··4 | 6 | ··[·2]·.note.gnu.build-id·NOTE············000001a8·0001a8·000024·00···A··0···0··4 |
| 7 | ··[·3]·.note.ABI-tag·····NOTE············000001cc·0001cc·000020·00···A··0···0··4 | 7 | ··[·3]·.note.ABI-tag·····NOTE············000001cc·0001cc·000020·00···A··0···0··4 |
| 8 | ··[·4]·.gnu.hash·········GNU_HASH········000001ec·0001ec·0026 | 8 | ··[·4]·.gnu.hash·········GNU_HASH········000001ec·0001ec·002660·04···A··5···0··4 |
| 9 | ··[·5]·.dynsym···········DYNSYM··········00002 | 9 | ··[·5]·.dynsym···········DYNSYM··········0000284c·00284c·005b50·10···A··6···1··4 |
| 10 | ··[·6]·.dynstr···········STRTAB··········00008 | 10 | ··[·6]·.dynstr···········STRTAB··········0000839c·00839c·013d5d·00···A··0···0··1 |
| 11 | ··[·7]·.gnu.version······VERSYM··········0001 | 11 | ··[·7]·.gnu.version······VERSYM··········0001c0fa·01c0fa·000b6a·02···A··5···0··2 |
| 12 | ··[·8]·.gnu.version_r····VERNEED·········0001c | 12 | ··[·8]·.gnu.version_r····VERNEED·········0001cc64·01cc64·000200·00···A··6···4··4 |
| 13 | ··[·9]·.rel.dyn··········REL·············0001c | 13 | ··[·9]·.rel.dyn··········REL·············0001ce64·01ce64·000258·08···A··5···0··4 |
| 14 | ··[10]·.rel.plt··········REL·············0001 | 14 | ··[10]·.rel.plt··········REL·············0001d0bc·01d0bc·000838·08··AI··5··24··4 |
| 15 | ··[11]·.init·············PROGBITS········0001e000·01e000·000020·00··AX··0···0··4 | 15 | ··[11]·.init·············PROGBITS········0001e000·01e000·000020·00··AX··0···0··4 |
| 16 | ··[12]·.plt··············PROGBITS········0001e020·01e020·0010 | 16 | ··[12]·.plt··············PROGBITS········0001e020·01e020·001080·04··AX··0···0·16 |
| 17 | ··[13]·.plt.got··········PROGBITS········0001f0 | 17 | ··[13]·.plt.got··········PROGBITS········0001f0a0·01f0a0·000008·08··AX··0···0··8 |
| 18 | ··[14]·.text·············PROGBITS········0001f0 | 18 | ··[14]·.text·············PROGBITS········0001f0b0·01f0b0·0d5274·00··AX··0···0·16 |
| 19 | ··[15]·.fini·············PROGBITS········000 | 19 | ··[15]·.fini·············PROGBITS········000f4324·0f4324·000014·00··AX··0···0··4 |
| 20 | ··[16]·.rodata···········PROGBITS········000f | 20 | ··[16]·.rodata···········PROGBITS········000f5000·0f5000·00b384·00···A··0···0·32 |
| 21 | ··[17]·.eh_frame_hdr·····PROGBITS········00 | 21 | ··[17]·.eh_frame_hdr·····PROGBITS········00100384·100384·002f64·00···A··0···0··4 |
| 22 | ··[18]·.eh_frame·········PROGBITS········00 | 22 | ··[18]·.eh_frame·········PROGBITS········001032e8·1032e8·022d20·00···A··0···0··4 |
| 23 | ··[19]·.gcc_except_table·PROGBITS········001 | 23 | ··[19]·.gcc_except_table·PROGBITS········00126008·126008·005b33·00···A··0···0··4 |
| 24 | ··[20]·.init_array·······INIT_ARRAY······0012 | 24 | ··[20]·.init_array·······INIT_ARRAY······0012cda0·12bda0·000098·04··WA··0···0··4 |
| 25 | ··[21]·.fini_array·······FINI_ARRAY······0012 | 25 | ··[21]·.fini_array·······FINI_ARRAY······0012ce38·12be38·000004·04··WA··0···0··4 |
| 26 | ··[22]·.dynamic··········DYNAMIC·········0012 | 26 | ··[22]·.dynamic··········DYNAMIC·········0012ce3c·12be3c·000138·08··WA··6···0··4 |
| 27 | ··[23]·.got··············PROGBITS········0012 | 27 | ··[23]·.got··············PROGBITS········0012cf74·12bf74·000080·04··WA··0···0··4 |
| 28 | ··[24]·.got.plt··········PROGBITS········0012 | 28 | ··[24]·.got.plt··········PROGBITS········0012cff4·12bff4·000428·04··WA··0···0··4 |
| 29 | ··[25]·.data·············PROGBITS········0012 | 29 | ··[25]·.data·············PROGBITS········0012d420·12c420·000540·00··WA··0···0·32 |
| 30 | ··[26]·.bss··············NOBITS··········0012 | 30 | ··[26]·.bss··············NOBITS··········0012d960·12c960·00003c·00··WA··0···0··8 |
| 31 | ··[27]·.gnu_debugaltlink·PROGBITS········00000000·12 | 31 | ··[27]·.gnu_debugaltlink·PROGBITS········00000000·12c960·000041·00······0···0··1 |
| 32 | ··[28]·.gnu_debuglink····PROGBITS········00000000·12 | 32 | ··[28]·.gnu_debuglink····PROGBITS········00000000·12c9a4·000034·00······0···0··4 |
| 33 | ··[29]·.shstrtab·········STRTAB··········00000000·12 | 33 | ··[29]·.shstrtab·········STRTAB··········00000000·12c9d8·00011f·00······0···0··1 |
| 34 | Key·to·Flags: | 34 | Key·to·Flags: |
| 35 | ··W·(write),·A·(alloc),·X·(execute),·M·(merge),·S·(strings),·I·(info), | 35 | ··W·(write),·A·(alloc),·X·(execute),·M·(merge),·S·(strings),·I·(info), |
| 36 | ··L·(link·order),·O·(extra·OS·processing·required),·G·(group),·T·(TLS), | 36 | ··L·(link·order),·O·(extra·OS·processing·required),·G·(group),·T·(TLS), |
| 37 | ··C·(compressed),·x·(unknown),·o·(OS·specific),·E·(exclude), | 37 | ··C·(compressed),·x·(unknown),·o·(OS·specific),·E·(exclude), |
| 38 | ··R·(retain),·D·(mbind),·p·(processor·specific) | 38 | ··R·(retain),·D·(mbind),·p·(processor·specific) |
| Offset 1, 9 lines modified | Offset 1, 9 lines modified | ||
| 1 | Symbol·table·'.dynsym'·contains·14 | 1 | Symbol·table·'.dynsym'·contains·1461·entries: |
| 2 | ···Num:····Value··Size·Type····Bind···Vis······Ndx·Name | 2 | ···Num:····Value··Size·Type····Bind···Vis······Ndx·Name |
| 3 | ·····0:·00000000·····0·NOTYPE··LOCAL··DEFAULT··UND· | 3 | ·····0:·00000000·····0·NOTYPE··LOCAL··DEFAULT··UND· |
| 4 | ·····1:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__printf_chk@GLIBC_2.3.4·(2) | 4 | ·····1:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__printf_chk@GLIBC_2.3.4·(2) |
| 5 | ·····2:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·open@GLIBC_2.0·(3) | 5 | ·····2:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·open@GLIBC_2.0·(3) |
| 6 | ·····3:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·pthread_mutex_destroy@GLIBC_2.0·(3) | 6 | ·····3:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·pthread_mutex_destroy@GLIBC_2.0·(3) |
| 7 | ·····4:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSo3putEc@GLIBCXX_3.4·(4) | 7 | ·····4:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSo3putEc@GLIBCXX_3.4·(4) |
| 8 | ·····5:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·roundf@GLIBC_2.1·(5) | 8 | ·····5:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·roundf@GLIBC_2.1·(5) |
| Offset 24, 109 lines modified | Offset 24, 109 lines modified | ||
| 24 | ····20:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__ctype_tolower_loc@GLIBC_2.3·(8) | 24 | ····20:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__ctype_tolower_loc@GLIBC_2.3·(8) |
| 25 | ····21:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN8BamTools15SamProgramChain5BeginEv | 25 | ····21:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN8BamTools15SamProgramChain5BeginEv |
| 26 | ····22:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·pthread_mutex_trylock@GLIBC_2.34·(10) | 26 | ····22:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·pthread_mutex_trylock@GLIBC_2.34·(10) |
| 27 | ····23:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSdD2Ev@GLIBCXX_3.4·(4) | 27 | ····23:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSdD2Ev@GLIBCXX_3.4·(4) |
| 28 | ····24:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTVSt9basic_iosIcSt11char_traitsIcEE@GLIBCXX_3.4·(4) | 28 | ····24:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTVSt9basic_iosIcSt11char_traitsIcEE@GLIBCXX_3.4·(4) |
| 29 | ····25:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN8BamTools14BamMultiReaderD1Ev | 29 | ····25:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN8BamTools14BamMultiReaderD1Ev |
| 30 | ····26:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·wrapper2_dgesv_ | 30 | ····26:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·wrapper2_dgesv_ |
| 31 | ····27:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZdlPvjSt11align_val_t@CXXABI_1.3.11·(11) | ||
| 31 | ····2 | 32 | ····28:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt13basic_filebufIcSt11char_traitsIcEE5closeEv@GLIBCXX_3.4·(4) |
| 32 | ····2 | 33 | ····29:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNKSt12__basic_fileIcE7is_openEv@GLIBCXX_3.4·(4) |
| 33 | ···· | 34 | ····30:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·sqrtf@GLIBC_2.0·(12) |
| 34 | ····3 | 35 | ····31:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·mkdir@GLIBC_2.0·(3) |
| 35 | ····3 | 36 | ····32:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN8BamTools14BamMultiReader20GetNextAlignmentCoreERNS_12BamAlignmentE |
| 36 | ····3 | 37 | ····33:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1119basic_ostringstreamIcSt11char_traitsIcESaIcEED1Ev@GLIBCXX_3.4.21·(9) |
| 37 | ····3 | 38 | ····34:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt14basic_ifstreamIcSt11char_traitsIcEED1Ev@GLIBCXX_3.4·(4) |
| 38 | ····3 | 39 | ····35:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·strstr@GLIBC_2.0·(3) |
| 39 | ····3 | 40 | ····36:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN8BamTools14BamMultiReader5CloseEv |
| 40 | ····3 | 41 | ····37:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE7compareEPKc@GLIBCXX_3.4.21·(9) |
| 41 | ····3 | 42 | ····38:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN8BamTools9BamWriter4OpenERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERKNS_9SamHeaderERKSt6vectorINS_7RefDataESaISD_EE |
| 42 | ····3 | 43 | ····39:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN4Json5ValueC1Ey |
| 43 | ···· | 44 | ····40:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt8ios_baseC2Ev@GLIBCXX_3.4·(4) |
| 44 | ····4 | 45 | ····41:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTVNSt7__cxx1119basic_istringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21·(9) |
| 45 | ····4 | 46 | ····42:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN8BamTools12BamAlignmentC1Ev |
| 46 | ····4 | 47 | ····43:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt8ios_baseD2Ev@GLIBCXX_3.4·(4) |
| 47 | ····4 | 48 | ····44:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN8BamTools9BamWriter18SetCompressionModeERKNS0_15CompressionModeE |
| 48 | ····4 | 49 | ····45:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN4Json6Reader5parseERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERNS_5ValueEb |
| 49 | ····4 | 50 | ····46:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·strdup@GLIBC_2.0·(3) |
| 50 | ····4 | 51 | ····47:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·realpath@GLIBC_2.3·(8) |
| 51 | ····4 | 52 | ····48:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·pthread_cond_broadcast@GLIBC_2.3.2·(13) |
| 52 | ····4 | 53 | ····49:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE6substrEjj@GLIBCXX_3.4.21·(9) |
| 53 | ···· | 54 | ····50:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTTNSt7__cxx1118basic_stringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21·(9) |
| 54 | ····5 | 55 | ····51:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt17__throw_bad_allocv@GLIBCXX_3.4·(4) |
| 55 | ····5 | 56 | ····52:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK8BamTools14BamMultiReader16GetReferenceDataEv |
| 56 | ····5 | 57 | ····53:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN4Json5ValueixEPKc |
| 57 | ····5 | 58 | ····54:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE10_M_replaceEjjPKcj@GLIBCXX_3.4.21·(9) |
| 58 | ····5 | 59 | ····55:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·fseeko@GLIBC_2.1·(14) |
| 59 | ····5 | 60 | ····56:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__cxa_begin_catch@CXXABI_1.3·(15) |
| 60 | ····5 | 61 | ····57:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE7reserveEj@GLIBCXX_3.4.21·(9) |
| 61 | ····5 | 62 | ····58:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·calloc@GLIBC_2.0·(3) |
| 62 | ····5 | 63 | ····59:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN4Json5ValueC1ENS_9ValueTypeE |
| 63 | ···· | 64 | ····60:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEC1ERKS4_@GLIBCXX_3.4.21·(9) |
| 64 | ····6 | 65 | ····61:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1119basic_istringstreamIcSt11char_traitsIcESaIcEED1Ev@GLIBCXX_3.4.21·(9) |
| 65 | ····6 | 66 | ····62:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·deflate |
| 66 | ····6 | 67 | ····63:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN19CSmithWatermanGotohD1Ev |
| 67 | ····6 | 68 | ····64:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt4endlIcSt11char_traitsIcEERSt13basic_ostreamIT_T0_ES6_@GLIBCXX_3.4·(4) |
| 68 | ····6 | 69 | ····65:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__cxa_allocate_exception@CXXABI_1.3·(15) |
| 69 | ····6 | 70 | ····66:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN4Json10FastWriterC1Ev |
| 70 | ····6 | 71 | ····67:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·fputc@GLIBC_2.0·(3) |
| 71 | ····6 | 72 | ····68:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·fgets@GLIBC_2.0·(3) |
| 72 | ····6 | 73 | ····69:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN4Json5ValueD1Ev |
| 73 | ···· | 74 | ····70:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSo9_M_insertIeEERSoT_@GLIBCXX_3.4.9·(16) |
| 74 | ····7 | 75 | ····71:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·fwrite@GLIBC_2.0·(3) |
| 75 | ····7 | 76 | ····72:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE14_M_replace_auxEjjjc@GLIBCXX_3.4.21·(9) |
| 76 | ····7 | 77 | ····73:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·memcpy@GLIBC_2.0·(3) |
| 77 | ····7 | 78 | ····74:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK8BamTools9SamHeader13HasReadGroupsEv |
| 78 | ····7 | 79 | ····75:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN4Json5ValueC1Ex |
| 79 | ····7 | 80 | ····76:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt20__throw_length_errorPKc@GLIBCXX_3.4·(4) |
| 80 | ····7 | 81 | ····77:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE9_M_assignERKS4_@GLIBCXX_3.4.21·(9) |
| 81 | ····7 | 82 | ····78:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·malloc@GLIBC_2.0·(3) |
| 82 | ····7 | 83 | ····79:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN8BamTools9BamWriterC1Ev |
| 83 | ···· | 84 | ····80:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·strlen@GLIBC_2.0·(3) |
| 84 | ····8 | 85 | ····81:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN8BamTools9BamWriter5CloseEv |
| 85 | ····8 | 86 | ····82:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK4Json5Value3getEPKcRKS0_ |
| 86 | ····8 | 87 | ····83:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·munmap@GLIBC_2.0·(3) |
| 87 | ····8 | 88 | ····84:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEC1EOS4_@GLIBCXX_3.4.21·(9) |
| 88 | ····8 | 89 | ····85:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__sprintf_chk@GLIBC_2.3.4·(2) |
| 89 | ····8 | 90 | ····86:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK8BamTools9BamReader14GetErrorStringB5cxx11Ev |
| 90 | ····8 | 91 | ····87:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·deflateEnd |
| 91 | ····8 | 92 | ····88:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK4Json5Value9asCStringEv |
| 92 | ····8 | 93 | ····89:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt28_Rb_tree_rebalance_for_erasePSt18_Rb_tree_node_baseRS_@GLIBCXX_3.4·(4) |
| 93 | ···· | 94 | ····90:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN4Json5ValueC1Ei |
| 94 | ····9 | 95 | ····91:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__snprintf_chk@GLIBC_2.3.4·(2) |
| 95 | ····9 | 96 | ····92:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSirsERi@GLIBCXX_3.4·(4) |
| 96 | ····9 | 97 | ····93:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt9bad_allocD1Ev@GLIBCXX_3.4·(4) |
| 97 | ····9 | 98 | ····94:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN8BamTools14BamMultiReader4OpenERKSt6vectorINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS7_EE |
| 98 | ····9 | 99 | ····95:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTVSt15basic_streambufIcSt11char_traitsIcEE@GLIBCXX_3.4·(4) |
| 99 | ····9 | 100 | ····96:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·stdout@GLIBC_2.0·(3) |
| 100 | ····9 | 101 | ····97:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSi10_M_extractIdEERSiRT_@GLIBCXX_3.4.9·(16) |
| 101 | ····9 | 102 | ····98:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN8BamTools9BamReaderC1Ev |
| 102 | ····9 | 103 | ····99:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSo9_M_insertImEERSoT_@GLIBCXX_3.4.9·(16) |
| 103 | ··· | 104 | ···100:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSo5flushEv@GLIBCXX_3.4·(4) |
| 104 | ···10 | 105 | ···101:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__cxa_atexit@GLIBC_2.1.3·(7) |
| 105 | ···10 | 106 | ···102:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZdlPvj@CXXABI_1.3.9·(17) |
| 106 | ···10 | 107 | ···103:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt18_Rb_tree_incrementPSt18_Rb_tree_node_base@GLIBCXX_3.4·(4) |
| 107 | ···10 | 108 | ···104:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN8BamTools9BamWriterD1Ev |
| 108 | ···10 | 109 | ···105:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK4Json5Value8asDoubleEv |
| 109 | ···10 | 110 | ···106:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt19__throw_logic_errorPKc@GLIBCXX_3.4·(4) |
| 110 | ···10 | 111 | ···107:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·crc32 |
| 111 | ···10 | 112 | ···108:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__cxa_free_exception@CXXABI_1.3·(15) |
| 112 | ···10 | 113 | ···109:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK8BamTools12BamAlignment18IsPrimaryAlignmentEv |
| 113 | ···1 | 114 | ···110:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·strcmp@GLIBC_2.0·(3) |
| 114 | ···11 | 115 | ···111:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__libc_start_main@GLIBC_2.34·(10) |
| 115 | ···11 | 116 | ···112:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN19CSmithWatermanGotoh23EnableEntropyGapPenaltyEf |
| 116 | ···11 | 117 | ···113:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTTSt14basic_ofstreamIcSt11char_traitsIcEE@GLIBCXX_3.4·(4) |
| 117 | ···11 | 118 | ···114:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK4Json5Value14toStyledStringB5cxx11Ev |
| 118 | ···11 | 119 | ···115:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK8BamTools14BamMultiReader9GetHeaderEv |
| 119 | ···11 | 120 | ···116:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1118basic_stringstreamIcSt11char_traitsIcESaIcEED1Ev@GLIBCXX_3.4.21·(9) |
| 120 | ···116:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE6insertEjPKc@GLIBCXX_3.4.21·(9) | ||
| 121 | ···117:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·toupper@GLIBC_2.0·(3) | 121 | ···117:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·toupper@GLIBC_2.0·(3) |
| 122 | ···118:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·time@GLIBC_2.0·(3) | 122 | ···118:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·time@GLIBC_2.0·(3) |
| 123 | ···119:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·lgamma@GLIBC_2.23·(1 | 123 | ···119:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·lgamma@GLIBC_2.23·(18) |
| 124 | ···120:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·posix_memalign@GLIBC_2.2·(1 | 124 | ···120:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·posix_memalign@GLIBC_2.2·(19) |
| 125 | ···121:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt28__throw_bad_array_new_lengthv@GLIBCXX_3.4.29·( | 125 | ···121:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt28__throw_bad_array_new_lengthv@GLIBCXX_3.4.29·(20) |
| 126 | ···122:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_Znaj@GLIBCXX_3.4·(4) | 126 | ···122:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_Znaj@GLIBCXX_3.4·(4) |
| 127 | ···123:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK8BamTools22SamReadGroupDictionary3EndEv | 127 | ···123:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK8BamTools22SamReadGroupDictionary3EndEv |
| 128 | ···124:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__errno_location@GLIBC_2.0·(3) | 128 | ···124:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__errno_location@GLIBC_2.0·(3) |
| 129 | ···125:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK8BamTools9BamWriter14GetErrorStringB5cxx11Ev | 129 | ···125:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK8BamTools9BamWriter14GetErrorStringB5cxx11Ev |
| 130 | ···126:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·inflate | 130 | ···126:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·inflate |
| 131 | ···127:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·fflush@GLIBC_2.0·(3) | 131 | ···127:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·fflush@GLIBC_2.0·(3) |
| 132 | ···128:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·memcmp@GLIBC_2.0·(3) | 132 | ···128:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·memcmp@GLIBC_2.0·(3) |
| Offset 134, 25 lines modified | Offset 134, 25 lines modified | ||
| 134 | ···130:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTVN4Json10FastWriterE | 134 | ···130:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTVN4Json10FastWriterE |
| 135 | ···131:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·inflateInit2_ | 135 | ···131:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·inflateInit2_ |
| 136 | ···132:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE7compareEjjRKS4_jj@GLIBCXX_3.4.21·(9) | 136 | ···132:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE7compareEjjRKS4_jj@GLIBCXX_3.4.21·(9) |
| 137 | ···133:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN4Json6WriterD2Ev | 137 | ···133:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN4Json6WriterD2Ev |
| 138 | ···134:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN8BamTools9SamHeaderC1ERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE | 138 | ···134:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN8BamTools9SamHeaderC1ERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE |
| 139 | ···135:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·pthread_join@GLIBC_2.34·(10) | 139 | ···135:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·pthread_join@GLIBC_2.34·(10) |
| Max diff block lines reached; 283696/304291 bytes (93.23%) of diff not shown. | |||
| Offset 1, 342 lines modified | Offset 1, 344 lines modified | ||
| 1 | Relocation·section·'.rel.dyn'·at·offset·0x1c | 1 | Relocation·section·'.rel.dyn'·at·offset·0x1ce64·contains·75·entries: |
| 2 | ·Offset·····Info····Type················Sym.·Value··Symbol's·Name | 2 | ·Offset·····Info····Type················Sym.·Value··Symbol's·Name |
| 3 | 0012cda0··00000008·R_386_RELATIVE········ | ||
| 3 | 0012 | 4 | 0012cda4··00000008·R_386_RELATIVE········ |
| 4 | 0012 | 5 | 0012cda8··00000008·R_386_RELATIVE········ |
| 5 | 0012 | 6 | 0012cdac··00000008·R_386_RELATIVE········ |
| 6 | 0012 | 7 | 0012cdb0··00000008·R_386_RELATIVE········ |
| 7 | 0012 | 8 | 0012cdb4··00000008·R_386_RELATIVE········ |
| 8 | 0012 | 9 | 0012cdb8··00000008·R_386_RELATIVE········ |
| 9 | 0012 | 10 | 0012cdbc··00000008·R_386_RELATIVE········ |
| 10 | 0012 | 11 | 0012cdc0··00000008·R_386_RELATIVE········ |
| 11 | 0012 | 12 | 0012cdc4··00000008·R_386_RELATIVE········ |
| 12 | 0012 | 13 | 0012cdc8··00000008·R_386_RELATIVE········ |
| 13 | 0012 | 14 | 0012cdcc··00000008·R_386_RELATIVE········ |
| 14 | 0012 | 15 | 0012cdd0··00000008·R_386_RELATIVE········ |
| 15 | 0012 | 16 | 0012cdd4··00000008·R_386_RELATIVE········ |
| 16 | 0012 | 17 | 0012cdd8··00000008·R_386_RELATIVE········ |
| 17 | 0012 | 18 | 0012cddc··00000008·R_386_RELATIVE········ |
| 18 | 0012 | 19 | 0012cde0··00000008·R_386_RELATIVE········ |
| 19 | 0012 | 20 | 0012cde4··00000008·R_386_RELATIVE········ |
| 20 | 0012 | 21 | 0012cde8··00000008·R_386_RELATIVE········ |
| 21 | 0012 | 22 | 0012cdec··00000008·R_386_RELATIVE········ |
| 22 | 0012 | 23 | 0012cdf0··00000008·R_386_RELATIVE········ |
| 23 | 0012 | 24 | 0012cdf4··00000008·R_386_RELATIVE········ |
| 24 | 0012 | 25 | 0012cdf8··00000008·R_386_RELATIVE········ |
| 25 | 0012 | 26 | 0012cdfc··00000008·R_386_RELATIVE········ |
| 26 | 0012 | 27 | 0012ce00··00000008·R_386_RELATIVE········ |
| 27 | 0012 | 28 | 0012ce04··00000008·R_386_RELATIVE········ |
| 28 | 0012 | 29 | 0012ce08··00000008·R_386_RELATIVE········ |
| 29 | 0012 | 30 | 0012ce0c··00000008·R_386_RELATIVE········ |
| 30 | 0012 | 31 | 0012ce10··00000008·R_386_RELATIVE········ |
| 31 | 0012 | 32 | 0012ce14··00000008·R_386_RELATIVE········ |
| 32 | 0012 | 33 | 0012ce18··00000008·R_386_RELATIVE········ |
| 33 | 0012 | 34 | 0012ce1c··00000008·R_386_RELATIVE········ |
| 34 | 0012 | 35 | 0012ce20··00000008·R_386_RELATIVE········ |
| 35 | 0012 | 36 | 0012ce24··00000008·R_386_RELATIVE········ |
| 36 | 0012 | 37 | 0012ce28··00000008·R_386_RELATIVE········ |
| 37 | 0012 | 38 | 0012ce2c··00000008·R_386_RELATIVE········ |
| 38 | 0012 | 39 | 0012ce30··00000008·R_386_RELATIVE········ |
| 39 | 0012 | 40 | 0012ce34··00000008·R_386_RELATIVE········ |
| 40 | 0012 | 41 | 0012ce38··00000008·R_386_RELATIVE········ |
| 41 | 0012 | 42 | 0012cf84··00000008·R_386_RELATIVE········ |
| 42 | 0012 | 43 | 0012d424··00000008·R_386_RELATIVE········ |
| 43 | 0012 | 44 | 0012cf74··00000d06·R_386_GLOB_DAT·········00000000···__cxa_finalize@GLIBC_2.1.3 |
| 44 | 0012 | 45 | 0012cf78··00001806·R_386_GLOB_DAT·········00000000···_ZTVSt9basic_iosIcSt11char_traitsIcEE@GLIBCXX_3.4 |
| 45 | 0012 | 46 | 0012cf7c··00002906·R_386_GLOB_DAT·········00000000···_ZTVNSt7__cxx1119basic_istringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21 |
| 46 | 0012 | 47 | 0012cf80··00003206·R_386_GLOB_DAT·········00000000···_ZTTNSt7__cxx1118basic_stringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21 |
| 47 | 0012 | 48 | 0012cf88··00005d06·R_386_GLOB_DAT·········00000000···_ZNSt9bad_allocD1Ev@GLIBCXX_3.4 |
| 48 | 0012 | 49 | 0012cf8c··00005f06·R_386_GLOB_DAT·········00000000···_ZTVSt15basic_streambufIcSt11char_traitsIcEE@GLIBCXX_3.4 |
| 49 | 0012 | 50 | 0012cf90··00006006·R_386_GLOB_DAT·········00000000···stdout@GLIBC_2.0 |
| 50 | 0012 | 51 | 0012cf94··00007106·R_386_GLOB_DAT·········00000000···_ZTTSt14basic_ofstreamIcSt11char_traitsIcEE@GLIBCXX_3.4 |
| 51 | 0012 | 52 | 0012cf98··00008206·R_386_GLOB_DAT·········00000000···_ZTVN4Json10FastWriterE |
| 52 | 0012 | 53 | 0012cf9c··00008b06·R_386_GLOB_DAT·········00000000···_ZTVSt9bad_alloc@GLIBCXX_3.4 |
| 53 | 0012 | 54 | 0012cfa0··00008e06·R_386_GLOB_DAT·········00000000···_ZTTNSt7__cxx1119basic_istringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21 |
| 54 | 0012 | 55 | 0012cfa4··00009206·R_386_GLOB_DAT·········00000000···_ZTVNSt7__cxx1119basic_ostringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21 |
| 55 | 0012 | 56 | 0012cfa8··00009606·R_386_GLOB_DAT·········00000000···_ZTVSt14basic_ifstreamIcSt11char_traitsIcEE@GLIBCXX_3.4 |
| 56 | 0012 | 57 | 0012cfac··00009e06·R_386_GLOB_DAT·········00000000···_ZNSt13runtime_errorD1Ev@GLIBCXX_3.4 |
| 57 | 0012 | 58 | 0012cfb0··0000a006·R_386_GLOB_DAT·········00000000···_ZTVNSt7__cxx1118basic_stringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21 |
| 58 | 0012 | 59 | 0012cfb4··0000ac06·R_386_GLOB_DAT·········00000000···_ZTTNSt7__cxx1119basic_ostringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21 |
| 59 | 0012 | 60 | 0012cfb8··0000b906·R_386_GLOB_DAT·········00000000···_ZNSt11logic_errorD1Ev@GLIBCXX_3.4 |
| 60 | 0012 | 61 | 0012cfbc··0000be06·R_386_GLOB_DAT·········00000000···_ZSt4cout@GLIBCXX_3.4 |
| 61 | 0012 | 62 | 0012cfc0··0000bf06·R_386_GLOB_DAT·········00000000···_ZTISt9bad_alloc@GLIBCXX_3.4 |
| 62 | 0012 | 63 | 0012d434··0000bf01·R_386_32···············00000000···_ZTISt9bad_alloc@GLIBCXX_3.4 |
| 63 | 0012 | 64 | 0012cfc4··0000d906·R_386_GLOB_DAT·········00000000···_ZTVSt13basic_filebufIcSt11char_traitsIcEE@GLIBCXX_3.4 |
| 64 | 0012 | 65 | 0012cfc8··0000e206·R_386_GLOB_DAT·········00000000···_ZTVSt14basic_ofstreamIcSt11char_traitsIcEE@GLIBCXX_3.4 |
| 65 | 0012 | 66 | 0012cfcc··00010106·R_386_GLOB_DAT·········00000000···_ITM_deregisterTMCloneTable |
| 66 | 0012 | 67 | 0012cfd0··00010406·R_386_GLOB_DAT·········00000000···_ZTISt11logic_error@GLIBCXX_3.4 |
| 67 | 0012 | 68 | 0012cfd4··00010f06·R_386_GLOB_DAT·········00000000···stderr@GLIBC_2.0 |
| 68 | 0012 | 69 | 0012cfd8··00011106·R_386_GLOB_DAT·········00000000···__gmon_start__ |
| 69 | 0012 | 70 | 0012cfdc··00011606·R_386_GLOB_DAT·········00000000···_ITM_registerTMCloneTable |
| 70 | 0012 | 71 | 0012cfe0··00011c06·R_386_GLOB_DAT·········00000000···_ZSt4cerr@GLIBCXX_3.4 |
| 71 | 0012 | 72 | 0012d428··00011c01·R_386_32···············00000000···_ZSt4cerr@GLIBCXX_3.4 |
| 72 | 0012 | 73 | 0012cfe4··00011d06·R_386_GLOB_DAT·········00000000···_ZTTSt14basic_ifstreamIcSt11char_traitsIcEE@GLIBCXX_3.4 |
| 73 | 0012 | 74 | 0012cfe8··00011f06·R_386_GLOB_DAT·········00000000···_ZTISt13runtime_error@GLIBCXX_3.4 |
| 74 | 0012 | 75 | 0012cfec··00012006·R_386_GLOB_DAT·········00000000···_ZTVNSt7__cxx1115basic_stringbufIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21 |
| 75 | 0012 | 76 | 0012cff0··00012706·R_386_GLOB_DAT·········00000000···_ZNSt8ios_base4InitD1Ev@GLIBCXX_3.4 |
| 76 | 0012 | 77 | 0012d42c··0000f101·R_386_32···············00000000···__gxx_personality_v0@CXXABI_1.3 |
| 77 | Relocation·section·'.rel.plt'·at·offset·0x1 | 78 | Relocation·section·'.rel.plt'·at·offset·0x1d0bc·contains·263·entries: |
| 78 | ·Offset·····Info····Type················Sym.·Value··Symbol's·Name | 79 | ·Offset·····Info····Type················Sym.·Value··Symbol's·Name |
| 79 | 0012 | 80 | 0012d000··00000107·R_386_JUMP_SLOT········00000000···__printf_chk@GLIBC_2.3.4 |
| 80 | 0012 | 81 | 0012d004··00000207·R_386_JUMP_SLOT········00000000···open@GLIBC_2.0 |
| 81 | 0012 | 82 | 0012d008··00000307·R_386_JUMP_SLOT········00000000···pthread_mutex_destroy@GLIBC_2.0 |
| 82 | 0012 | 83 | 0012d00c··00000407·R_386_JUMP_SLOT········00000000···_ZNSo3putEc@GLIBCXX_3.4 |
| 83 | 0012 | 84 | 0012d010··00000507·R_386_JUMP_SLOT········00000000···roundf@GLIBC_2.1 |
| 84 | 0012 | 85 | 0012d014··00000607·R_386_JUMP_SLOT········00000000···_ZN19CSmithWatermanGotoh5AlignERjRNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERKS6_S9_ |
| 85 | 0012 | 86 | 0012d018··00000707·R_386_JUMP_SLOT········00000000···_ZNK8BamTools12BamAlignment14SetErrorStringERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES8_ |
| 86 | 0012 | 87 | 0012d01c··00000807·R_386_JUMP_SLOT········00000000···_Znwj@GLIBCXX_3.4 |
| 87 | 0012 | 88 | 0012d020··00000907·R_386_JUMP_SLOT········00000000···strcat@GLIBC_2.0 |
| 88 | 0012 | 89 | 0012d024··00000a07·R_386_JUMP_SLOT········00000000···_ZNK8BamTools14BamMultiReader14GetErrorStringB5cxx11Ev |
| 89 | 0012 | 90 | 0012d028··00000b07·R_386_JUMP_SLOT········00000000···_ZNSt8__detail15_List_node_base7_M_hookEPS0_@GLIBCXX_3.4.15 |
| 90 | 0012 | 91 | 0012d02c··00000c07·R_386_JUMP_SLOT········00000000···deflateInit2_ |
| 91 | 0012 | 92 | 0012d030··00000e07·R_386_JUMP_SLOT········00000000···fread@GLIBC_2.0 |
| 92 | 0012 | 93 | 0012d034··00000f07·R_386_JUMP_SLOT········00000000···wrapper2_dgemv_ |
| 93 | 0012 | 94 | 0012d038··00001007·R_386_JUMP_SLOT········00000000···_ZNK8BamTools12BamAlignment8IsMappedEv |
| 94 | 0012 | 95 | 0012d03c··00001107·R_386_JUMP_SLOT········00000000···__ctype_toupper_loc@GLIBC_2.3 |
| 95 | 0012 | 96 | 0012d040··00001207·R_386_JUMP_SLOT········00000000···_ZNSt7__cxx1115basic_stringbufIcSt11char_traitsIcESaIcEE7_M_syncEPcjj@GLIBCXX_3.4.21 |
| 96 | 0012 | 97 | 0012d044··00001307·R_386_JUMP_SLOT········00000000···_ZSt29_Rb_tree_insert_and_rebalancebPSt18_Rb_tree_node_baseS0_RS_@GLIBCXX_3.4 |
| 97 | 0012 | 98 | 0012d048··00001407·R_386_JUMP_SLOT········00000000···__ctype_tolower_loc@GLIBC_2.3 |
| 98 | 0012 | 99 | 0012d04c··00001507·R_386_JUMP_SLOT········00000000···_ZN8BamTools15SamProgramChain5BeginEv |
| 99 | 0012 | 100 | 0012d050··00001607·R_386_JUMP_SLOT········00000000···pthread_mutex_trylock@GLIBC_2.34 |
| 100 | 0012 | 101 | 0012d054··00001707·R_386_JUMP_SLOT········00000000···_ZNSdD2Ev@GLIBCXX_3.4 |
| 101 | 0012 | 102 | 0012d058··00001907·R_386_JUMP_SLOT········00000000···_ZN8BamTools14BamMultiReaderD1Ev |
| 102 | 0012 | 103 | 0012d05c··00001a07·R_386_JUMP_SLOT········00000000···wrapper2_dgesv_ |
| 104 | 0012d060··00001b07·R_386_JUMP_SLOT········00000000···_ZdlPvjSt11align_val_t@CXXABI_1.3.11 | ||
| 103 | 0012 | 105 | 0012d064··00001c07·R_386_JUMP_SLOT········00000000···_ZNSt13basic_filebufIcSt11char_traitsIcEE5closeEv@GLIBCXX_3.4 |
| 104 | 0012 | 106 | 0012d068··00001d07·R_386_JUMP_SLOT········00000000···_ZNKSt12__basic_fileIcE7is_openEv@GLIBCXX_3.4 |
| 105 | 0012 | 107 | 0012d06c··00001e07·R_386_JUMP_SLOT········00000000···sqrtf@GLIBC_2.0 |
| 106 | 0012 | 108 | 0012d070··00001f07·R_386_JUMP_SLOT········00000000···mkdir@GLIBC_2.0 |
| 107 | 0012 | 109 | 0012d074··00002007·R_386_JUMP_SLOT········00000000···_ZN8BamTools14BamMultiReader20GetNextAlignmentCoreERNS_12BamAlignmentE |
| 108 | 0012 | 110 | 0012d078··00002107·R_386_JUMP_SLOT········00000000···_ZNSt7__cxx1119basic_ostringstreamIcSt11char_traitsIcESaIcEED1Ev@GLIBCXX_3.4.21 |
| 109 | 0012 | 111 | 0012d07c··00002207·R_386_JUMP_SLOT········00000000···_ZNSt14basic_ifstreamIcSt11char_traitsIcEED1Ev@GLIBCXX_3.4 |
| 110 | 0012 | 112 | 0012d080··00002307·R_386_JUMP_SLOT········00000000···strstr@GLIBC_2.0 |
| 111 | 0012 | 113 | 0012d084··00002407·R_386_JUMP_SLOT········00000000···_ZN8BamTools14BamMultiReader5CloseEv |
| 112 | 0012 | 114 | 0012d088··00002507·R_386_JUMP_SLOT········00000000···_ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE7compareEPKc@GLIBCXX_3.4.21 |
| 113 | 0012 | 115 | 0012d08c··00002607·R_386_JUMP_SLOT········00000000···_ZN8BamTools9BamWriter4OpenERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERKNS_9SamHeaderERKSt6vectorINS_7RefDataESaISD_EE |
| 114 | 0012 | 116 | 0012d090··00002707·R_386_JUMP_SLOT········00000000···_ZN4Json5ValueC1Ey |
| 115 | 0012 | 117 | 0012d094··00002807·R_386_JUMP_SLOT········00000000···_ZNSt8ios_baseC2Ev@GLIBCXX_3.4 |
| 116 | 0012 | 118 | 0012d098··00002a07·R_386_JUMP_SLOT········00000000···_ZN8BamTools12BamAlignmentC1Ev |
| 117 | 0012 | 119 | 0012d09c··00002b07·R_386_JUMP_SLOT········00000000···_ZNSt8ios_baseD2Ev@GLIBCXX_3.4 |
| 118 | 0012 | 120 | 0012d0a0··00002c07·R_386_JUMP_SLOT········00000000···_ZN8BamTools9BamWriter18SetCompressionModeERKNS0_15CompressionModeE |
| 119 | 0012 | 121 | 0012d0a4··00002d07·R_386_JUMP_SLOT········00000000···_ZN4Json6Reader5parseERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERNS_5ValueEb |
| 120 | 0012 | 122 | 0012d0a8··00002e07·R_386_JUMP_SLOT········00000000···strdup@GLIBC_2.0 |
| 121 | 0012 | 123 | 0012d0ac··00002f07·R_386_JUMP_SLOT········00000000···realpath@GLIBC_2.3 |
| 122 | 0012 | 124 | 0012d0b0··00003007·R_386_JUMP_SLOT········00000000···pthread_cond_broadcast@GLIBC_2.3.2 |
| 123 | 0012 | 125 | 0012d0b4··00003107·R_386_JUMP_SLOT········00000000···_ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE6substrEjj@GLIBCXX_3.4.21 |
| Max diff block lines reached; -1/61042 bytes (-0.00%) of diff not shown. | |||
| Offset 1, 38 lines modified | Offset 1, 38 lines modified | ||
| 1 | Dynamic·section·at·offset·0x12 | 1 | Dynamic·section·at·offset·0x12be3c·contains·35·entries: |
| 2 | ··Tag········Type·························Name/Value | 2 | ··Tag········Type·························Name/Value |
| 3 | ·0x00000001·(NEEDED)·····················Shared·library:·[libbamtools.so.2.5.2] | 3 | ·0x00000001·(NEEDED)·····················Shared·library:·[libbamtools.so.2.5.2] |
| 4 | ·0x00000001·(NEEDED)·····················Shared·library:·[libz.so.1] | 4 | ·0x00000001·(NEEDED)·····················Shared·library:·[libz.so.1] |
| 5 | ·0x00000001·(NEEDED)·····················Shared·library:·[libarmadillo.so.11] | 5 | ·0x00000001·(NEEDED)·····················Shared·library:·[libarmadillo.so.11] |
| 6 | ·0x00000001·(NEEDED)·····················Shared·library:·[libjsoncpp.so.25] | 6 | ·0x00000001·(NEEDED)·····················Shared·library:·[libjsoncpp.so.25] |
| 7 | ·0x00000001·(NEEDED)·····················Shared·library:·[libsmithwaterman.so.0] | 7 | ·0x00000001·(NEEDED)·····················Shared·library:·[libsmithwaterman.so.0] |
| 8 | ·0x00000001·(NEEDED)·····················Shared·library:·[libdisorder.so.0] | 8 | ·0x00000001·(NEEDED)·····················Shared·library:·[libdisorder.so.0] |
| 9 | ·0x00000001·(NEEDED)·····················Shared·library:·[libstdc++.so.6] | 9 | ·0x00000001·(NEEDED)·····················Shared·library:·[libstdc++.so.6] |
| 10 | ·0x00000001·(NEEDED)·····················Shared·library:·[libm.so.6] | 10 | ·0x00000001·(NEEDED)·····················Shared·library:·[libm.so.6] |
| 11 | ·0x00000001·(NEEDED)·····················Shared·library:·[libgcc_s.so.1] | 11 | ·0x00000001·(NEEDED)·····················Shared·library:·[libgcc_s.so.1] |
| 12 | ·0x00000001·(NEEDED)·····················Shared·library:·[libc.so.6] | 12 | ·0x00000001·(NEEDED)·····················Shared·library:·[libc.so.6] |
| 13 | ·0x0000000c·(INIT)·······················0x1e000 | 13 | ·0x0000000c·(INIT)·······················0x1e000 |
| 14 | ·0x0000000d·(FINI)·······················0x | 14 | ·0x0000000d·(FINI)·······················0xf4324 |
| 15 | ·0x00000019·(INIT_ARRAY)·················0x12 | 15 | ·0x00000019·(INIT_ARRAY)·················0x12cda0 |
| 16 | ·0x0000001b·(INIT_ARRAYSZ)···············1 | 16 | ·0x0000001b·(INIT_ARRAYSZ)···············152·(bytes) |
| 17 | ·0x0000001a·(FINI_ARRAY)·················0x12 | 17 | ·0x0000001a·(FINI_ARRAY)·················0x12ce38 |
| 18 | ·0x0000001c·(FINI_ARRAYSZ)···············4·(bytes) | 18 | ·0x0000001c·(FINI_ARRAYSZ)···············4·(bytes) |
| 19 | ·0x6ffffef5·(GNU_HASH)···················0x1ec | 19 | ·0x6ffffef5·(GNU_HASH)···················0x1ec |
| 20 | ·0x00000005·(STRTAB)·····················0x8 | 20 | ·0x00000005·(STRTAB)·····················0x839c |
| 21 | ·0x00000006·(SYMTAB)·····················0x2 | 21 | ·0x00000006·(SYMTAB)·····················0x284c |
| 22 | ·0x0000000a·(STRSZ)······················8 | 22 | ·0x0000000a·(STRSZ)······················81245·(bytes) |
| 23 | ·0x0000000b·(SYMENT)·····················16·(bytes) | 23 | ·0x0000000b·(SYMENT)·····················16·(bytes) |
| 24 | ·0x00000015·(DEBUG)······················0x0 | 24 | ·0x00000015·(DEBUG)······················0x0 |
| 25 | ·0x00000003·(PLTGOT)·····················0x12 | 25 | ·0x00000003·(PLTGOT)·····················0x12cff4 |
| 26 | ·0x00000002·(PLTRELSZ)···················2 | 26 | ·0x00000002·(PLTRELSZ)···················2104·(bytes) |
| 27 | ·0x00000014·(PLTREL)·····················REL | 27 | ·0x00000014·(PLTREL)·····················REL |
| 28 | ·0x00000017·(JMPREL)·····················0x1 | 28 | ·0x00000017·(JMPREL)·····················0x1d0bc |
| 29 | ·0x00000011·(REL)························0x1c | 29 | ·0x00000011·(REL)························0x1ce64 |
| 30 | ·0x00000012·(RELSZ)······················ | 30 | ·0x00000012·(RELSZ)······················600·(bytes) |
| 31 | ·0x00000013·(RELENT)·····················8·(bytes) | 31 | ·0x00000013·(RELENT)·····················8·(bytes) |
| 32 | ·0x6ffffffb·(FLAGS_1)····················Flags:·PIE | 32 | ·0x6ffffffb·(FLAGS_1)····················Flags:·PIE |
| 33 | ·0x6ffffffe·(VERNEED)····················0x1c | 33 | ·0x6ffffffe·(VERNEED)····················0x1cc64 |
| 34 | ·0x6fffffff·(VERNEEDNUM)·················4 | 34 | ·0x6fffffff·(VERNEEDNUM)·················4 |
| 35 | ·0x6ffffff0·(VERSYM)·····················0x1 | 35 | ·0x6ffffff0·(VERSYM)·····················0x1c0fa |
| 36 | ·0x6ffffffa·(RELCOUNT)···················4 | 36 | ·0x6ffffffa·(RELCOUNT)···················41 |
| 37 | ·0x00000000·(NULL)·······················0x0 | 37 | ·0x00000000·(NULL)·······················0x0 |
| Offset 1, 8 lines modified | Offset 1, 8 lines modified | ||
| 1 | Displaying·notes·found·in:·.note.gnu.build-id | 1 | Displaying·notes·found·in:·.note.gnu.build-id |
| 2 | ··Owner················Data·size·» Description | 2 | ··Owner················Data·size·» Description |
| 3 | ··GNU··················0x00000014» NT_GNU_BUILD_ID·(unique·build·ID·bitstring)» ····Build·ID:· | 3 | ··GNU··················0x00000014» NT_GNU_BUILD_ID·(unique·build·ID·bitstring)» ····Build·ID:·94b56f66fe5cec5e6f031245f840bcf70e13ee39 |
| 4 | Displaying·notes·found·in:·.note.ABI-tag | 4 | Displaying·notes·found·in:·.note.ABI-tag |
| 5 | ··Owner················Data·size·» Description | 5 | ··Owner················Data·size·» Description |
| 6 | ··GNU··················0x00000010» NT_GNU_ABI_TAG·(ABI·version·tag)» ····OS:·Linux,·ABI:·3.2.0 | 6 | ··GNU··················0x00000010» NT_GNU_ABI_TAG·(ABI·version·tag)» ····OS:·Linux,·ABI:·3.2.0 |
| Offset 1, 84 lines modified | Offset 1, 84 lines modified | ||
| 1 | Version·symbols·section·'.gnu.version'·contains·14 | 1 | Version·symbols·section·'.gnu.version'·contains·1461·entries: |
| 2 | ·Addr:·0x000000000001 | 2 | ·Addr:·0x000000000001c0fa··Offset:·0x0001c0fa··Link:·5·(.dynsym) |
| 3 | ··000:···0·(*local*)·······2·(GLIBC_2.3.4)···3·(GLIBC_2.0)·····3·(GLIBC_2.0)·· | 3 | ··000:···0·(*local*)·······2·(GLIBC_2.3.4)···3·(GLIBC_2.0)·····3·(GLIBC_2.0)·· |
| 4 | ··004:···4·(GLIBCXX_3.4)···5·(GLIBC_2.1)·····1·(*global*)······1·(*global*)··· | 4 | ··004:···4·(GLIBCXX_3.4)···5·(GLIBC_2.1)·····1·(*global*)······1·(*global*)··· |
| 5 | ··008:···4·(GLIBCXX_3.4)···3·(GLIBC_2.0)·····1·(*global*)······6·(GLIBCXX_3.4.15)· | 5 | ··008:···4·(GLIBCXX_3.4)···3·(GLIBC_2.0)·····1·(*global*)······6·(GLIBCXX_3.4.15)· |
| 6 | ··00c:···1·(*global*)······7·(GLIBC_2.1.3)···3·(GLIBC_2.0)·····1·(*global*)··· | 6 | ··00c:···1·(*global*)······7·(GLIBC_2.1.3)···3·(GLIBC_2.0)·····1·(*global*)··· |
| 7 | ··010:···1·(*global*)······8·(GLIBC_2.3)·····9·(GLIBCXX_3.4.21)····4·(GLIBCXX_3.4) | 7 | ··010:···1·(*global*)······8·(GLIBC_2.3)·····9·(GLIBCXX_3.4.21)····4·(GLIBCXX_3.4) |
| 8 | ··014:···8·(GLIBC_2.3)·····1·(*global*)······a·(GLIBC_2.34)····4·(GLIBCXX_3.4) | 8 | ··014:···8·(GLIBC_2.3)·····1·(*global*)······a·(GLIBC_2.34)····4·(GLIBCXX_3.4) |
| 9 | ··018:···4·(GLIBCXX_3.4)···1·(*global*)······1·(*global*)······ | 9 | ··018:···4·(GLIBCXX_3.4)···1·(*global*)······1·(*global*)······b·(CXXABI_1.3.11) |
| 10 | ··01c:···4·(GLIBCXX_3.4)···4·(GLIBCXX_3.4)···c·(GLIBC_2.0)·····3·(GLIBC_2.0)·· | ||
| 11 | ··020:···1·(*global*)······9·(GLIBCXX_3.4.21)····4·(GLIBCXX_3.4)···3·(GLIBC_2.0)·· | ||
| 12 | ··024:···1·(*global*)······9·(GLIBCXX_3.4.21)····1·(*global*)······1·(*global*)··· | ||
| 13 | ··028:···4·(GLIBCXX_3.4)···9·(GLIBCXX_3.4.21)····1·(*global*)······4·(GLIBCXX_3.4) | ||
| 14 | ··02c:···1·(*global*)······1·(*global*)······3·(GLIBC_2.0)·····8·(GLIBC_2.3)·· | ||
| 15 | ··030:···d·(GLIBC_2.3.2)···9·(GLIBCXX_3.4.21)····9·(GLIBCXX_3.4.21)····4·(GLIBCXX_3.4) | ||
| 16 | ··034:···1·(*global*)······1·(*global*)······9·(GLIBCXX_3.4.21)····e·(GLIBC_2.1)·· | ||
| 17 | ··038:···f·(CXXABI_1.3)····9·(GLIBCXX_3.4.21)····3·(GLIBC_2.0)·····1·(*global*)··· | ||
| 18 | ··03c:···9·(GLIBCXX_3.4.21)····9·(GLIBCXX_3.4.21)····1·(*global*)······1·(*global*)··· | ||
| 19 | ··040:···4·(GLIBCXX_3.4)···f·(CXXABI_1.3)····1·(*global*)······3·(GLIBC_2.0)·· | ||
| 20 | ··044:···3·(GLIBC_2.0)·····1·(*global*)·····10·(GLIBCXX_3.4.9)···3·(GLIBC_2.0)·· | ||
| 21 | ··048:···9·(GLIBCXX_3.4.21)····3·(GLIBC_2.0)·····1·(*global*)······1·(*global*)··· | ||
| 10 | ··0 | 22 | ··04c:···4·(GLIBCXX_3.4)···9·(GLIBCXX_3.4.21)····3·(GLIBC_2.0)·····1·(*global*)··· |
| 11 | ··020:···9·(GLIBCXX_3.4.21)····4·(GLIBCXX_3.4)···3·(GLIBC_2.0)·····1·(*global*)··· | ||
| 12 | ··0 | 23 | ··050:···3·(GLIBC_2.0)·····1·(*global*)······1·(*global*)······3·(GLIBC_2.0)·· |
| 24 | ··054:···9·(GLIBCXX_3.4.21)····2·(GLIBC_2.3.4)···1·(*global*)······1·(*global*)··· | ||
| 25 | ··058:···1·(*global*)······4·(GLIBCXX_3.4)···1·(*global*)······2·(GLIBC_2.3.4) | ||
| 13 | ··028:···9·(GLIBCXX_3.4.21)····1·(*global*)······4·(GLIBCXX_3.4)···1·(*global*)··· | ||
| 14 | ··02c:···1·(*global*)······3·(GLIBC_2.0)·····8·(GLIBC_2.3)·····c·(GLIBC_2.3.2) | ||
| 15 | ··030:···9·(GLIBCXX_3.4.21)····9·(GLIBCXX_3.4.21)····4·(GLIBCXX_3.4)···1·(*global*)··· | ||
| 16 | ··034:···1·(*global*)······9·(GLIBCXX_3.4.21)····d·(GLIBC_2.1)·····e·(CXXABI_1.3)· | ||
| 17 | ··0 | 26 | ··05c:···4·(GLIBCXX_3.4)···4·(GLIBCXX_3.4)···1·(*global*)······4·(GLIBCXX_3.4) |
| 18 | ··0 | 27 | ··060:···3·(GLIBC_2.0)····10·(GLIBCXX_3.4.9)···1·(*global*)·····10·(GLIBCXX_3.4.9) |
| 28 | ··064:···4·(GLIBCXX_3.4)···7·(GLIBC_2.1.3)··11·(CXXABI_1.3.9)···4·(GLIBCXX_3.4) | ||
| 29 | ··068:···1·(*global*)······1·(*global*)······4·(GLIBCXX_3.4)···1·(*global*)··· | ||
| 19 | ··0 | 30 | ··06c:···f·(CXXABI_1.3)····1·(*global*)······3·(GLIBC_2.0)·····a·(GLIBC_2.34)· |
| 20 | ··044:···1·(*global*)······f·(GLIBCXX_3.4.9)···3·(GLIBC_2.0)·····9·(GLIBCXX_3.4.21)· | ||
| 21 | ··048:···3·(GLIBC_2.0)·····1·(*global*)······1·(*global*)······4·(GLIBCXX_3.4) | ||
| 22 | ··04c:···9·(GLIBCXX_3.4.21)····3·(GLIBC_2.0)·····1·(*global*)······3·(GLIBC_2.0)·· | ||
| 23 | ··050:···1·(*global*)······1·(*global*)······3·(GLIBC_2.0)·····9·(GLIBCXX_3.4.21)· | ||
| 24 | ··054:···2·(GLIBC_2.3.4)···1·(*global*)······1·(*global*)······1·(*global*)··· | ||
| 25 | ··058:···4·(GLIBCXX_3.4)···1·(*global*)······2·(GLIBC_2.3.4)···4·(GLIBCXX_3.4) | ||
| 26 | ··05c:···4·(GLIBCXX_3.4)···1·(*global*)······4·(GLIBCXX_3.4)···3·(GLIBC_2.0)·· | ||
| 27 | ··060:···f·(GLIBCXX_3.4.9)···1·(*global*)······f·(GLIBCXX_3.4.9)···4·(GLIBCXX_3.4) | ||
| 28 | ··064:···7·(GLIBC_2.1.3)··10·(CXXABI_1.3.9)···4·(GLIBCXX_3.4)···1·(*global*)··· | ||
| 29 | ··0 | 31 | ··070:···1·(*global*)······4·(GLIBCXX_3.4)···1·(*global*)······1·(*global*)··· |
| 30 | ··06c:···1·(*global*)······3·(GLIBC_2.0)·····a·(GLIBC_2.34)····1·(*global*)··· | ||
| 31 | ··070:···4·(GLIBCXX_3.4)···1·(*global*)······1·(*global*)······9·(GLIBCXX_3.4.21)· | ||
| 32 | ··074:···9·(GLIBCXX_3.4.21)····3·(GLIBC_2.0)·····3·(GLIBC_2.0)····1 | 32 | ··074:···9·(GLIBCXX_3.4.21)····3·(GLIBC_2.0)·····3·(GLIBC_2.0)····12·(GLIBC_2.23)· |
| 33 | ··078:··1 | 33 | ··078:··13·(GLIBC_2.2)····14·(GLIBCXX_3.4.29)····4·(GLIBCXX_3.4)···1·(*global*)··· |
| 34 | ··07c:···3·(GLIBC_2.0)·····1·(*global*)······1·(*global*)······3·(GLIBC_2.0)·· | 34 | ··07c:···3·(GLIBC_2.0)·····1·(*global*)······1·(*global*)······3·(GLIBC_2.0)·· |
| 35 | ··080:···3·(GLIBC_2.0)·····1·(*global*)······1·(*global*)······1·(*global*)··· | 35 | ··080:···3·(GLIBC_2.0)·····1·(*global*)······1·(*global*)······1·(*global*)··· |
| 36 | ··084:···9·(GLIBCXX_3.4.21)····1·(*global*)······1·(*global*)······a·(GLIBC_2.34)· | 36 | ··084:···9·(GLIBCXX_3.4.21)····1·(*global*)······1·(*global*)······a·(GLIBC_2.34)· |
| 37 | ··088:···4·(GLIBCXX_3.4)··1 | 37 | ··088:···4·(GLIBCXX_3.4)··15·(GLIBC_2.33)····1·(*global*)······4·(GLIBCXX_3.4) |
| 38 | ··08c:···1·(*global*)······3·(GLIBC_2.0)·····9·(GLIBCXX_3.4.21)··· | 38 | ··08c:···1·(*global*)······3·(GLIBC_2.0)·····9·(GLIBCXX_3.4.21)···10·(GLIBCXX_3.4.9) |
| 39 | ··090:···9·(GLIBCXX_3.4.21)···· | 39 | ··090:···9·(GLIBCXX_3.4.21)····e·(GLIBC_2.1)·····9·(GLIBCXX_3.4.21)···16·(GLIBC_2.7)·· |
| 40 | ··094:···3·(GLIBC_2.0)·····1·(*global*)······4·(GLIBCXX_3.4)···9·(GLIBCXX_3.4.21)· | 40 | ··094:···3·(GLIBC_2.0)·····1·(*global*)······4·(GLIBCXX_3.4)···9·(GLIBCXX_3.4.21)· |
| 41 | ··098:···1·(*global*)······4·(GLIBCXX_3.4)···1·(*global*)······9·(GLIBCXX_3.4.21)· | 41 | ··098:···1·(*global*)······4·(GLIBCXX_3.4)···1·(*global*)······9·(GLIBCXX_3.4.21)· |
| 42 | ··09c:···1·(*global*)······1·(*global*)······4·(GLIBCXX_3.4)···9·(GLIBCXX_3.4.21)· | 42 | ··09c:···1·(*global*)······1·(*global*)······4·(GLIBCXX_3.4)···9·(GLIBCXX_3.4.21)· |
| 43 | ··0a0:···9·(GLIBCXX_3.4.21)····4·(GLIBCXX_3.4)···4·(GLIBCXX_3.4)···1·(*global*)··· | 43 | ··0a0:···9·(GLIBCXX_3.4.21)····4·(GLIBCXX_3.4)···4·(GLIBCXX_3.4)···1·(*global*)··· |
| 44 | ··0a4:···1·(*global*)······1·(*global*)······3·(GLIBC_2.0)·····1·(*global*)··· | 44 | ··0a4:···1·(*global*)······1·(*global*)······3·(GLIBC_2.0)·····1·(*global*)··· |
| 45 | ··0a8:···4·(GLIBCXX_3.4)···1·(*global*)······1·(*global*)······8·(GLIBC_2.3)·· | 45 | ··0a8:···4·(GLIBCXX_3.4)···1·(*global*)······1·(*global*)······8·(GLIBC_2.3)·· |
| 46 | ··0ac:···9·(GLIBCXX_3.4.21)····6·(GLIBCXX_3.4.15)···1 | 46 | ··0ac:···9·(GLIBCXX_3.4.21)····6·(GLIBCXX_3.4.15)···17·(GLIBC_2.4)·····1·(*global*)··· |
| 47 | ··0b0:··1 | 47 | ··0b0:··18·(GLIBCXX_3.4.11)····3·(GLIBC_2.0)·····3·(GLIBC_2.0)·····4·(GLIBCXX_3.4) |
| 48 | ··0b4:···4·(GLIBCXX_3.4)···1·(*global*)······1·(*global*)······ | 48 | ··0b4:···4·(GLIBCXX_3.4)···1·(*global*)······1·(*global*)······d·(GLIBC_2.3.2) |
| 49 | ··0b8:···9·(GLIBCXX_3.4.21)····4·(GLIBCXX_3.4)···3·(GLIBC_2.0)·····1·(*global*)··· | 49 | ··0b8:···9·(GLIBCXX_3.4.21)····4·(GLIBCXX_3.4)···3·(GLIBC_2.0)·····1·(*global*)··· |
| 50 | ··0bc:···4·(GLIBCXX_3.4)···9·(GLIBCXX_3.4.21)····4·(GLIBCXX_3.4)···4·(GLIBCXX_3.4) | 50 | ··0bc:···4·(GLIBCXX_3.4)···9·(GLIBCXX_3.4.21)····4·(GLIBCXX_3.4)···4·(GLIBCXX_3.4) |
| 51 | ··0c0:···4·(GLIBCXX_3.4)···1·(*global*)······1·(*global*)····· | 51 | ··0c0:···4·(GLIBCXX_3.4)···1·(*global*)······1·(*global*)·····10·(GLIBCXX_3.4.9) |
| 52 | ··0c4:···4·(GLIBCXX_3.4)···1·(*global*)······3·(GLIBC_2.0)·····1·(*global*)··· | 52 | ··0c4:···4·(GLIBCXX_3.4)···1·(*global*)······3·(GLIBC_2.0)·····1·(*global*)··· |
| 53 | ··0c8:···9·(GLIBCXX_3.4.21)····4·(GLIBCXX_3.4)··1 | 53 | ··0c8:···9·(GLIBCXX_3.4.21)····4·(GLIBCXX_3.4)··19·(GLIBCXX_3.4.26)····1·(*global*)··· |
| 54 | ··0cc:···4·(GLIBCXX_3.4)···1·(*global*)······1·(*global*)······ | 54 | ··0cc:···4·(GLIBCXX_3.4)···1·(*global*)······1·(*global*)······e·(GLIBC_2.1)·· |
| 55 | ··0d0:···3·(GLIBC_2.0)·····4·(GLIBCXX_3.4)··· | 55 | ··0d0:···3·(GLIBC_2.0)·····4·(GLIBCXX_3.4)···f·(CXXABI_1.3)····3·(GLIBC_2.0)·· |
| 56 | ··0d4:···9·(GLIBCXX_3.4.21)····4·(GLIBCXX_3.4)···1·(*global*)·····1 | 56 | ··0d4:···9·(GLIBCXX_3.4.21)····4·(GLIBCXX_3.4)···1·(*global*)·····1a·(GLIBCXX_3.4.20)· |
| 57 | ··0d8:···1·(*global*)······4·(GLIBCXX_3.4)··· | 57 | ··0d8:···1·(*global*)······4·(GLIBCXX_3.4)···d·(GLIBC_2.3.2)···3·(GLIBC_2.0)·· |
| 58 | ··0dc:···4·(GLIBCXX_3.4)···9·(GLIBCXX_3.4.21)····3·(GLIBC_2.0)····· | 58 | ··0dc:···4·(GLIBCXX_3.4)···9·(GLIBCXX_3.4.21)····3·(GLIBC_2.0)·····b·(CXXABI_1.3.11) |
| 59 | ··0e0:···1·(*global*)······4·(GLIBCXX_3.4)···4·(GLIBCXX_3.4)···9·(GLIBCXX_3.4.21)· | ||
| 60 | ··0e4:···9·(GLIBCXX_3.4.21)····1·(*global*)······f·(GLIBCXX_3.4.9)···9·(GLIBCXX_3.4.21)· | ||
| 61 | ··0e8:···6·(GLIBCXX_3.4.15)····1·(*global*)······e·(CXXABI_1.3)····3·(GLIBC_2.0)·· | ||
| 62 | ··0ec:···2·(GLIBC_2.3.4)···f·(GLIBCXX_3.4.9)···3·(GLIBC_2.0)·····3·(GLIBC_2.0)·· | ||
| 63 | ··0f0:···e·(CXXABI_1.3)···1a·(GLIBC_2.27)····1·(*global*)·····14·(GLIBC_2.33)· | ||
| 64 | ··0f4:···3·(GLIBC_2.0)·····1·(*global*)······9·(GLIBCXX_3.4.21)····1·(*global*)··· | ||
| 65 | ··0f8:···4·(GLIBCXX_3.4)···9·(GLIBCXX_3.4.21)····1·(*global*)······e·(CXXABI_1.3)· | ||
| 66 | ··0fc:···9·(GLIBCXX_3.4.21)····3·(GLIBC_2.0)·····4·(GLIBCXX_3.4)··1b·(GLIBC_2.29)· | ||
| 67 | ··100:···1·(*global*)·····1c·(GCC_3.0)·······1·(*global*)······4·(GLIBCXX_3.4) | ||
| 68 | ··104:···d·(GLIBC_2.1)·····3·(GLIBC_2.0)·····a·(GLIBC_2.34)····1·(*global*)··· | ||
| 69 | ··108:···1·(*global*)······9·(GLIBCXX_3.4.21)····4·(GLIBCXX_3.4)···1·(*global*)··· | ||
| 70 | ··10c:··1a·(GLIBC_2.27)····1·(*global*)······3·(GLIBC_2.0)·····1·(*global*)··· | ||
| 71 | ··110:···1·(*global*)······1·(*global*)······3·(GLIBC_2.0)·····1·(*global*)··· | ||
| 72 | ·· | 59 | ··0e0:···3·(GLIBC_2.0)·····1·(*global*)······4·(GLIBCXX_3.4)···4·(GLIBCXX_3.4) |
| 73 | ··118:···9·(GLIBCXX_3.4.21)····3·(GLIBC_2.0)·····c·(GLIBC_2.3.2)···4·(GLIBCXX_3.4) | ||
| 74 | ··11c:···4·(GLIBCXX_3.4)···3·(GLIBC_2.0)·····4·(GLIBCXX_3.4)···9·(GLIBCXX_3.4.21)· | ||
| 75 | ·· | 60 | ··0e4:···9·(GLIBCXX_3.4.21)····9·(GLIBCXX_3.4.21)····1·(*global*)·····10·(GLIBCXX_3.4.9) |
| 61 | ··0e8:···9·(GLIBCXX_3.4.21)····6·(GLIBCXX_3.4.15)····1·(*global*)······f·(CXXABI_1.3)· | ||
| 62 | ··0ec:···3·(GLIBC_2.0)·····2·(GLIBC_2.3.4)··10·(GLIBCXX_3.4.9)···3·(GLIBC_2.0)·· | ||
| 63 | ··0f0:···3·(GLIBC_2.0)·····f·(CXXABI_1.3)···1b·(GLIBC_2.27)····1·(*global*)··· | ||
| 64 | ··0f4:··15·(GLIBC_2.33)····3·(GLIBC_2.0)·····1·(*global*)······9·(GLIBCXX_3.4.21)· | ||
| 76 | ·· | 65 | ··0f8:···1·(*global*)······4·(GLIBCXX_3.4)···9·(GLIBCXX_3.4.21)····1·(*global*)··· |
| 66 | ··0fc:···f·(CXXABI_1.3)····9·(GLIBCXX_3.4.21)····3·(GLIBC_2.0)·····4·(GLIBCXX_3.4) | ||
| 67 | ··100:··1c·(GLIBC_2.29)····1·(*global*)·····1d·(GCC_3.0)·······1·(*global*)··· | ||
| 68 | ··104:···4·(GLIBCXX_3.4)···e·(GLIBC_2.1)·····3·(GLIBC_2.0)·····a·(GLIBC_2.34)· | ||
| 69 | ··108:···1·(*global*)······1·(*global*)······9·(GLIBCXX_3.4.21)····4·(GLIBCXX_3.4) | ||
| 70 | ··10c:···1·(*global*)·····1b·(GLIBC_2.27)····1·(*global*)······3·(GLIBC_2.0)·· | ||
| 71 | ··110:···1·(*global*)······1·(*global*)······1·(*global*)······3·(GLIBC_2.0)·· | ||
| 72 | ··114:···1·(*global*)······3·(GLIBC_2.0)·····1·(*global*)······9·(GLIBCXX_3.4.21)· | ||
| 73 | ··118:···9·(GLIBCXX_3.4.21)····9·(GLIBCXX_3.4.21)····3·(GLIBC_2.0)·····d·(GLIBC_2.3.2) | ||
| 74 | ··11c:···4·(GLIBCXX_3.4)···4·(GLIBCXX_3.4)···3·(GLIBC_2.0)·····4·(GLIBCXX_3.4) | ||
| 75 | ··120:···9·(GLIBCXX_3.4.21)····1·(*global*)······9·(GLIBCXX_3.4.21)···10·(GLIBCXX_3.4.9) | ||
| 76 | ··124:···3·(GLIBC_2.0)·····e·(GLIBC_2.1)·····4·(GLIBCXX_3.4)···4·(GLIBCXX_3.4) | ||
| 77 | ··128:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 77 | ··128:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 78 | ··12c:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 78 | ··12c:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 79 | ··130:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 79 | ··130:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 80 | ··134:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 80 | ··134:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 81 | ··138:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 81 | ··138:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 82 | ··13c:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 82 | ··13c:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 83 | ··140:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 83 | ··140:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| Offset 357, 41 lines modified | Offset 357, 48 lines modified | ||
| 357 | ··584:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 357 | ··584:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 358 | ··588:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 358 | ··588:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 359 | ··58c:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 359 | ··58c:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 360 | ··590:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 360 | ··590:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 361 | ··594:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 361 | ··594:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 362 | ··598:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 362 | ··598:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 363 | ··59c:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 363 | ··59c:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 364 | ··5a0:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | ||
| 365 | ··5a4:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | ||
| 366 | ··5a8:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | ||
| 367 | ··5ac:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | ||
| Max diff block lines reached; 3549/16179 bytes (21.94%) of diff not shown. | |||
| Offset 8, 15 lines modified | Offset 8, 15 lines modified | ||
| 8 | ··Data·alignment·factor:·-4 | 8 | ··Data·alignment·factor:·-4 |
| 9 | ··Return·address·column:·8 | 9 | ··Return·address·column:·8 |
| 10 | ··Augmentation·data:·····1b | 10 | ··Augmentation·data:·····1b |
| 11 | ··DW_CFA_def_cfa:·r4·(esp)·ofs·4 | 11 | ··DW_CFA_def_cfa:·r4·(esp)·ofs·4 |
| 12 | ··DW_CFA_offset:·r8·(eip)·at·cfa-4 | 12 | ··DW_CFA_offset:·r8·(eip)·at·cfa-4 |
| 13 | ··DW_CFA_undefined:·r8·(eip) | 13 | ··DW_CFA_undefined:·r8·(eip) |
| 14 | 00000018·00000010·0000001c·FDE·cie=00000000·pc=0002 | 14 | 00000018·00000010·0000001c·FDE·cie=00000000·pc=0002b1b0..0002b1dc |
| 15 | ··DW_CFA_nop | 15 | ··DW_CFA_nop |
| 16 | ··DW_CFA_nop | 16 | ··DW_CFA_nop |
| 17 | ··DW_CFA_nop | 17 | ··DW_CFA_nop |
| 18 | 0000002c·00000014·00000000·CIE | 18 | 0000002c·00000014·00000000·CIE |
| 19 | ··Version:···············1 | 19 | ··Version:···············1 |
| 20 | ··Augmentation:··········"zR" | 20 | ··Augmentation:··········"zR" |
| Offset 25, 77856 lines modified | Offset 25, 79220 lines modified | ||
| 25 | ··Return·address·column:·8 | 25 | ··Return·address·column:·8 |
| 26 | ··Augmentation·data:·····1b | 26 | ··Augmentation·data:·····1b |
| 27 | ··DW_CFA_def_cfa:·r4·(esp)·ofs·4 | 27 | ··DW_CFA_def_cfa:·r4·(esp)·ofs·4 |
| 28 | ··DW_CFA_offset:·r8·(eip)·at·cfa-4 | 28 | ··DW_CFA_offset:·r8·(eip)·at·cfa-4 |
| 29 | ··DW_CFA_nop | 29 | ··DW_CFA_nop |
| 30 | ··DW_CFA_nop | 30 | ··DW_CFA_nop |
| 31 | 00000044·00000020·0000001c·FDE·cie=0000002c·pc=0001e020..0001f0 | 31 | 00000044·00000020·0000001c·FDE·cie=0000002c·pc=0001e020..0001f0a0 |
| 32 | ··DW_CFA_def_cfa_offset:·8 | 32 | ··DW_CFA_def_cfa_offset:·8 |
| 33 | ··DW_CFA_advance_loc:·6·to·0001e026 | 33 | ··DW_CFA_advance_loc:·6·to·0001e026 |
| 34 | ··DW_CFA_def_cfa_offset:·12 | 34 | ··DW_CFA_def_cfa_offset:·12 |
| 35 | ··DW_CFA_advance_loc:·10·to·0001e030 | 35 | ··DW_CFA_advance_loc:·10·to·0001e030 |
| 36 | ··DW_CFA_def_cfa_expression·(DW_OP_breg4·(esp):·4;·DW_OP_breg8·(eip):·0;·DW_OP_lit15;·DW_OP_and;·DW_OP_lit11;·DW_OP_ge;·DW_OP_lit2;·DW_OP_shl;·DW_OP_plus) | 36 | ··DW_CFA_def_cfa_expression·(DW_OP_breg4·(esp):·4;·DW_OP_breg8·(eip):·0;·DW_OP_lit15;·DW_OP_and;·DW_OP_lit11;·DW_OP_ge;·DW_OP_lit2;·DW_OP_shl;·DW_OP_plus) |
| 37 | 00000068·00000010·00000040·FDE·cie=0000002c·pc=0001f0 | 37 | 00000068·00000010·00000040·FDE·cie=0000002c·pc=0001f0a0..0001f0a8 |
| 38 | ··DW_CFA_nop | 38 | ··DW_CFA_nop |
| 39 | ··DW_CFA_nop | 39 | ··DW_CFA_nop |
| 40 | ··DW_CFA_nop | 40 | ··DW_CFA_nop |
| 41 | 0000007c·00000010·00000054·FDE·cie=0000002c·pc=0002d | 41 | 0000007c·00000010·00000054·FDE·cie=0000002c·pc=0002d320..0002d326 |
| 42 | ··DW_CFA_nop | 42 | ··DW_CFA_nop |
| 43 | ··DW_CFA_nop | 43 | ··DW_CFA_nop |
| 44 | ··DW_CFA_nop | 44 | ··DW_CFA_nop |
| 45 | 00000090·0000004c·00000068·FDE·cie=0000002c·pc=0002 | 45 | 00000090·0000004c·00000068·FDE·cie=0000002c·pc=0002b2e0..0002b355 |
| 46 | ··DW_CFA_advance_loc:·1·to·0002 | 46 | ··DW_CFA_advance_loc:·1·to·0002b2e1 |
| 47 | ··DW_CFA_def_cfa_offset:·8 | 47 | ··DW_CFA_def_cfa_offset:·8 |
| 48 | ··DW_CFA_offset:·r7·(edi)·at·cfa-8 | 48 | ··DW_CFA_offset:·r7·(edi)·at·cfa-8 |
| 49 | ··DW_CFA_advance_loc:·1·to·0002 | 49 | ··DW_CFA_advance_loc:·1·to·0002b2e2 |
| 50 | ··DW_CFA_def_cfa_offset:·12 | 50 | ··DW_CFA_def_cfa_offset:·12 |
| 51 | ··DW_CFA_offset:·r6·(esi)·at·cfa-12 | 51 | ··DW_CFA_offset:·r6·(esi)·at·cfa-12 |
| 52 | ··DW_CFA_advance_loc:·3·to·0002 | 52 | ··DW_CFA_advance_loc:·3·to·0002b2e5 |
| 53 | ··DW_CFA_def_cfa_offset:·16 | 53 | ··DW_CFA_def_cfa_offset:·16 |
| 54 | ··DW_CFA_offset:·r3·(ebx)·at·cfa-16 | 54 | ··DW_CFA_offset:·r3·(ebx)·at·cfa-16 |
| 55 | ··DW_CFA_advance_loc:·37·to·0002 | 55 | ··DW_CFA_advance_loc:·37·to·0002b30a |
| 56 | ··DW_CFA_def_cfa_offset:·24 | 56 | ··DW_CFA_def_cfa_offset:·24 |
| 57 | ··DW_CFA_advance_loc:·1·to·0002 | 57 | ··DW_CFA_advance_loc:·1·to·0002b30b |
| 58 | ··DW_CFA_def_cfa_offset:·28 | 58 | ··DW_CFA_def_cfa_offset:·28 |
| 59 | ··DW_CFA_advance_loc:·1·to·0002 | 59 | ··DW_CFA_advance_loc:·1·to·0002b30c |
| 60 | ··DW_CFA_def_cfa_offset:·32 | 60 | ··DW_CFA_def_cfa_offset:·32 |
| 61 | ··DW_CFA_advance_loc:·16·to·0002 | 61 | ··DW_CFA_advance_loc:·16·to·0002b31c |
| 62 | ··DW_CFA_def_cfa_offset:·16 | 62 | ··DW_CFA_def_cfa_offset:·16 |
| 63 | ··DW_CFA_advance_loc:·1·to·0002 | 63 | ··DW_CFA_advance_loc:·1·to·0002b31d |
| 64 | ··DW_CFA_remember_state | 64 | ··DW_CFA_remember_state |
| 65 | ··DW_CFA_restore:·r3·(ebx) | 65 | ··DW_CFA_restore:·r3·(ebx) |
| 66 | ··DW_CFA_def_cfa_offset:·12 | 66 | ··DW_CFA_def_cfa_offset:·12 |
| 67 | ··DW_CFA_advance_loc:·1·to·0002 | 67 | ··DW_CFA_advance_loc:·1·to·0002b31e |
| 68 | ··DW_CFA_restore:·r6·(esi) | 68 | ··DW_CFA_restore:·r6·(esi) |
| 69 | ··DW_CFA_def_cfa_offset:·8 | 69 | ··DW_CFA_def_cfa_offset:·8 |
| 70 | ··DW_CFA_advance_loc:·1·to·0002 | 70 | ··DW_CFA_advance_loc:·1·to·0002b31f |
| 71 | ··DW_CFA_restore:·r7·(edi) | 71 | ··DW_CFA_restore:·r7·(edi) |
| 72 | ··DW_CFA_def_cfa_offset:·4 | 72 | ··DW_CFA_def_cfa_offset:·4 |
| 73 | ··DW_CFA_advance_loc:·1·to·0002 | 73 | ··DW_CFA_advance_loc:·1·to·0002b320 |
| 74 | ··DW_CFA_restore_state | 74 | ··DW_CFA_restore_state |
| 75 | ··DW_CFA_advance_loc:·3·to·0002 | 75 | ··DW_CFA_advance_loc:·3·to·0002b323 |
| 76 | ··DW_CFA_def_cfa_offset:·28 | 76 | ··DW_CFA_def_cfa_offset:·28 |
| 77 | ··DW_CFA_advance_loc:·1·to·0002 | 77 | ··DW_CFA_advance_loc:·1·to·0002b324 |
| 78 | ··DW_CFA_def_cfa_offset:·32 | 78 | ··DW_CFA_def_cfa_offset:·32 |
| 79 | ··DW_CFA_advance_loc:·16·to·0002 | 79 | ··DW_CFA_advance_loc:·16·to·0002b334 |
| 80 | ··DW_CFA_def_cfa_offset:·16 | 80 | ··DW_CFA_def_cfa_offset:·16 |
| 81 | ··DW_CFA_advance_loc:·15·to·0002 | 81 | ··DW_CFA_advance_loc:·15·to·0002b343 |
| 82 | ··DW_CFA_def_cfa_offset:·24 | 82 | ··DW_CFA_def_cfa_offset:·24 |
| 83 | ··DW_CFA_advance_loc:·2·to·0002 | 83 | ··DW_CFA_advance_loc:·2·to·0002b345 |
| 84 | ··DW_CFA_def_cfa_offset:·28 | 84 | ··DW_CFA_def_cfa_offset:·28 |
| 85 | ··DW_CFA_advance_loc:·1·to·0002 | 85 | ··DW_CFA_advance_loc:·1·to·0002b346 |
| 86 | ··DW_CFA_def_cfa_offset:·32 | 86 | ··DW_CFA_def_cfa_offset:·32 |
| 87 | ··DW_CFA_advance_loc:·8·to·0002 | 87 | ··DW_CFA_advance_loc:·8·to·0002b34e |
| 88 | ··DW_CFA_def_cfa_offset:·16 | 88 | ··DW_CFA_def_cfa_offset:·16 |
| 89 | 000000e0·000000a4·000000b8·FDE·cie=0000002c·pc=0002 | 89 | 000000e0·000000a4·000000b8·FDE·cie=0000002c·pc=0002b360..0002b5c3 |
| 90 | ··DW_CFA_advance_loc:·1·to·0002 | 90 | ··DW_CFA_advance_loc:·1·to·0002b361 |
| 91 | ··DW_CFA_def_cfa_offset:·8 | 91 | ··DW_CFA_def_cfa_offset:·8 |
| 92 | ··DW_CFA_offset:·r5·(ebp)·at·cfa-8 | 92 | ··DW_CFA_offset:·r5·(ebp)·at·cfa-8 |
| 93 | ··DW_CFA_advance_loc:·1·to·0002 | 93 | ··DW_CFA_advance_loc:·1·to·0002b362 |
| 94 | ··DW_CFA_def_cfa_offset:·12 | 94 | ··DW_CFA_def_cfa_offset:·12 |
| 95 | ··DW_CFA_offset:·r7·(edi)·at·cfa-12 | 95 | ··DW_CFA_offset:·r7·(edi)·at·cfa-12 |
| 96 | ··DW_CFA_advance_loc:·3·to·0002 | 96 | ··DW_CFA_advance_loc:·3·to·0002b365 |
| 97 | ··DW_CFA_def_cfa_offset:·16 | 97 | ··DW_CFA_def_cfa_offset:·16 |
| 98 | ··DW_CFA_offset:·r6·(esi)·at·cfa-16 | 98 | ··DW_CFA_offset:·r6·(esi)·at·cfa-16 |
| 99 | ··DW_CFA_advance_loc:·3·to·0002 | 99 | ··DW_CFA_advance_loc:·3·to·0002b368 |
| 100 | ··DW_CFA_def_cfa_offset:·20 | 100 | ··DW_CFA_def_cfa_offset:·20 |
| 101 | ··DW_CFA_offset:·r3·(ebx)·at·cfa-20 | 101 | ··DW_CFA_offset:·r3·(ebx)·at·cfa-20 |
| 102 | ··DW_CFA_advance_loc:·14·to·0002 | 102 | ··DW_CFA_advance_loc:·14·to·0002b376 |
| 103 | ··DW_CFA_def_cfa_offset:·48 | 103 | ··DW_CFA_def_cfa_offset:·48 |
| 104 | ··DW_CFA_advance_loc:·28·to·0002 | 104 | ··DW_CFA_advance_loc:·28·to·0002b392 |
| 105 | ··DW_CFA_remember_state | 105 | ··DW_CFA_remember_state |
| 106 | ··DW_CFA_def_cfa_offset:·20 | 106 | ··DW_CFA_def_cfa_offset:·20 |
| 107 | ··DW_CFA_advance_loc:·1·to·0002 | 107 | ··DW_CFA_advance_loc:·1·to·0002b393 |
| 108 | ··DW_CFA_restore:·r3·(ebx) | 108 | ··DW_CFA_restore:·r3·(ebx) |
| 109 | ··DW_CFA_def_cfa_offset:·16 | 109 | ··DW_CFA_def_cfa_offset:·16 |
| 110 | ··DW_CFA_advance_loc:·1·to·0002 | 110 | ··DW_CFA_advance_loc:·1·to·0002b394 |
| 111 | ··DW_CFA_restore:·r6·(esi) | 111 | ··DW_CFA_restore:·r6·(esi) |
| 112 | ··DW_CFA_def_cfa_offset:·12 | 112 | ··DW_CFA_def_cfa_offset:·12 |
| 113 | ··DW_CFA_advance_loc:·1·to·0002 | 113 | ··DW_CFA_advance_loc:·1·to·0002b395 |
| 114 | ··DW_CFA_restore:·r7·(edi) | 114 | ··DW_CFA_restore:·r7·(edi) |
| 115 | ··DW_CFA_def_cfa_offset:·8 | 115 | ··DW_CFA_def_cfa_offset:·8 |
| 116 | ··DW_CFA_advance_loc:·1·to·0002 | 116 | ··DW_CFA_advance_loc:·1·to·0002b396 |
| 117 | ··DW_CFA_restore:·r5·(ebp) | 117 | ··DW_CFA_restore:·r5·(ebp) |
| 118 | ··DW_CFA_def_cfa_offset:·4 | 118 | ··DW_CFA_def_cfa_offset:·4 |
| 119 | ··DW_CFA_advance_loc:·10·to·0002 | 119 | ··DW_CFA_advance_loc:·10·to·0002b3a0 |
| 120 | ··DW_CFA_restore_state | 120 | ··DW_CFA_restore_state |
| 121 | ··DW_CFA_advance_loc1:·87·to·0002b | 121 | ··DW_CFA_advance_loc1:·87·to·0002b3f7 |
| 122 | ··DW_CFA_def_cfa_offset:·60 | 122 | ··DW_CFA_def_cfa_offset:·60 |
| 123 | ··DW_CFA_advance_loc:·5·to·0002b | 123 | ··DW_CFA_advance_loc:·5·to·0002b3fc |
| 124 | ··DW_CFA_def_cfa_offset:·64 | 124 | ··DW_CFA_def_cfa_offset:·64 |
| 125 | ··DW_CFA_advance_loc:·11·to·0002b | 125 | ··DW_CFA_advance_loc:·11·to·0002b407 |
| 126 | ··DW_CFA_def_cfa_offset:·48 | 126 | ··DW_CFA_def_cfa_offset:·48 |
| 127 | ··DW_CFA_advance_loc:· | 127 | ··DW_CFA_advance_loc:·49·to·0002b438 |
| 128 | ··DW_CFA_remember_state | 128 | ··DW_CFA_remember_state |
| 129 | ··DW_CFA_def_cfa_offset:·20 | 129 | ··DW_CFA_def_cfa_offset:·20 |
| 130 | ··DW_CFA_advance_loc:·1·to·0002b | 130 | ··DW_CFA_advance_loc:·1·to·0002b439 |
| Max diff block lines reached; 3895611/3901354 bytes (99.85%) of diff not shown. | |||
| Offset 1, 9 lines modified | Offset 1, 8 lines modified | ||
| 1 | /lib/ld-linux.so.2 | 1 | /lib/ld-linux.so.2 |
| 2 | » "&%C·Q+ | ||
| 3 | deflateInit2_ | 2 | deflateInit2_ |
| 4 | deflateEnd | 3 | deflateEnd |
| 5 | inflateInit2_ | 4 | inflateInit2_ |
| 6 | inflateEnd | 5 | inflateEnd |
| 7 | _ITM_deregisterTMCloneTable | 6 | _ITM_deregisterTMCloneTable |
| 8 | __gmon_start__ | 7 | __gmon_start__ |
| 9 | _ITM_registerTMCloneTable | 8 | _ITM_registerTMCloneTable |
| Offset 186, 14 lines modified | Offset 185, 15 lines modified | ||
| 186 | _ZSt28_Rb_tree_rebalance_for_erasePSt18_Rb_tree_node_baseRS_ | 185 | _ZSt28_Rb_tree_rebalance_for_erasePSt18_Rb_tree_node_baseRS_ |
| 187 | __cxa_begin_catch | 186 | __cxa_begin_catch |
| 188 | _ZSt4endlIcSt11char_traitsIcEERSt13basic_ostreamIT_T0_ES6_ | 187 | _ZSt4endlIcSt11char_traitsIcEERSt13basic_ostreamIT_T0_ES6_ |
| 189 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE9_M_mutateEjjPKcj | 188 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE9_M_mutateEjjPKcj |
| 190 | _ZNSt7__cxx1119basic_ostringstreamIcSt11char_traitsIcESaIcEED1Ev | 189 | _ZNSt7__cxx1119basic_ostringstreamIcSt11char_traitsIcESaIcEED1Ev |
| 191 | _ZSt7getlineIcSt11char_traitsIcESaIcEERSt13basic_istreamIT_T0_ES7_RNSt7__cxx1112basic_stringIS4_S5_T1_EES4_ | 190 | _ZSt7getlineIcSt11char_traitsIcESaIcEERSt13basic_istreamIT_T0_ES7_RNSt7__cxx1112basic_stringIS4_S5_T1_EES4_ |
| 192 | _ZSt29_Rb_tree_insert_and_rebalancebPSt18_Rb_tree_node_baseS0_RS_ | 191 | _ZSt29_Rb_tree_insert_and_rebalancebPSt18_Rb_tree_node_baseS0_RS_ |
| 192 | _ZnwjSt11align_val_t | ||
| 193 | _ZNSt8__detail15_List_node_base9_M_unhookEv | 193 | _ZNSt8__detail15_List_node_base9_M_unhookEv |
| 194 | _ZNSo9_M_insertImEERSoT_ | 194 | _ZNSo9_M_insertImEERSoT_ |
| 195 | _ZNSt13basic_filebufIcSt11char_traitsIcEED1Ev | 195 | _ZNSt13basic_filebufIcSt11char_traitsIcEED1Ev |
| 196 | _ZNSt11logic_errorC1ERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE | 196 | _ZNSt11logic_errorC1ERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE |
| 197 | _ZSt20__throw_length_errorPKc | 197 | _ZSt20__throw_length_errorPKc |
| 198 | _ZSt20__throw_out_of_rangePKc | 198 | _ZSt20__throw_out_of_rangePKc |
| 199 | __cxa_rethrow | 199 | __cxa_rethrow |
| Offset 213, 15 lines modified | Offset 213, 14 lines modified | ||
| 213 | _ZNSt8ios_baseC2Ev | 213 | _ZNSt8ios_baseC2Ev |
| 214 | _ZNSo9_M_insertIlEERSoT_ | 214 | _ZNSo9_M_insertIlEERSoT_ |
| 215 | _ZSt17__throw_bad_allocv | 215 | _ZSt17__throw_bad_allocv |
| 216 | _ZTTSt14basic_ifstreamIcSt11char_traitsIcEE | 216 | _ZTTSt14basic_ifstreamIcSt11char_traitsIcEE |
| 217 | _ZTTSt14basic_ofstreamIcSt11char_traitsIcEE | 217 | _ZTTSt14basic_ofstreamIcSt11char_traitsIcEE |
| 218 | _ZNSt7__cxx1119basic_ostringstreamIcSt11char_traitsIcESaIcEEC1Ev | 218 | _ZNSt7__cxx1119basic_ostringstreamIcSt11char_traitsIcESaIcEEC1Ev |
| 219 | _ZSt24__throw_out_of_range_fmtPKcz | 219 | _ZSt24__throw_out_of_range_fmtPKcz |
| 220 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE6insertEjPKc | ||
| 221 | _ZSt4cerr | 220 | _ZSt4cerr |
| 222 | _ZNSt13basic_filebufIcSt11char_traitsIcEEC1Ev | 221 | _ZNSt13basic_filebufIcSt11char_traitsIcEEC1Ev |
| 223 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE14_M_replace_auxEjjjc | 222 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE14_M_replace_auxEjjjc |
| 224 | __gxx_personality_v0 | 223 | __gxx_personality_v0 |
| 225 | _ZNSo3putEc | 224 | _ZNSo3putEc |
| 226 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE9_M_createERjj | 225 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE9_M_createERjj |
| 227 | _ZNSt8__detail15_List_node_base7_M_hookEPS0_ | 226 | _ZNSt8__detail15_List_node_base7_M_hookEPS0_ |
| Offset 232, 14 lines modified | Offset 231, 15 lines modified | ||
| 232 | _ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE4findEcj | 231 | _ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE4findEcj |
| 233 | _ZNSt9bad_allocD1Ev | 232 | _ZNSt9bad_allocD1Ev |
| 234 | _ZNSi10_M_extractIfEERSiRT_ | 233 | _ZNSi10_M_extractIfEERSiRT_ |
| 235 | _ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE7compareEjjRKS4_jj | 234 | _ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE7compareEjjRKS4_jj |
| 236 | __cxa_allocate_exception | 235 | __cxa_allocate_exception |
| 237 | _ZStlsISt11char_traitsIcEERSt13basic_ostreamIcT_ES5_c | 236 | _ZStlsISt11char_traitsIcEERSt13basic_ostreamIcT_ES5_c |
| 238 | _ZTVNSt7__cxx1118basic_stringstreamIcSt11char_traitsIcESaIcEEE | 237 | _ZTVNSt7__cxx1118basic_stringstreamIcSt11char_traitsIcESaIcEEE |
| 238 | _ZdlPvjSt11align_val_t | ||
| 239 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEC1EOS4_ | 239 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEC1EOS4_ |
| 240 | _ZTVNSt7__cxx1115basic_stringbufIcSt11char_traitsIcESaIcEEE | 240 | _ZTVNSt7__cxx1115basic_stringbufIcSt11char_traitsIcESaIcEEE |
| 241 | _ZNSt8__detail15_List_node_base10_M_reverseEv | 241 | _ZNSt8__detail15_List_node_base10_M_reverseEv |
| 242 | _ZNSirsERi | 242 | _ZNSirsERi |
| 243 | _ZTISt11logic_error | 243 | _ZTISt11logic_error |
| 244 | _ZStrsIcSt11char_traitsIcESaIcEERSt13basic_istreamIT_T0_ES7_RNSt7__cxx1112basic_stringIS4_S5_T1_EE | 244 | _ZStrsIcSt11char_traitsIcESaIcEERSt13basic_istreamIT_T0_ES7_RNSt7__cxx1112basic_stringIS4_S5_T1_EE |
| 245 | _ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE5rfindEPKcjj | 245 | _ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE5rfindEPKcjj |
| Offset 309, 30 lines modified | Offset 309, 33 lines modified | ||
| 309 | _Z13GetPrefixFlowP9AlignmentRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERKN3ion9FlowOrderE | 309 | _Z13GetPrefixFlowP9AlignmentRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERKN3ion9FlowOrderE |
| 310 | _ZN22LinearCalibrationModelC2Ev | 310 | _ZN22LinearCalibrationModelC2Ev |
| 311 | _ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_bESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE24_M_get_insert_unique_posERS7_ | 311 | _ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_bESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE24_M_get_insert_unique_posERS7_ |
| 312 | _ZN12DPTreephaserC2ERKN3ion9FlowOrderEi | 312 | _ZN12DPTreephaserC2ERKN3ion9FlowOrderEi |
| 313 | _Z24DiagnosticJsonCrossStackRN4Json5ValueERK15HypothesisStack | 313 | _Z24DiagnosticJsonCrossStackRN4Json5ValueERK15HypothesisStack |
| 314 | _ZN9MultiBook42AssignPositionFromEndToHardClassifiedReadsERSt6vectorIiSaIiEES3_S3_ | 314 | _ZN9MultiBook42AssignPositionFromEndToHardClassifiedReadsERSt6vectorIiSaIiEES3_S3_ |
| 315 | _ZN15CrossHypotheses13CleanAllocateEii | 315 | _ZN15CrossHypotheses13CleanAllocateEii |
| 316 | _ZN13TreephaserSSEC1Ev | ||
| 316 | ion_xy_to_readname | 317 | ion_xy_to_readname |
| 317 | _ZN18PosteriorInferenceD2Ev | 318 | _ZN18PosteriorInferenceD2Ev |
| 319 | _ZN13TreephaserSSE13advanceState4EP7PathReci | ||
| 318 | _ZN19BasicSigmaGenerator11ResetUpdateEv | 320 | _ZN19BasicSigmaGenerator11ResetUpdateEv |
| 319 | _ZN12AlleleParserD2Ev | 321 | _ZN12AlleleParserD2Ev |
| 320 | _ZNSt6vectorIbSaIbEEC2ERKS1_ | 322 | _ZNSt6vectorIbSaIbEEC2ERKS1_ |
| 321 | _ZN22StrandedSigmaGenerator20UpdateSigmaEstimatesER10ShortStack | 323 | _ZN22StrandedSigmaGenerator20UpdateSigmaEstimatesER10ShortStack |
| 322 | _ZN16DecisionTreeData20SetupFromMultiAlleleERK12EnsembleEval | 324 | _ZN16DecisionTreeData20SetupFromMultiAlleleERK12EnsembleEval |
| 323 | _ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_S6_IiiEESt10_Select1stIS9_ESt4lessIS5_ESaIS9_EE16_M_emplace_equalIJS6_IS5_S8_EEEESt17_Rb_tree_iteratorIS9_EDpOT_ | 325 | _ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_S6_IiiEESt10_Select1stIS9_ESt4lessIS5_ESaIS9_EE16_M_emplace_equalIJS6_IS5_S8_EEEESt17_Rb_tree_iteratorIS9_EDpOT_ |
| 324 | _ZN18PosteriorInference19StartAtHardClassifyER10ShortStackbRKSt6vectorIfSaIfEE | 326 | _ZN18PosteriorInference19StartAtHardClassifyER10ShortStackbRKSt6vectorIfSaIfEE |
| 325 | _ZN7OptArgs20StringToDoubleVectorERSt6vectorIdSaIdEERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESB_c | 327 | _ZN7OptArgs20StringToDoubleVectorERSt6vectorIdSaIdEERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESB_c |
| 326 | _ZNSt5dequeIN3vcf9RuleTokenESaIS1_EE4backEv | 328 | _ZNSt5dequeIN3vcf9RuleTokenESaIS1_EE4backEv |
| 327 | _ZN10FreqMasterC2Ev | 329 | _ZN10FreqMasterC2Ev |
| 328 | _ZN3vcf13VariantFilterC1ENSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEENS0_17VariantFilterTypeERSt3mapIS6_NS_16VariantFieldTypeESt4lessIS6_ESaISt4pairIKS6_S9_EEE | 330 | _ZN3vcf13VariantFilterC1ENSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEENS0_17VariantFilterTypeERSt3mapIS6_NS_16VariantFieldTypeESt4lessIS6_ESaISt4pairIKS6_S9_EEE |
| 329 | _ZNSt6vectorIlSaIlEE17_M_realloc_insertIJRKlEEEvN9__gnu_cxx17__normal_iteratorIPlS1_EEDpOT_ | 331 | _ZNSt6vectorIlSaIlEE17_M_realloc_insertIJRKlEEEvN9__gnu_cxx17__normal_iteratorIPlS1_EEDpOT_ |
| 330 | _ZN12EnsembleEval17StackUpOneVariantERK16ExtendParametersRK18PositionInProgress | 332 | _ZN12EnsembleEval17StackUpOneVariantERK16ExtendParametersRK18PositionInProgress |
| 331 | _ZSt13__adjust_heapISt15_Deque_iteratorIP9AlignmentRS2_PS2_EiS2_N9__gnu_cxx5__ops15_Iter_comp_iterI19AlignmentComporatorEEEvT_T0_SC_T1_T2_ | 333 | _ZSt13__adjust_heapISt15_Deque_iteratorIP9AlignmentRS2_PS2_EiS2_N9__gnu_cxx5__ops15_Iter_comp_iterI19AlignmentComporatorEEEvT_T0_SC_T1_T2_ |
| 334 | _ZN13TreephaserSSE19InitializeVariablesEf | ||
| 332 | _ZN3vcf5isHomERSt3mapIiiSt4lessIiESaISt4pairIKiiEEE | 335 | _ZN3vcf5isHomERSt3mapIiiSt4lessIiESaISt4pairIKiiEEE |
| 333 | _ZNSt6vectorIS_I13AlignmentCellSaIS0_EESaIS2_EED1Ev | 336 | _ZNSt6vectorIS_I13AlignmentCellSaIS0_EESaIS2_EED1Ev |
| 334 | _ZN15BAMWalkerEngine20ReadyForNextPositionEv | 337 | _ZN15BAMWalkerEngine20ReadyForNextPositionEv |
| 335 | _ZNSt6vectorIN12DPTreephaser14TreephaserPathESaIS1_EED2Ev | 338 | _ZNSt6vectorIN12DPTreephaser14TreephaserPathESaIS1_EED2Ev |
| 336 | ti_close | 339 | ti_close |
| 337 | _ZN12EnsembleEval22ScanSupportingEvidenceERfi | 340 | _ZN12EnsembleEval22ScanSupportingEvidenceERfi |
| 338 | _Z11FibIntervalRSt6vectorIjSaIjEEii | 341 | _Z11FibIntervalRSt6vectorIjSaIjEEii |
| Offset 439, 14 lines modified | Offset 442, 15 lines modified | ||
| 439 | _ZN9MultiBook19GetPositionBiasPvalEi | 442 | _ZN9MultiBook19GetPositionBiasPvalEi |
| 440 | _ZN19BasicSigmaGenerator14DoLatentUpdateEv | 443 | _ZN19BasicSigmaGenerator14DoLatentUpdateEv |
| 441 | _Z29DiagnosticJsonCrossHypothesesRN4Json5ValueERK15CrossHypotheses | 444 | _Z29DiagnosticJsonCrossHypothesesRN4Json5ValueERK15CrossHypotheses |
| 442 | _Z7dateStrB5cxx11v | 445 | _Z7dateStrB5cxx11v |
| 443 | _ZN10IonVersion10GetVersionB5cxx11Ev | 446 | _ZN10IonVersion10GetVersionB5cxx11Ev |
| 444 | _ZN9MultiBook12ResetCounterEv | 447 | _ZN9MultiBook12ResetCounterEv |
| 445 | _ZN15InputStructuresD2Ev | 448 | _ZN15InputStructuresD2Ev |
| 449 | _ZN13TreephaserSSE16ComputeQVmetricsER14BasecallerRead | ||
| 446 | _ZN22StrandedSigmaGenerator19ResetSigmaGeneratorEv | 450 | _ZN22StrandedSigmaGenerator19ResetSigmaGeneratorEv |
| 447 | _ZN13VariantAssist12MannWhitneyUERSt6vectorIfSaIfEES3_b | 451 | _ZN13VariantAssist12MannWhitneyUERSt6vectorIfSaIfEES3_b |
| 448 | _ZN3vcf10mergeCigarERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES7_ | 452 | _ZN3vcf10mergeCigarERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES7_ |
| 449 | _ZN3vcf15VariantCallFile11parseHeaderEv | 453 | _ZN3vcf15VariantCallFile11parseHeaderEv |
| 450 | _ZN16DecisionTreeDataD1Ev | 454 | _ZN16DecisionTreeDataD1Ev |
| 451 | _Z13reverseStringRNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE | 455 | _Z13reverseStringRNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE |
| 452 | _ZN11BiasChecker14AddCrossUpdateER15CrossHypotheses | 456 | _ZN11BiasChecker14AddCrossUpdateER15CrossHypotheses |
| Offset 461, 14 lines modified | Offset 465, 15 lines modified | ||
| 461 | _ZN11BiasChecker8DoUpdateEv | 465 | _ZN11BiasChecker8DoUpdateEv |
| 462 | _Z21DiagnosticJsonHistoryRN4Json5ValueERK15HypothesisStack | 466 | _Z21DiagnosticJsonHistoryRN4Json5ValueERK15HypothesisStack |
| 463 | _ZN16DecisionTreeData25AccumulateFilteredAllelesEv | 467 | _ZN16DecisionTreeData25AccumulateFilteredAllelesEv |
| 464 | _ZN15HypothesisStack16ExecuteInferenceEi | 468 | _ZN15HypothesisStack16ExecuteInferenceEi |
| 465 | _ZN9ScanSpace24DoPosteriorFrequencyScanER10ShortStackR10FreqMasterbibi | 469 | _ZN9ScanSpace24DoPosteriorFrequencyScanER10ShortStackR10FreqMasterbibi |
| 466 | _Z21compare_best_responseSt4pairIifES0_ | 470 | _Z21compare_best_responseSt4pairIifES0_ |
| 467 | _ZN15InputStructuresC2Ev | 471 | _ZN15InputStructuresC2Ev |
| 472 | _ZN23PersistingThreadObjectsD2Ev | ||
| 468 | ion_id_to_xy | 473 | ion_id_to_xy |
| 469 | ti_lazy_index_load | 474 | ti_lazy_index_load |
| 470 | _ZN9ScanSpaceC1Ev | 475 | _ZN9ScanSpaceC1Ev |
| 471 | _ZNSt6vectorIjSaIjEE17_M_realloc_insertIJjEEEvN9__gnu_cxx17__normal_iteratorIPjS1_EEDpOT_ | 476 | _ZNSt6vectorIjSaIjEE17_M_realloc_insertIJjEEEvN9__gnu_cxx17__normal_iteratorIPjS1_EEDpOT_ |
| 472 | _ZN9Realigner18backtrackAlignmentEjjRSt6vectorIN8BamTools7CigarOpESaIS2_EERS0_I9MDelementSaIS6_EERj | 477 | _ZN9Realigner18backtrackAlignmentEjjRSt6vectorIN8BamTools7CigarOpESaIS2_EERS0_I9MDelementSaIS6_EERj |
| 473 | _bgzf_read | 478 | _bgzf_read |
| 474 | _ZN11OptArgumentC1Ev | 479 | _ZN11OptArgumentC1Ev |
| Offset 588, 14 lines modified | Offset 593, 15 lines modified | ||
| 588 | ks_heapmake_offt | 593 | ks_heapmake_offt |
| 589 | _bgzf_read_block | 594 | _bgzf_read_block |
| 590 | _ZN16ExtendParameters27ValidateAndCanonicalizePathERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE | 595 | _ZN16ExtendParameters27ValidateAndCanonicalizePathERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE |
| Max diff block lines reached; 25646/31719 bytes (80.85%) of diff not shown. | |||
| Offset 1, 612 lines modified | Offset 1, 617 lines modified | ||
| 1 | Hex·dump·of·section·'.gnu.hash': | 1 | Hex·dump·of·section·'.gnu.hash': |
| 2 | ··0x000001ec·07040000·2 | 2 | ··0x000001ec·07040000·28010000·00010000·0d000000·....(........... |
| 3 | ··0x000001fc·a8a40a84·104a4001·800010b0·00420006·.....J@......B.. | 3 | ··0x000001fc·a8a40a84·104a4001·800010b0·00420006·.....J@......B.. |
| 4 | ··0x0000020c·08400000·102190d4·05482018·9490 | 4 | ··0x0000020c·08400000·102190d4·05482018·94903000·.@...!...H·...0. |
| 5 | ··0x0000021c·0d | 5 | ··0x0000021c·0dc062a8·3002041e·90dc0c10·30901940·..b.0.......0..@ |
| 6 | ··0x0000022c·12454042·210240ee·44a25010·00a80024·.E@B!.@.D.P....$ | 6 | ··0x0000022c·12454042·210240ee·44a25010·00a80024·.E@B!.@.D.P....$ |
| 7 | ··0x0000023c·4010b013· | 7 | ··0x0000023c·4010b013·a35c4c69·84040242·845eae4a·@....\Li...B.^.J |
| 8 | ··0x0000024c·00e84483·10009809·84018a32·325014c4·..D........22P.. | 8 | ··0x0000024c·00e84483·10009809·84018a32·325014c4·..D........22P.. |
| 9 | ··0x0000025c·004c0402·831f4141·22000000·0524b8a2·.L....AA"....$.. | 9 | ··0x0000025c·004c0402·831f4141·22000000·0524b8a2·.L....AA"....$.. |
| 10 | ··0x0000026c· | 10 | ··0x0000026c·b00c364c·2c09f088·bd0a1600·5c00c401·..6L,.......\... |
| 11 | ··0x0000027c·040a2030·04083402·29209081·22028425·..·0..4.)·.."..% | 11 | ··0x0000027c·040a2030·04083402·29209081·22028425·..·0..4.)·.."..% |
| 12 | ··0x0000028c·8469c001·c0060150·0c808801·60400a08·.i.....P....`@.. | 12 | ··0x0000028c·8469c001·c0060150·0c808801·60400a08·.i.....P....`@.. |
| 13 | ··0x0000029c·0b48 | 13 | ··0x0000029c·0b48c220·10454001·08c51060·1009840e·.H.·.E@....`.... |
| 14 | ··0x000002ac·00000000·104823b3·10188422·020005c0·.....H#....".... | 14 | ··0x000002ac·00000000·104823b3·10188422·020005c0·.....H#....".... |
| 15 | ··0x000002bc·cc980063·04d40824·00102194·34504990·...c...$..!.4PI. | 15 | ··0x000002bc·cc980063·04d40824·00102194·34504990·...c...$..!.4PI. |
| 16 | ··0x000002cc·00380040·00020812·020e0414·02941420·.8.@...........· | 16 | ··0x000002cc·00380040·00020812·020e0414·02941420·.8.@...........· |
| 17 | ··0x000002dc·40041383·afc10aa0·6801a040·01093000·@.......h..@..0. | 17 | ··0x000002dc·40041383·afc10aa0·6801a040·01093000·@.......h..@..0. |
| 18 | ··0x000002ec·182a0083·80802440·80009241·5c010208·.*....$@...A\... | 18 | ··0x000002ec·182a0083·80802440·80009241·5c010208·.*....$@...A\... |
| 19 | ··0x000002fc·00270608·8c00270a·44880021·4f2010ce·.'....'.D..!O·.. | 19 | ··0x000002fc·00270608·8c00270a·44880021·4f2010ce·.'....'.D..!O·.. |
| 20 | ··0x0000030c·85002003·08800429·19200313·01182286·..·....).·....". | 20 | ··0x0000030c·85002003·08800429·19200313·01182286·..·....).·....". |
| 21 | ··0x0000031c·40000 | 21 | ··0x0000031c·40000840·1c542406·00538020·00048001·@..@.T$..S.·.... |
| 22 | ··0x0000032c·00800040·50201000·20002005·01408223·...@P·..·.·..@.# | 22 | ··0x0000032c·00800040·50201000·20002005·01408223·...@P·..·.·..@.# |
| 23 | ··0x0000033c·28105842·42734a10·48044400·00000814·(.XBBsJ.H.D..... | 23 | ··0x0000033c·28105842·42734a10·48044400·00000814·(.XBBsJ.H.D..... |
| 24 | ··0x0000034c·0c20e890·18082220·19d24002·90088c44·.·...."·..@....D | 24 | ··0x0000034c·0c20e890·18082220·19d24002·90088c44·.·...."·..@....D |
| 25 | ··0x0000035c·805844a0·040 | 25 | ··0x0000035c·805844a0·04082206·25432051·2b063448·.XD...".%C·Q+.4H |
| 26 | ··0x0000036c·16120905·0aa0d204·40201121·4d080800·........@·.!M... | 26 | ··0x0000036c·16120905·0aa0d204·40201121·4d080800·........@·.!M... |
| 27 | ··0x0000037c· | 27 | ··0x0000037c·60010002·a0223164·04224a00·05000078·`...."1d."J....x |
| 28 | ··0x0000038c·8e500186·d8e496a8·84a00128·32c20c40·.P.........(2..@ | 28 | ··0x0000038c·8e500186·d8e496a8·84a00128·32c20c40·.P.........(2..@ |
| 29 | ··0x0000039c·1300e530·22e9c011·1044fc40·04 | 29 | ··0x0000039c·1300e530·22e9c011·1044fc40·0410570a·...0"....D.@..W. |
| 30 | ··0x000003ac·80a00010·e44a0240·01a060c0·00008128·.....J.@..`....( | 30 | ··0x000003ac·80a00010·e44a0240·01a060c0·00008128·.....J.@..`....( |
| 31 | ··0x000003bc·400a1618·c0009128·044a00e0·204c3ac9·@......(.J..·L:. | 31 | ··0x000003bc·400a1618·c0009128·044a00e0·204c3ac9·@......(.J..·L:. |
| 32 | ··0x000003cc·0224b4ee·0210a9f4·c20c2703·04940202·.$........'..... | 32 | ··0x000003cc·0224b4ee·0210a9f4·c20c2703·04940202·.$........'..... |
| 33 | ··0x000003dc·5c186139·00011928·0aae02a2·061 | 33 | ··0x000003dc·5c186139·00011928·0aae02a2·06104a48·\.a9...(......JH |
| 34 | ··0x000003ec· | 34 | ··0x000003ec·111100a2·00900000·2c804910·040001b4·........,.I..... |
| 35 | ··0x000003fc·45062005·0000d266·80812b45·d4 | 35 | ··0x000003fc·45062005·0000d266·80812b45·d4206944·E.·....f..+E.·iD |
| 36 | ··0x0000040c·0554b209·ac02800c·0410189a·22562105·.T.........."V!. | 36 | ··0x0000040c·0554b209·ac02800c·0410189a·22562105·.T.........."V!. |
| 37 | ··0x0000041c·09a06d42·008508d0·04a2a240·37 | 37 | ··0x0000041c·09a06d42·008508d0·04a2a240·37d2900c·..mB.......@7... |
| 38 | ··0x0000042c·58c00006·00009410·8a080005·12811008·X............... | 38 | ··0x0000042c·58c00006·00009410·8a080005·12811008·X............... |
| 39 | ··0x0000043c·08088400·20084880·00807000·80200000·....·.H...p..·.. | 39 | ··0x0000043c·08088400·20084880·00807000·80200000·....·.H...p..·.. |
| 40 | ··0x0000044c·0080ee62·8584c059·084a9c02·04816448·...b...Y.J....dH | 40 | ··0x0000044c·0080ee62·8584c059·084a9c02·04816448·...b...Y.J....dH |
| 41 | ··0x0000045c·8eb10801·68201510·e109a012·01404140·....h·.......@A@ | 41 | ··0x0000045c·8eb10801·68201510·e109a012·01404140·....h·.......@A@ |
| 42 | ··0x0000046c·240010c0·4f581b37·18802820·59e00800·$...OX.7..(·Y... | 42 | ··0x0000046c·240010c0·4f581b37·18802820·59e00800·$...OX.7..(·Y... |
| 43 | ··0x0000047c·00000120·2812160c·17042100·6c114009·...·(.....!.l.@. | 43 | ··0x0000047c·00000120·2812160c·17042100·6c114009·...·(.....!.l.@. |
| 44 | ··0x0000048c·038 | 44 | ··0x0000048c·038e1112·c44009a2·5c100203·c201ab8a·.....@..\....... |
| 45 | ··0x0000049c·a0acc670·00480011·00880600·0d | 45 | ··0x0000049c·a0acc670·00480011·00880600·0d380004·...p.H.......8.. |
| 46 | ··0x000004ac·020007c0·0051300c·80990391·2a048644·.....Q0.....*..D | 46 | ··0x000004ac·020007c0·0051300c·80990391·2a048644·.....Q0.....*..D |
| 47 | ··0x000004bc·51196280·c0480294·c1714c65·00008008·Q.b..H...qLe.... | 47 | ··0x000004bc·51196280·c0480294·c1714c65·00008008·Q.b..H...qLe.... |
| 48 | ··0x000004cc·c42c3529· | 48 | ··0x000004cc·c42c3529·24006040·014a4000·09800029·.,5)$.`@.J@....) |
| 49 | ··0x000004dc·00110000·00022048· | 49 | ··0x000004dc·00110000·00022048·9032a092·4008ac00·......·H.2..@... |
| 50 | ··0x000004ec·00890344·08401021·6f3624a2·00204900·...D.@.!o6$..·I. | 50 | ··0x000004ec·00890344·08401021·6f3624a2·00204900·...D.@.!o6$..·I. |
| 51 | ··0x000004fc·14824840·00403800·56106010·00080400·..H@.@8.V.`..... | 51 | ··0x000004fc·14824840·00403800·56106010·00080400·..H@.@8.V.`..... |
| 52 | ··0x0000050c·0c080980·1c011019·431000a0·4400e052·........C...D..R | 52 | ··0x0000050c·0c080980·1c011019·431000a0·4400e052·........C...D..R |
| 53 | ··0x0000051c·2044b039·00040013·cc568d84·242dcce0··D.9.....V..$-.. | 53 | ··0x0000051c·2044b039·00040013·cc568d84·242dcce0··D.9.....V..$-.. |
| 54 | ··0x0000052c·04000001·03080084·00601401·13240818·.........`...$.. | 54 | ··0x0000052c·04000001·03080084·00601401·13240818·.........`...$.. |
| 55 | ··0x0000053c·409a08e2·08411186·a1012113·022082a0·@....A....!..·.. | 55 | ··0x0000053c·409a08e2·08411186·a1012113·022082a0·@....A....!..·.. |
| 56 | ··0x0000054c·82208c00·44f8801b·04025100·4 | 56 | ··0x0000054c·82208c00·44f8801b·04025100·41dc01a4·.·..D.....Q.A... |
| 57 | ··0x0000055c·4ccf07e1·41a02002·80044517·29a01a10·L...A.·...E.)... | 57 | ··0x0000055c·4ccf07e1·41a02002·80044517·29a01a10·L...A.·...E.)... |
| 58 | ··0x0000056c·01080000·00211406·0ab | 58 | ··0x0000056c·01080000·00211406·0ab16180·c02c0c22·.....!....a..,." |
| 59 | ··0x0000057c·80000002·802171c8·08841010·cc56001a·.....!q......V.. | 59 | ··0x0000057c·80000002·802171c8·08841010·cc56001a·.....!q......V.. |
| 60 | ··0x0000058c·ec480014·0a7 | 60 | ··0x0000058c·ec480014·0a791048·881c2000·00011000·.H...y.H..·..... |
| 61 | ··0x0000059c·29e21050·01590020·806c4a98·18090892·)..P.Y.·.lJ..... | 61 | ··0x0000059c·29e21050·01590020·806c4a98·18090892·)..P.Y.·.lJ..... |
| 62 | ··0x000005ac·0c050ea8·b4042411·8650004c·818b0202·......$..P.L.... | 62 | ··0x000005ac·0c050ea8·b4042411·8650004c·818b0202·......$..P.L.... |
| 63 | ··0x000005bc·29051916·430002a2·10142004·00084008·)...C.....·...@. | 63 | ··0x000005bc·29051916·430002a2·10142004·00084008·)...C.....·...@. |
| 64 | ··0x000005cc·0a08d228·1470105c·14cc444c·c01488a0·...(.p.\..DL.... | 64 | ··0x000005cc·0a08d228·1470105c·14cc444c·c01488a0·...(.p.\..DL.... |
| 65 | ··0x000005dc·40200420·02c | 65 | ··0x000005dc·40200420·02ccefe7·00362002·c61c2993·@·.·.....6·...). |
| 66 | ··0x000005ec·42050900·fad922b1·10892010·00234404·B....."...·..#D. | 66 | ··0x000005ec·42050900·fad922b1·10892010·00234404·B....."...·..#D. |
| 67 | ··0x000005fc·2 | 67 | ··0x000005fc·28010000·2a010000·00000000·00000000·(...*........... |
| 68 | ··0x0000060c·2 | 68 | ··0x0000060c·2c010000·2f010000·30010000·32010000·,.../...0...2... |
| 69 | ··0x0000061c·00000000·00000000·3 | 69 | ··0x0000061c·00000000·00000000·33010000·35010000·........3...5... |
| 70 | ··0x0000062c·3 | 70 | ··0x0000062c·36010000·37010000·00000000·3d010000·6...7.......=... |
| 71 | ··0x0000063c·00000000·00000000·00000000·00000000·................ | 71 | ··0x0000063c·00000000·00000000·00000000·00000000·................ |
| 72 | ··0x0000064c·00000000·3 | 72 | ··0x0000064c·00000000·3e010000·00000000·42010000·....>.......B... |
| 73 | ··0x0000065c·4 | 73 | ··0x0000065c·43010000·00000000·45010000·47010000·C.......E...G... |
| 74 | ··0x0000066c·00000000·4 | 74 | ··0x0000066c·00000000·4b010000·4c010000·4f010000·....K...L...O... |
| 75 | ··0x0000067c·5 | 75 | ··0x0000067c·51010000·52010000·00000000·53010000·Q...R.......S... |
| 76 | ··0x0000068c·00000000·5 | 76 | ··0x0000068c·00000000·54010000·56010000·00000000·....T...V....... |
| 77 | ··0x0000069c·5 | 77 | ··0x0000069c·57010000·58010000·59010000·5a010000·W...X...Y...Z... |
| 78 | ··0x000006ac·00000000·5 | 78 | ··0x000006ac·00000000·5c010000·5d010000·5f010000·....\...]..._... |
| 79 | ··0x000006bc· | 79 | ··0x000006bc·61010000·62010000·00000000·63010000·a...b.......c... |
| 80 | ··0x000006cc·6 | 80 | ··0x000006cc·66010000·00000000·00000000·69010000·f...........i... |
| 81 | ··0x000006dc·6 | 81 | ··0x000006dc·6a010000·6b010000·00000000·00000000·j...k........... |
| 82 | ··0x000006ec·6c010000·6d010000·6f010000·72010000·l...m...o...r... | ||
| 82 | ··0x000006ec·6a010000·6b010000·6d010000·70010000·j...k...m...p... | ||
| 83 | ··0x000006fc·71010000·73010000·74010000·00000000·q...s...t....... | ||
| 84 | ··0x0000070c·75010000·76010000·78010000·7b010000·u...v...x...{... | ||
| 85 | ··0x00000 | 83 | ··0x000006fc·73010000·75010000·76010000·00000000·s...u...v....... |
| 84 | ··0x0000070c·77010000·78010000·7a010000·7d010000·w...x...z...}... | ||
| 85 | ··0x0000071c·7e010000·7f010000·80010000·82010000·~............... | ||
| 86 | ··0x0000072c·00000000·8 | 86 | ··0x0000072c·00000000·84010000·85010000·00000000·................ |
| 87 | ··0x0000073c·8 | 87 | ··0x0000073c·88010000·8a010000·8b010000·00000000·................ |
| 88 | ··0x0000074c·8 | 88 | ··0x0000074c·8d010000·8f010000·90010000·91010000·................ |
| 89 | ··0x0000075c·9 | 89 | ··0x0000075c·93010000·94010000·95010000·00000000·................ |
| 90 | ··0x0000076c·9 | 90 | ··0x0000076c·97010000·99010000·9b010000·9c010000·................ |
| 91 | ··0x0000077c·9 | 91 | ··0x0000077c·9f010000·a1010000·00000000·a2010000·................ |
| 92 | ··0x0000078c· | 92 | ··0x0000078c·a3010000·a4010000·a6010000·a7010000·................ |
| 93 | ··0x0000079c·a | 93 | ··0x0000079c·aa010000·00000000·00000000·ab010000·................ |
| 94 | ··0x000007ac·00000000·a | 94 | ··0x000007ac·00000000·ad010000·00000000·ae010000·................ |
| 95 | ··0x000007bc·00000000·00000000·00000000·00000000·................ | 95 | ··0x000007bc·00000000·00000000·00000000·00000000·................ |
| 96 | ··0x000007cc· | 96 | ··0x000007cc·b0010000·b2010000·b3010000·00000000·................ |
| 97 | ··0x000007dc·00000000·00000000·00000000·b | 97 | ··0x000007dc·00000000·00000000·00000000·b7010000·................ |
| 98 | ··0x000007ec·b | 98 | ··0x000007ec·b8010000·00000000·bc010000·00000000·................ |
| 99 | ··0x000007fc·b | 99 | ··0x000007fc·bf010000·c0010000·c1010000·c2010000·................ |
| 100 | ··0x0000080c·00000000· | 100 | ··0x0000080c·00000000·c4010000·c5010000·00000000·................ |
| 101 | ··0x0000081c·c | 101 | ··0x0000081c·c6010000·c7010000·c8010000·00000000·................ |
| 102 | ··0x0000082c·c | 102 | ··0x0000082c·cb010000·00000000·ce010000·d0010000·................ |
| 103 | ··0x0000083c·00000000· | 103 | ··0x0000083c·00000000·d1010000·d3010000·00000000·................ |
| 104 | ··0x0000084c· | 104 | ··0x0000084c·d4010000·d6010000·d7010000·00000000·................ |
| 105 | ··0x0000085c·00000000·d | 105 | ··0x0000085c·00000000·d9010000·00000000·00000000·................ |
| 106 | ··0x0000086c·d | 106 | ··0x0000086c·dc010000·dd010000·00000000·de010000·................ |
| 107 | ··0x0000087c· | 107 | ··0x0000087c·e1010000·e3010000·e4010000·e5010000·................ |
| 108 | ··0x0000088c·e | 108 | ··0x0000088c·e6010000·00000000·e7010000·e8010000·................ |
| 109 | ··0x0000089c·e | 109 | ··0x0000089c·e9010000·eb010000·ee010000·00000000·................ |
| 110 | ··0x000008ac· | 110 | ··0x000008ac·f1010000·f2010000·f3010000·00000000·................ |
| 111 | ··0x000008bc·00000000·f | 111 | ··0x000008bc·00000000·f6010000·f7010000·f8010000·................ |
| 112 | ··0x000008cc·00000000·f | 112 | ··0x000008cc·00000000·fc010000·fe010000·00000000·................ |
| 113 | ··0x000008dc·f | 113 | ··0x000008dc·ff010000·00020000·02020000·04020000·................ |
| 114 | ··0x000008ec·00000000·00000000·0 | 114 | ··0x000008ec·00000000·00000000·06020000·00000000·................ |
| 115 | ··0x000008fc·0 | 115 | ··0x000008fc·07020000·00000000·08020000·00000000·................ |
| 116 | ··0x0000090c·0 | 116 | ··0x0000090c·09020000·00000000·00000000·0b020000·................ |
| 117 | ··0x0000091c·0 | 117 | ··0x0000091c·0d020000·10020000·11020000·12020000·................ |
| 118 | ··0x0000092c· | 118 | ··0x0000092c·13020000·15020000·16020000·00000000·................ |
| 119 | ··0x0000093c·1 | 119 | ··0x0000093c·17020000·1a020000·00000000·1b020000·................ |
| 120 | ··0x0000094c·1 | 120 | ··0x0000094c·1d020000·1e020000·1f020000·20020000·............·... |
| 121 | ··0x0000095c· | 121 | ··0x0000095c·21020000·23020000·00000000·00000000·!...#........... |
| 122 | ··0x0000096c·00000000· | 122 | ··0x0000096c·00000000·24020000·25020000·26020000·....$...%...&... |
| 123 | ··0x0000097c·00000000·2 | 123 | ··0x0000097c·00000000·27020000·28020000·00000000·....'...(....... |
| Max diff block lines reached; 63451/77711 bytes (81.65%) of diff not shown. | |||
| Offset 1, 5031 lines modified | Offset 1, 5081 lines modified | ||
| 1 | Hex·dump·of·section·'.dynstr': | 1 | Hex·dump·of·section·'.dynstr': |
| 2 | ··0x00008 | 2 | ··0x0000839c·00646566·6c617465·496e6974·325f0064·.deflateInit2_.d |
| 3 | ··0x00008 | 3 | ··0x000083ac·65666c61·74650064·65666c61·7465456e·eflate.deflateEn |
| 4 | ··0x00008 | 4 | ··0x000083bc·64006372·63333200·696e666c·61746500·d.crc32.inflate. |
| 5 | ··0x00008 | 5 | ··0x000083cc·696e666c·61746549·6e697432·5f00696e·inflateInit2_.in |
| 6 | ··0x00008 | 6 | ··0x000083dc·666c6174·65456e64·005f4954·4d5f6465·flateEnd._ITM_de |
| 7 | ··0x00008 | 7 | ··0x000083ec·72656769·73746572·544d436c·6f6e6554·registerTMCloneT |
| 8 | ··0x00008 | 8 | ··0x000083fc·61626c65·005f5f67·6d6f6e5f·73746172·able.__gmon_star |
| 9 | ··0x00008 | 9 | ··0x0000840c·745f5f00·5f49544d·5f726567·69737465·t__._ITM_registe |
| 10 | ··0x00008 | 10 | ··0x0000841c·72544d43·6c6f6e65·5461626c·65005f5a·rTMCloneTable._Z |
| 11 | ··0x00008 | 11 | ··0x0000842c·4e384261·6d546f6f·6c733135·53616d50·N8BamTools15SamP |
| 12 | ··0x00008 | 12 | ··0x0000843c·726f6772·616d4368·61696e35·436c6561·rogramChain5Clea |
| 13 | ··0x000082ac·72457600·5f5a4e38·42616d54·6f6f6c73·rEv._ZN8BamTools | ||
| 14 | ··0x000082bc·3942616d·57726974·65723138·53657443·9BamWriter18SetC | ||
| 15 | ··0x000082cc·6f6d7072·65737369·6f6e4d6f·64654552·ompressionModeER | ||
| 16 | ··0x000082dc·4b4e5330·5f313543·6f6d7072·65737369·KNS0_15Compressi | ||
| 17 | ··0x000082ec·6f6e4d6f·64654500·5f5a4e4b·3842616d·onModeE._ZNK8Bam | ||
| 18 | ··0x000082fc·546f6f6c·73313242·616d416c·69676e6d·Tools12BamAlignm | ||
| 19 | ··0x0000830c·656e7431·38497350·72696d61·7279416c·ent18IsPrimaryAl | ||
| 20 | ··0x0000831c·69676e6d·656e7445·76005f5a·4e384261·ignmentEv._ZN8Ba | ||
| 21 | ··0x0000832c·6d546f6f·6c733231·53616d53·65717565·mTools21SamSeque | ||
| 22 | ··0x0000833c·6e636544·69637469·6f6e6172·79433145·nceDictionaryC1E | ||
| 23 | ··0x0000834c·524b5330·5f005f5a·4e384261·6d546f6f·RKS0_._ZN8BamToo | ||
| 24 | ··0x0000835c·6c733132·53616d52·65616447·726f7570·ls12SamReadGroup | ||
| 25 | ··0x0000836c·44324576·005f5a4e·3842616d·546f6f6c·D2Ev._ZN8BamTool | ||
| 26 | ··0x0000837c·73313553·616d5072·6f677261·6d436861·s15SamProgramCha | ||
| 27 | ··0x0000838c·696e3542·6567696e·4576005f·5a4e5374·in5BeginEv._ZNSt | ||
| 28 | ··0x0000839c·36766563·746f7249·4e384261·6d546f6f·6vectorIN8BamToo | ||
| 29 | ··0x000083ac·6c733135·43757374·6f6d4865·61646572·ls15CustomHeader | ||
| 30 | ··0x000083bc·54616745·53614953·315f4545·43324552·TagESaIS1_EEC2ER | ||
| 31 | ··0x000083cc·4b53335f·005f5a4e·3842616d·546f6f6c·KS3_._ZN8BamTool | ||
| 32 | ··0x000083dc·73395361·6d486561·64657243·3145524b·s9SamHeaderC1ERK | ||
| 33 | ··0x000083ec·4e537437·5f5f6378·78313131·32626173·NSt7__cxx1112bas | ||
| 34 | ··0x000083fc·69635f73·7472696e·67496353·74313163·ic_stringIcSt11c | ||
| 35 | ··0x0000840c·6861725f·74726169·74734963·45536149·har_traitsIcESaI | ||
| 36 | ··0x0000841c·63454545·005f5a4e·53743676·6563746f·cEEE._ZNSt6vecto | ||
| 37 | ··0x0000842c·72496353·61496345·4531345f·4d5f6669·rIcSaIcEE14_M_fi | ||
| 38 | ··0x0000843c·6c6c5f69·6e736572·74454e39·5f5f676e·ll_insertEN9__gn | ||
| 39 | ··0x0000844c·755f6378·7831375f·5f6e6f72·6d616c5f·u_cxx17__normal_ | ||
| 40 | ··0x0000845c·69746572·61746f72·49506353·315f4545·iteratorIPcS1_EE | ||
| 41 | ··0x0000846c·6a524b63·005f5a4e·4b384261·6d546f6f·jRKc._ZNK8BamToo | ||
| 42 | ··0x0000847c·6c733942·616d5265·61646572·39476574·ls9BamReader9Get | ||
| 43 | ··0x0000848c·48656164·65724576·005f5a4e·4b384261·HeaderEv._ZNK8Ba | ||
| 44 | ··0x0000849c·6d546f6f·6c733953·616d4865·61646572·mTools9SamHeader | ||
| 45 | ··0x000084ac·31334861·73526561·6447726f·75707345·13HasReadGroupsE | ||
| 46 | ··0x000084bc·76005f5a·4e384261·6d546f6f·6c733131·v._ZN8BamTools11 | ||
| 47 | ··0x000084cc·53616d53·65717565·6e636544·31457600·SamSequenceD1Ev. | ||
| 48 | ··0x000084dc·5f5a4e38·42616d54·6f6f6c73·32325361·_ZN8BamTools22Sa | ||
| 49 | ··0x000084ec·6d526561·6447726f·75704469·6374696f·mReadGroupDictio | ||
| 50 | ··0x000084fc·6e617279·44314576·005f5a4e·3842616d·naryD1Ev._ZN8Bam | ||
| 51 | ··0x0000850c·546f6f6c·73313442·616d4d75·6c746952·Tools14BamMultiR | ||
| 52 | ··0x0000851c·65616465·72433145·76005f5a·4e537436·eaderC1Ev._ZNSt6 | ||
| 53 | ··0x0000852c·76656374·6f72494e·3842616d·546f6f6c·vectorIN8BamTool | ||
| 54 | ··0x0000853c·73313053·616d5072·6f677261·6d455361·s10SamProgramESa | ||
| 55 | ··0x0000854c·4953315f·45454431·4576005f·5a4e3842·IS1_EED1Ev._ZN8B | ||
| 56 | ··0x0000855c·616d546f·6f6c7332·3153616d·53657175·amTools21SamSequ | ||
| 57 | ··0x0000856c·656e6365·44696374·696f6e61·72794431·enceDictionaryD1 | ||
| 58 | ··0x0000857c·4576005f·5a4e3842·616d546f·6f6c7332·Ev._ZN8BamTools2 | ||
| 59 | ··0x0000858c·3253616d·52656164·47726f75·70446963·2SamReadGroupDic | ||
| 60 | ··0x0000859c·74696f6e·61727943·3145524b·53305f00·tionaryC1ERKS0_. | ||
| 61 | ··0x000085ac·5f5a4e38·42616d54·6f6f6c73·31344261·_ZN8BamTools14Ba | ||
| 62 | ··0x000085bc·6d4d756c·74695265·61646572·35436c6f·mMultiReader5Clo | ||
| 63 | ··0x000085cc·73654576·005f5a4e·3842616d·546f6f6c·seEv._ZN8BamTool | ||
| 64 | ··0x000085dc·73313253·616d5265·61644772·6f757043·s12SamReadGroupC | ||
| 65 | ··0x000085ec·3145524b·53305f00·5f5a4e53·74375f5f·1ERKS0_._ZNSt7__ | ||
| 66 | ··0x000085fc·63787831·31313562·61736963·5f737472·cxx1115basic_str | ||
| 67 | ··0x0000860c·696e6762·75664963·53743131·63686172·ingbufIcSt11char | ||
| 68 | ··0x0000861c·5f747261·69747349·63455361·49634545·_traitsIcESaIcEE | ||
| 69 | ··0x0000862c·44304576·005f5a4e·4b384261·6d546f6f·D0Ev._ZNK8BamToo | ||
| 70 | ··0x0000863c·6c733132·42616d41·6c69676e·6d656e74·ls12BamAlignment | ||
| 71 | ··0x0000864c·3849734d·61707065·64457600·5f5a4e38·8IsMappedEv._ZN8 | ||
| 72 | ··0x0000865c·42616d54·6f6f6c73·31315361·6d536571·BamTools11SamSeq | ||
| 73 | ··0x0000866c·75656e63·65443245·76005f5a·4e384261·uenceD2Ev._ZN8Ba | ||
| 74 | ··0x0000867c·6d546f6f·6c733942·616d5265·61646572·mTools9BamReader | ||
| 75 | ··0x0000868c·43314576·005f5a4e·3842616d·546f6f6c·C1Ev._ZN8BamTool | ||
| 76 | ··0x0000869c·73323253·616d5265·61644772·6f757044·s22SamReadGroupD | ||
| 77 | ··0x000086ac·69637469·6f6e6172·79443245·76005f5a·ictionaryD2Ev._Z | ||
| 78 | ··0x000086bc·4e384261·6d546f6f·6c733953·616d4865·N8BamTools9SamHe | ||
| 79 | ··0x000086cc·61646572·43324552·4b53305f·005f5a4e·aderC2ERKS0_._ZN | ||
| 80 | ··0x000086dc·53743676·6563746f·72494e38·42616d54·St6vectorIN8BamT | ||
| 81 | ··0x000086ec·6f6f6c73·31305361·6d50726f·6772616d·ools10SamProgram | ||
| 82 | ··0x000086fc·45536149·53315f45·45443245·76005f5a·ESaIS1_EED2Ev._Z | ||
| 83 | ··0x0000870c·4e4b3842·616d546f·6f6c7331·3242616d·NK8BamTools12Bam | ||
| 84 | ··0x0000871c·416c6967·6e6d656e·74313549·73526576·Alignment15IsRev | ||
| 85 | ··0x0000872c·65727365·53747261·6e644576·005f5a4e·erseStrandEv._ZN | ||
| 86 | ··0x0000873c·4b384261·6d546f6f·6c733132·53616d52·K8BamTools12SamR | ||
| 87 | ··0x0000874c·65616447·726f7570·31324861·73466c6f·eadGroup12HasFlo | ||
| 88 | ··0x0000875c·774f7264·65724576·005f5a4e·3842616d·wOrderEv._ZN8Bam | ||
| 89 | ··0x0000876c·546f6f6c·73313553·616d5072·6f677261·Tools15SamProgra | ||
| 90 | ··0x0000877c·6d436861·696e3345·6e644576·005f5a4e·mChain3EndEv._ZN | ||
| 91 | ··0x0000878c·3842616d·546f6f6c·73323153·616d5365·8BamTools21SamSe | ||
| 92 | ··0x0000879c·7175656e·63654469·6374696f·6e617279·quenceDictionary | ||
| 93 | ··0x000087ac·44324576·005f5a4e·53743676·6563746f·D2Ev._ZNSt6vecto | ||
| 94 | ··0x000087bc·72494e38·42616d54·6f6f6c73·37436967·rIN8BamTools7Cig | ||
| 95 | ··0x000087cc·61724f70·45536149·53315f45·4531375f·arOpESaIS1_EE17_ | ||
| 96 | ··0x000087dc·4d5f7265·616c6c6f·635f696e·73657274·M_realloc_insert | ||
| 97 | ··0x000087ec·494a524b·53315f45·4545764e·395f5f67·IJRKS1_EEEvN9__g | ||
| 98 | ··0x000087fc·6e755f63·78783137·5f5f6e6f·726d616c·nu_cxx17__normal | ||
| 99 | ··0x0000880c·5f697465·7261746f·72495053·315f5333·_iteratorIPS1_S3 | ||
| 100 | ··0x0000881c·5f454544·704f545f·005f5a4e·3842616d·_EEDpOT_._ZN8Bam | ||
| 101 | ··0x0000882c·546f6f6c·73394261·6d577269·74657235·Tools9BamWriter5 | ||
| 102 | ··0x0000883c·436c6f73·65457600·5f5a4e53·74375f5f·CloseEv._ZNSt7__ | ||
| 103 | ··0x0000884c·63787831·31313562·61736963·5f737472·cxx1115basic_str | ||
| 104 | ··0x0000885c·696e6762·75664963·53743131·63686172·ingbufIcSt11char | ||
| 105 | ··0x0000886c·5f747261·69747349·63455361·49634545·_traitsIcESaIcEE | ||
| 106 | ··0x0000887c·44314576·005f5a4e·4b384261·6d546f6f·D1Ev._ZNK8BamToo | ||
| 107 | ··0x0000888c·6c733134·42616d4d·756c7469·52656164·ls14BamMultiRead | ||
| 108 | ··0x0000889c·65723136·47657452·65666572·656e6365·er16GetReference | ||
| 109 | ··0x000088ac·44617461·4576005f·5a4e5374·36766563·DataEv._ZNSt6vec | ||
| 110 | ··0x000088bc·746f7249·4e384261·6d546f6f·6c733131·torIN8BamTools11 | ||
| 111 | ··0x000088cc·53616d53·65717565·6e636545·53614953·SamSequenceESaIS | ||
| 112 | ··0x000088dc·315f4545·44314576·005f5a4e·3842616d·1_EED1Ev._ZN8Bam | ||
| 113 | ··0x000088ec·546f6f6c·73394261·6d526561·64657234·Tools9BamReader4 | ||
| 114 | ··0x000088fc·4f70656e·45524b4e·5374375f·5f637878·OpenERKNSt7__cxx | ||
| 115 | ··0x0000890c·31313132·62617369·635f7374·72696e67·1112basic_string | ||
| 116 | ··0x0000891c·49635374·31316368·61725f74·72616974·IcSt11char_trait | ||
| 117 | ··0x0000892c·73496345·53614963·45454500·5f5a5374·sIcESaIcEEE._ZSt | ||
| 118 | ··0x0000893c·706c4963·53743131·63686172·5f747261·plIcSt11char_tra | ||
| 119 | ··0x0000894c·69747349·63455361·49634545·4e537437·itsIcESaIcEENSt7 | ||
| 120 | ··0x0000895c·5f5f6378·78313131·32626173·69635f73·__cxx1112basic_s | ||
| 121 | ··0x0000896c·7472696e·6749545f·54305f54·315f4545·tringIT_T0_T1_EE | ||
| 122 | ··0x0000897c·524b5338·5f53415f·005f5a4e·53743676·RKS8_SA_._ZNSt6v | ||
| 123 | ··0x0000898c·6563746f·72494e38·42616d54·6f6f6c73·ectorIN8BamTools | ||
| 124 | ··0x0000899c·31354375·73746f6d·48656164·65725461·15CustomHeaderTa | ||
| 125 | ··0x000089ac·67455361·4953315f·45454331·45524b53·gESaIS1_EEC1ERKS | ||
| 126 | ··0x000089bc·335f005f·5a4e4b38·42616d54·6f6f6c73·3_._ZNK8BamTools | ||
| Max diff block lines reached; 642393/676954 bytes (94.89%) of diff not shown. | |||
| Offset 3, 16 lines modified | Offset 3, 16 lines modified | ||
| 3 | Disassembly·of·section·.init: | 3 | Disassembly·of·section·.init: |
| 4 | 0001e000·<.init>: | 4 | 0001e000·<.init>: |
| 5 | _init(): | 5 | _init(): |
| 6 | » push···%ebx | 6 | » push···%ebx |
| 7 | » sub····$0x8,%esp | 7 | » sub····$0x8,%esp |
| 8 | » call···2 | 8 | » call···2b1e0·<_start@@Base+0x30> |
| 9 | » add····$0x10 | 9 | » add····$0x10efeb,%ebx |
| 10 | » mov····-0x1c(%ebx),%eax | 10 | » mov····-0x1c(%ebx),%eax |
| 11 | » test···%eax,%eax | 11 | » test···%eax,%eax |
| 12 | » je·····1e01b·<__printf_chk@plt-0x15> | 12 | » je·····1e01b·<__printf_chk@plt-0x15> |
| 13 | » call···*%eax | 13 | » call···*%eax |
| 14 | » add····$0x8,%esp | 14 | » add····$0x8,%esp |
| 15 | » pop····%ebx | 15 | » pop····%ebx |
| 16 | » ret | 16 | » ret |
| Offset 125, 430 lines modified | Offset 125, 430 lines modified | ||
| 125 | » jmp····1e020·<__printf_chk@plt-0x10> | 125 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 126 | 0001e1a0·<wrapper2_dgesv_@plt>: | 126 | 0001e1a0·<wrapper2_dgesv_@plt>: |
| 127 | » jmp····*0x68(%ebx) | 127 | » jmp····*0x68(%ebx) |
| 128 | » push···$0xb8 | 128 | » push···$0xb8 |
| 129 | » jmp····1e020·<__printf_chk@plt-0x10> | 129 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 130 | 0001e1b0·< | 130 | 0001e1b0·<operator·delete(void*,·unsigned·int,·std::align_val_t)@plt>: |
| 131 | » jmp····*0x6c(%ebx) | 131 | » jmp····*0x6c(%ebx) |
| 132 | » push···$0xc0 | 132 | » push···$0xc0 |
| 133 | » jmp····1e020·<__printf_chk@plt-0x10> | 133 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 134 | 0001e1c0·<std:: | 134 | 0001e1c0·<std::basic_filebuf<char,·std::char_traits<char>·>::close()@plt>: |
| 135 | » jmp····*0x70(%ebx) | 135 | » jmp····*0x70(%ebx) |
| 136 | » push···$0xc8 | 136 | » push···$0xc8 |
| 137 | » jmp····1e020·<__printf_chk@plt-0x10> | 137 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 138 | 0001e1d0·<s | 138 | 0001e1d0·<std::__basic_file<char>::is_open()·const@plt>: |
| 139 | » jmp····*0x74(%ebx) | 139 | » jmp····*0x74(%ebx) |
| 140 | » push···$0xd0 | 140 | » push···$0xd0 |
| 141 | » jmp····1e020·<__printf_chk@plt-0x10> | 141 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 142 | 0001e1e0·< | 142 | 0001e1e0·<sqrtf@plt>: |
| 143 | » jmp····*0x78(%ebx) | 143 | » jmp····*0x78(%ebx) |
| 144 | » push···$0xd8 | 144 | » push···$0xd8 |
| 145 | » jmp····1e020·<__printf_chk@plt-0x10> | 145 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 146 | 0001e1f0·< | 146 | 0001e1f0·<mkdir@plt>: |
| 147 | » jmp····*0x7c(%ebx) | 147 | » jmp····*0x7c(%ebx) |
| 148 | » push···$0xe0 | 148 | » push···$0xe0 |
| 149 | » jmp····1e020·<__printf_chk@plt-0x10> | 149 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 150 | 0001e200·< | 150 | 0001e200·<BamTools::BamMultiReader::GetNextAlignmentCore(BamTools::BamAlignment&)@plt>: |
| 151 | » jmp····*0x80(%ebx) | 151 | » jmp····*0x80(%ebx) |
| 152 | » push···$0xe8 | 152 | » push···$0xe8 |
| 153 | » jmp····1e020·<__printf_chk@plt-0x10> | 153 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 154 | 0001e210·<std::basic_i | 154 | 0001e210·<std::__cxx11::basic_ostringstream<char,·std::char_traits<char>,·std::allocator<char>·>::~basic_ostringstream()@plt>: |
| 155 | » jmp····*0x84(%ebx) | 155 | » jmp····*0x84(%ebx) |
| 156 | » push···$0xf0 | 156 | » push···$0xf0 |
| 157 | » jmp····1e020·<__printf_chk@plt-0x10> | 157 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 158 | 0001e220·<strstr@plt>: | 158 | 0001e220·<std::basic_ifstream<char,·std::char_traits<char>·>::~basic_ifstream()@plt>: |
| 159 | » jmp····*0x88(%ebx) | 159 | » jmp····*0x88(%ebx) |
| 160 | » push···$0xf8 | 160 | » push···$0xf8 |
| 161 | » jmp····1e020·<__printf_chk@plt-0x10> | 161 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 162 | 0001e230·< | 162 | 0001e230·<strstr@plt>: |
| 163 | » jmp····*0x8c(%ebx) | 163 | » jmp····*0x8c(%ebx) |
| 164 | » push···$0x100 | 164 | » push···$0x100 |
| 165 | » jmp····1e020·<__printf_chk@plt-0x10> | 165 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 166 | 0001e240·< | 166 | 0001e240·<BamTools::BamMultiReader::Close()@plt>: |
| 167 | » jmp····*0x90(%ebx) | 167 | » jmp····*0x90(%ebx) |
| 168 | » push···$0x108 | 168 | » push···$0x108 |
| 169 | » jmp····1e020·<__printf_chk@plt-0x10> | 169 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 170 | 0001e250·< | 170 | 0001e250·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::compare(char·const*)·const@plt>: |
| 171 | » jmp····*0x94(%ebx) | 171 | » jmp····*0x94(%ebx) |
| 172 | » push···$0x110 | 172 | » push···$0x110 |
| 173 | » jmp····1e020·<__printf_chk@plt-0x10> | 173 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 174 | 0001e260·< | 174 | 0001e260·<BamTools::BamWriter::Open(std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·BamTools::SamHeader·const&,·std::vector<BamTools::RefData,·std::allocator<BamTools::RefData>·>·const&)@plt>: |
| 175 | » jmp····*0x98(%ebx) | 175 | » jmp····*0x98(%ebx) |
| 176 | » push···$0x118 | 176 | » push···$0x118 |
| 177 | » jmp····1e020·<__printf_chk@plt-0x10> | 177 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 178 | 0001e270·<s | 178 | 0001e270·<Json::Value::Value(unsigned·long·long)@plt>: |
| 179 | » jmp····*0x9c(%ebx) | 179 | » jmp····*0x9c(%ebx) |
| 180 | » push···$0x120 | 180 | » push···$0x120 |
| 181 | » jmp····1e020·<__printf_chk@plt-0x10> | 181 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 182 | 0001e280·< | 182 | 0001e280·<std::ios_base::ios_base()@plt>: |
| 183 | » jmp····*0xa0(%ebx) | 183 | » jmp····*0xa0(%ebx) |
| 184 | » push···$0x128 | 184 | » push···$0x128 |
| 185 | » jmp····1e020·<__printf_chk@plt-0x10> | 185 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 186 | 0001e290·< | 186 | 0001e290·<BamTools::BamAlignment::BamAlignment()@plt>: |
| 187 | » jmp····*0xa4(%ebx) | 187 | » jmp····*0xa4(%ebx) |
| 188 | » push···$0x130 | 188 | » push···$0x130 |
| 189 | » jmp····1e020·<__printf_chk@plt-0x10> | 189 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 190 | 0001e2a0·< | 190 | 0001e2a0·<std::ios_base::~ios_base()@plt>: |
| 191 | » jmp····*0xa8(%ebx) | 191 | » jmp····*0xa8(%ebx) |
| 192 | » push···$0x138 | 192 | » push···$0x138 |
| 193 | » jmp····1e020·<__printf_chk@plt-0x10> | 193 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 194 | 0001e2b0·< | 194 | 0001e2b0·<BamTools::BamWriter::SetCompressionMode(BamTools::BamWriter::CompressionMode·const&)@plt>: |
| 195 | » jmp····*0xac(%ebx) | 195 | » jmp····*0xac(%ebx) |
| 196 | » push···$0x140 | 196 | » push···$0x140 |
| 197 | » jmp····1e020·<__printf_chk@plt-0x10> | 197 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 198 | 0001e2c0·<strdu | 198 | 0001e2c0·<Json::Reader::parse(std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·Json::Value&,·bool)@plt>: |
| 199 | » jmp····*0xb0(%ebx) | 199 | » jmp····*0xb0(%ebx) |
| 200 | » push···$0x148 | 200 | » push···$0x148 |
| 201 | » jmp····1e020·<__printf_chk@plt-0x10> | 201 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 202 | 0001e2d0·< | 202 | 0001e2d0·<strdup@plt>: |
| 203 | » jmp····*0xb4(%ebx) | 203 | » jmp····*0xb4(%ebx) |
| 204 | » push···$0x150 | 204 | » push···$0x150 |
| 205 | » jmp····1e020·<__printf_chk@plt-0x10> | 205 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 206 | 0001e2e0·< | 206 | 0001e2e0·<realpath@plt>: |
| 207 | » jmp····*0xb8(%ebx) | 207 | » jmp····*0xb8(%ebx) |
| 208 | » push···$0x158 | 208 | » push···$0x158 |
| 209 | » jmp····1e020·<__printf_chk@plt-0x10> | 209 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 210 | 0001e2f0·< | 210 | 0001e2f0·<pthread_cond_broadcast@plt>: |
| 211 | » jmp····*0xbc(%ebx) | 211 | » jmp····*0xbc(%ebx) |
| 212 | » push···$0x160 | 212 | » push···$0x160 |
| 213 | » jmp····1e020·<__printf_chk@plt-0x10> | 213 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 214 | 0001e300·<std::__thr | 214 | 0001e300·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::substr(unsigned·int,·unsigned·int)·const@plt>: |
| 215 | » jmp····*0xc0(%ebx) | 215 | » jmp····*0xc0(%ebx) |
| 216 | » push···$0x168 | 216 | » push···$0x168 |
| 217 | » jmp····1e020·<__printf_chk@plt-0x10> | 217 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 218 | 0001e310·< | 218 | 0001e310·<std::__throw_bad_alloc()@plt>: |
| 219 | » jmp····*0xc4(%ebx) | 219 | » jmp····*0xc4(%ebx) |
| 220 | » push···$0x170 | 220 | » push···$0x170 |
| 221 | » jmp····1e020·<__printf_chk@plt-0x10> | 221 | » jmp····1e020·<__printf_chk@plt-0x10> |
| 222 | 0001e320·< | 222 | 0001e320·<BamTools::BamMultiReader::GetReferenceData()·const@plt>: |
| 223 | » jmp····*0xc8(%ebx) | 223 | » jmp····*0xc8(%ebx) |
| 224 | » push···$0x178 | 224 | » push···$0x178 |
| 225 | » jmp····1e020·<__printf_chk@plt-0x10> | 225 | » jmp····1e020·<__printf_chk@plt-0x10> |
| Max diff block lines reached; 25986/31796 bytes (81.73%) of diff not shown. | |||
| Offset 1, 8 lines modified | Offset 1, 8 lines modified | ||
| 1 | Disassembly·of·section·.plt.got: | 1 | Disassembly·of·section·.plt.got: |
| 2 | 0001f0 | 2 | 0001f0a0·<__cxa_finalize@plt>: |
| 3 | » jmp····*-0x80(%ebx) | 3 | » jmp····*-0x80(%ebx) |
| 4 | » xchg···%ax,%ax | 4 | » xchg···%ax,%ax |
| Offset 1, 457 lines modified | Offset 1, 450 lines modified | ||
| 1 | Disassembly·of·section·.text: | 1 | Disassembly·of·section·.text: |
| 2 | 0001f0 | 2 | 0001f0b0·<arma::Mat<double>::reset()@@Base-0x5c94>: |
| 3 | main.cold(): | 3 | main.cold(): |
| 4 | /usr/include/c++/12/bits/basic_string.h:795·(discriminator·5) | 4 | /usr/include/c++/12/bits/basic_string.h:795·(discriminator·5) |
| 5 | » sub····$0xc,%esp | 5 | » sub····$0xc,%esp |
| 6 | » push···-0x11a8(%ebp) | 6 | » push···-0x11a8(%ebp) |
| 7 | » mov····%edi,%ebx | 7 | » mov····%edi,%ebx |
| 8 | » call···1eaa0·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> | 8 | » call···1eaa0·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> |
| 9 | /usr/include/c++/12/bits/new_allocator.h:90·(discriminator·5) | 9 | /usr/include/c++/12/bits/new_allocator.h:90·(discriminator·5) |
| 10 | » add····$0x10,%esp | 10 | » add····$0x10,%esp |
| 11 | /usr/include/c++/12/bits/basic_string.h:795·(discriminator·3) | 11 | /usr/include/c++/12/bits/basic_string.h:795·(discriminator·3) |
| 12 | » sub····$0xc,%esp | 12 | » sub····$0xc,%esp |
| 13 | » push···-0x11 | 13 | » push···-0x11a4(%ebp) |
| 14 | » mov····%edi,%ebx | 14 | » mov····%edi,%ebx |
| 15 | » call···1eaa0·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> | 15 | » call···1eaa0·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> |
| 16 | /usr/include/c++/12/bits/new_allocator.h:90·(discriminator·3) | 16 | /usr/include/c++/12/bits/new_allocator.h:90·(discriminator·3) |
| 17 | » add····$0x10,%esp | 17 | » add····$0x10,%esp |
| 18 | ./obj-i686-linux-gnu/./VariantCaller/VariantCaller.cpp:151 | 18 | ./obj-i686-linux-gnu/./VariantCaller/VariantCaller.cpp:151 |
| 19 | » sub····$0xc,%esp | 19 | » sub····$0xc,%esp |
| 20 | » push···-0x11 | 20 | » push···-0x11bc(%ebp) |
| 21 | » call···32 | 21 | » call···32c50·<OrderedVCFWriter::~OrderedVCFWriter()@@Base> |
| 22 | » add····$0x10,%esp | 22 | » add····$0x10,%esp |
| 23 | » sub····$0xc,%esp | 23 | » sub····$0xc,%esp |
| 24 | » push···-0x11 | 24 | » push···-0x11dc(%ebp) |
| 25 | » call···2f | 25 | » call···2f490·<InputStructures::~InputStructures()@@Base> |
| 26 | » add····$0x10,%esp | 26 | » add····$0x10,%esp |
| 27 | » sub····$0xc,%esp | 27 | » sub····$0xc,%esp |
| 28 | » push···-0x11 | 28 | » push···-0x11e0(%ebp) |
| 29 | » call···2e | 29 | » call···2eac0·<SampleManager::~SampleManager()@@Base> |
| 30 | » add····$0x10,%esp | 30 | » add····$0x10,%esp |
| 31 | » sub····$0xc,%esp | 31 | » sub····$0xc,%esp |
| 32 | » push···-0x11 | 32 | » push···-0x11c4(%ebp) |
| 33 | » mov····%edi,%ebx | 33 | » mov····%edi,%ebx |
| 34 | » call···34 | 34 | » call···34320·<BAMWalkerEngine::~BAMWalkerEngine()@@Base> |
| 35 | » add····$0x10,%esp | 35 | » add····$0x10,%esp |
| 36 | » sub····$0xc,%esp | 36 | » sub····$0xc,%esp |
| 37 | » push···-0x11c | 37 | » push···-0x11c8(%ebp) |
| 38 | » mov····%edi,%ebx | 38 | » mov····%edi,%ebx |
| 39 | » call···3 | 39 | » call···3df00·<TargetsManager::~TargetsManager()@@Base> |
| 40 | » add····$0x10,%esp | 40 | » add····$0x10,%esp |
| 41 | » sub····$0xc,%esp | 41 | » sub····$0xc,%esp |
| 42 | » push···-0x11 | 42 | » push···-0x11e4(%ebp) |
| 43 | » call···2e | 43 | » call···2e450·<ReferenceReader::~ReferenceReader()@@Base> |
| 44 | » add····$0x10,%esp | 44 | » add····$0x10,%esp |
| 45 | » sub····$0xc,%esp | 45 | » sub····$0xc,%esp |
| 46 | » push···-0x11 | 46 | » push···-0x11c0(%ebp) |
| 47 | » call···2 | 47 | » call···2f130·<ExtendParameters::~ExtendParameters()@@Base> |
| 48 | » add····$0x10,%esp | 48 | » add····$0x10,%esp |
| 49 | » sub····$0xc,%esp | 49 | » sub····$0xc,%esp |
| 50 | » push···-0x11 | 50 | » push···-0x11e8(%ebp) |
| 51 | » mov····%edi,%ebx | 51 | » mov····%edi,%ebx |
| 52 | » call···1ec40·<std::basic_ofstream<char,·std::char_traits<char>·>::~basic_ofstream()@plt> | 52 | » call···1ec40·<std::basic_ofstream<char,·std::char_traits<char>·>::~basic_ofstream()@plt> |
| 53 | » mov····%esi,(%esp) | 53 | » mov····%esi,(%esp) |
| 54 | » call···1ee | 54 | » call···1eed0·<_Unwind_Resume@plt> |
| 55 | /usr/include/c++/12/bits/basic_string.h:795 | 55 | /usr/include/c++/12/bits/basic_string.h:795 |
| 56 | » sub····$0xc,%esp | 56 | » sub····$0xc,%esp |
| 57 | » push···-0x11a8(%ebp) | 57 | » push···-0x11a8(%ebp) |
| 58 | » mov····%edi,%ebx | 58 | » mov····%edi,%ebx |
| 59 | » call···1eaa0·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> | 59 | » call···1eaa0·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> |
| 60 | /usr/include/c++/12/bits/new_allocator.h:90 | 60 | /usr/include/c++/12/bits/new_allocator.h:90 |
| 61 | » add····$0x10,%esp | 61 | » add····$0x10,%esp |
| 62 | /usr/include/c++/12/bits/basic_string.h:795·(discriminator·5) | 62 | /usr/include/c++/12/bits/basic_string.h:795·(discriminator·5) |
| 63 | » sub····$0xc,%esp | 63 | » sub····$0xc,%esp |
| 64 | » push···-0x11 | 64 | » push···-0x11c0(%ebp) |
| 65 | » mov····%edi,%ebx | 65 | » mov····%edi,%ebx |
| 66 | » call···1eaa0·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> | 66 | » call···1eaa0·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> |
| 67 | /usr/include/c++/12/bits/new_allocator.h:90·(discriminator·5) | 67 | /usr/include/c++/12/bits/new_allocator.h:90·(discriminator·5) |
| 68 | » add····$0x10,%esp | 68 | » add····$0x10,%esp |
| 69 | /usr/include/c++/12/bits/basic_string.h:795·(discriminator·3) | 69 | /usr/include/c++/12/bits/basic_string.h:795·(discriminator·3) |
| 70 | » sub····$0xc,%esp | 70 | » sub····$0xc,%esp |
| 71 | » push···-0x11 | 71 | » push···-0x11bc(%ebp) |
| 72 | » mov····%edi,%ebx | 72 | » mov····%edi,%ebx |
| 73 | » call···1eaa0·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> | 73 | » call···1eaa0·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> |
| 74 | /usr/include/c++/12/bits/new_allocator.h:90·(discriminator·3) | 74 | /usr/include/c++/12/bits/new_allocator.h:90·(discriminator·3) |
| 75 | » mov····%esi,(%esp) | 75 | » mov····%esi,(%esp) |
| 76 | » call···1ee | 76 | » call···1eed0·<_Unwind_Resume@plt> |
| 77 | /usr/include/c++/12/bits/basic_string.h:795·(discriminator·3) | 77 | /usr/include/c++/12/bits/basic_string.h:795·(discriminator·3) |
| 78 | » sub····$0xc,%esp | 78 | » sub····$0xc,%esp |
| 79 | » mov····%edi,%ebx | 79 | » mov····%edi,%ebx |
| 80 | » push···%esi | 80 | » push···%esi |
| 81 | » call···1eaa0·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> | 81 | » call···1eaa0·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> |
| 82 | /usr/include/c++/12/bits/new_allocator.h:90·(discriminator·3) | 82 | /usr/include/c++/12/bits/new_allocator.h:90·(discriminator·3) |
| 83 | » mov····-0x11 | 83 | » mov····-0x11a0(%ebp),%esi |
| 84 | » add····$0x10,%esp | 84 | » add····$0x10,%esp |
| 85 | /usr/include/c++/12/bits/stl_list.h:575 | 85 | /usr/include/c++/12/bits/stl_list.h:575 |
| 86 | » sub····$0xc,%esp | 86 | » sub····$0xc,%esp |
| 87 | » push···-0x11 | 87 | » push···-0x11ec(%ebp) |
| 88 | ./obj-i686-linux-gnu/./VariantCaller/VariantCaller.cpp:151 | 88 | ./obj-i686-linux-gnu/./VariantCaller/VariantCaller.cpp:151 |
| 89 | » mov····%edi,%ebx | 89 | » mov····%edi,%ebx |
| 90 | /usr/include/c++/12/bits/stl_list.h:575 | 90 | /usr/include/c++/12/bits/stl_list.h:575 |
| 91 | » call··· | 91 | » call···301e0·<std::__cxx11::_List_base<MetricsAccumulator,·std::allocator<MetricsAccumulator>·>::_M_clear()@@Base> |
| 92 | ./obj-i686-linux-gnu/./VariantCaller/VariantCaller.cpp:151 | 92 | ./obj-i686-linux-gnu/./VariantCaller/VariantCaller.cpp:151 |
| 93 | » pop····%eax | 93 | » pop····%eax |
| 94 | » push···-0x11 | 94 | » push···-0x11f0(%ebp) |
| 95 | » call···bb | 95 | » call···bba40·<AlleleParser::~AlleleParser()@@Base> |
| 96 | » add····$0x10,%esp | 96 | » add····$0x10,%esp |
| 97 | » sub····$0xc,%esp | 97 | » sub····$0xc,%esp |
| 98 | » push···-0x11a8(%ebp) | 98 | » push···-0x11a8(%ebp) |
| 99 | » mov····%edi,%ebx | 99 | » mov····%edi,%ebx |
| 100 | » call···4 | 100 | » call···49e20·<HotspotReader::~HotspotReader()@@Base> |
| 101 | » add····$0x10,%esp | 101 | » add····$0x10,%esp |
| 102 | /usr/include/c++/12/bits/stl_deque.h:1028 | 102 | /usr/include/c++/12/bits/stl_deque.h:1028 |
| 103 | » sub····$0xc,%esp | 103 | » sub····$0xc,%esp |
| 104 | » push···-0x11 | 104 | » push···-0x11f4(%ebp) |
| 105 | » call···2f | 105 | » call···2fa70·<std::_Deque_base<Alignment*,·std::allocator<Alignment*>·>::~_Deque_base()@@Base> |
| 106 | » add····$0x10,%esp | 106 | » add····$0x10,%esp |
| 107 | » jmp····1f0 | 107 | » jmp····1f0d6·<__cxa_finalize@plt+0x36> |
| 108 | VariantCallerWorker(void*)·[clone·.cold]: | 108 | VariantCallerWorker(void*)·[clone·.cold]: |
| 109 | ./obj-i686-linux-gnu/./VariantCaller/OrderedVCFWriter.h:91 | 109 | ./obj-i686-linux-gnu/./VariantCaller/OrderedVCFWriter.h:91 |
| 110 | » sub····$0xc,%esp | 110 | » sub····$0xc,%esp |
| 111 | » push···-0x2 | 111 | » push···-0x2ac(%ebp) |
| 112 | » call···31 | 112 | » call···31eb0·<std::deque<VariantCandidate,·std::allocator<VariantCandidate>·>::~deque()@@Base> |
| 113 | » add····$0x10,%esp | 113 | » add····$0x10,%esp |
| 114 | ./obj-i686-linux-gnu/./VariantCaller/ | 114 | ./obj-i686-linux-gnu/./VariantCaller/VariantCaller.cpp:363 |
| 115 | » sub····$0xc,%esp | 115 | » sub····$0xc,%esp |
| 116 | » push···-0x284(%ebp) | ||
| 117 | » call···2e5c0·<PersistingThreadObjects::~PersistingThreadObjects()@@Base> | ||
| 116 | » lea····-0x28(%ebp),%eax | ||
| 117 | » push···%eax | ||
| 118 | » call···2f6b0·<std::vector<DPTreephaser,·std::allocator<DPTreephaser>·>::~vector()@@Base> | ||
| 119 | » lea····-0x114(%ebp),%eax | ||
| 120 | » mov····%eax,(%esp) | ||
| 121 | » call···2e400·<Realigner::~Realigner()@@Base> | ||
| Max diff block lines reached; 21000064/21006286 bytes (99.97%) of diff not shown. | |||
| Offset 1, 14 lines modified | Offset 1, 14 lines modified | ||
| 1 | Disassembly·of·section·.fini: | 1 | Disassembly·of·section·.fini: |
| 2 | 000 | 2 | 000f4324·<.fini>: |
| 3 | _fini(): | 3 | _fini(): |
| 4 | » push···%ebx | 4 | » push···%ebx |
| 5 | » sub····$0x8,%esp | 5 | » sub····$0x8,%esp |
| 6 | » call···2 | 6 | » call···2b1e0·<_start@@Base+0x30> |
| 7 | » add····$0x3 | 7 | » add····$0x38cc7,%ebx |
| 8 | » add····$0x8,%esp | 8 | » add····$0x8,%esp |
| 9 | » pop····%ebx | 9 | » pop····%ebx |
| 10 | » ret | 10 | » ret |
| Offset 1, 2722 lines modified | Offset 1, 2876 lines modified | ||
| Diff chunk too large, falling back to line-by-line diff (2873 lines added, 2719 lines removed) | |||
| 1 | Hex·dump·of·section·'.rodata': | 1 | Hex·dump·of·section·'.rodata': |
| 2 | ··0x000f | 2 | ··0x000f5000·03000000·01000200·63616e6e·6f742063·........cannot·c |
| 3 | ··0x000f | 3 | ··0x000f5010·72656174·65207374·643a3a64·65717565·reate·std::deque |
| 4 | ··0x000f | 4 | ··0x000f5020·206c6172·67657220·7468616e·206d6178··larger·than·max |
| 5 | ··0x000f | 5 | ··0x000f5030·5f73697a·65282900·74766320·25732d25·_size().tvc·%s-% |
| 6 | ··0x000f | 6 | ··0x000f5040·73202825·7329202d·20546f72·72656e74·s·(%s)·-·Torrent |
| 7 | ··0x000f | 7 | ··0x000f5050·20566172·69616e74·2043616c·6c65720a··Variant·Caller. |
| 8 | ··0x000f | 8 | ··0x000f5060·0a000000·2a457272·6f722a20·2d207072·....*Error*·-·pr |
| 9 | ··0x000f | 9 | ··0x000f5070·6f626c65·6d207374·61727469·6e672074·oblem·starting·t |
| 10 | ··0x000f | 10 | ··0x000f5080·68726561·64000000·5b747663·5d204e6f·hread...[tvc]·No |
| 11 | ··0x000f | 11 | ··0x000f5090·726d616c·20746572·6d696e61·74696f6e·rmal·termination |
| 12 | ··0x000f | 12 | ··0x000f50a0·2e205072·6f636573·73696e67·2074696d·.·Processing·tim |
| 13 | ··0x000f | 13 | ··0x000f50b0·653a2000·62617369·635f7374·72696e67·e:·.basic_string |
| 14 | ··0x000f | 14 | ··0x000f50c0·3a3a6170·70656e64·005f6669·6c746572·::append._filter |
| 15 | ··0x000f | 15 | ··0x000f50d0·65642e76·63660000·4552524f·523a2043·ed.vcf..ERROR:·C |
| 16 | ··0x000f | 16 | ··0x000f50e0·616e6e6f·74206f70·656e206f·75747075·annot·open·outpu |
| 17 | ··0x000f | 17 | ··0x000f50f0·74207663·66206669·6c652000·4552524f·t·vcf·file·.ERRO |
| 18 | ··0x000f | 18 | ··0x000f5100·523a2043·616e6e6f·74206f70·656e2066·R:·Cannot·open·f |
| 19 | ··0x000f | 19 | ··0x000f5110·696c7465·72656420·76636620·66696c65·iltered·vcf·file |
| 20 | ··0x000f | 20 | ··0x000f5120·20007665·63746f72·3a3a5f4d·5f726561··.vector::_M_rea |
| 21 | ··0x000f | 21 | ··0x000f5130·6c6c6f63·5f696e73·65727400·4552524f·lloc_insert.ERRO |
| 22 | ··0x000f | 22 | ··0x000f5140·523a2043·616e6e6f·74206f70·656e2066·R:·Cannot·open·f |
| 23 | ··0x000f | 23 | ··0x000f5150·61737461·2066696c·65200000·4552524f·asta·file·..ERRO |
| 24 | ··0x000f | 24 | ··0x000f5160·523a2043·616e6e6f·74206f70·656e2066·R:·Cannot·open·f |
| 25 | ··0x000f | 25 | ··0x000f5170·61737461·20696e64·65782066·696c6520·asta·index·file· |
| 26 | ··0x000f | 26 | ··0x000f5180·002e6661·69002531·30323073·09256c64·..fai.%1020s.%ld |
| 27 | ··0x000f | 27 | ··0x000f5190·09256c64·09256409·2564002f·6465762f·.%ld.%d.%d./dev/ |
| 28 | ··0x000f | 28 | ··0x000f51a0·6e756c6c·002f7476·635f6d65·74726963·null./tvc_metric |
| 29 | ··0x000f | 29 | ··0x000f51b0·732e6a73·6f6e0020·7365636f·6e64732e·s.json.·seconds. |
| 30 | ··0x000f | 30 | ··0x000f51c0·00000000·0000c07f·62617369·635f7374·........basic_st |
| 31 | ··0x000f | 31 | ··0x000f51d0·72696e67·3a3a7375·62737472·005a4d00·ring::substr.ZM. |
| 32 | ··0x000f | 32 | ··0x000f51e0·5a500050·47004241·4d57616c·6b657245·ZP.PG.BAMWalkerE |
| 33 | ··0x000f | 33 | ··0x000f51f0·6e67696e·653a0020·73746172·743d0020·ngine:.·start=.· |
| 34 | ··0x000f | 34 | ··0x000f5200·696e5f6d·656d6f72·793d0020·64656c65·in_memory=.·dele |
| 35 | ··0x000f | 35 | ··0x000f5210·74656162·6c653d00·20726561·645f6168·teable=.·read_ah |
| 36 | ··0x000f | 36 | ··0x000f5220·6561643d·00207265·6379636c·653d0057·ead=.·recycle=.W |
| 37 | ··0x000f | 37 | ··0x000f5230·41524e49·4e473a20·56617269·616e7420·ARNING:·Variant· |
| 38 | ··0x000f | 38 | ··0x000f5240·004d6572·67656420·00206475·706c6963·.Merged·.·duplic |
| 39 | ··0x000f | 39 | ··0x000f5250·61746520·636f6d6d·656e7473·2e002020·ate·comments..·· |
| 40 | ··0x000f | 40 | ··0x000f5260·20202020·2042414d·20686173·20002063······BAM·has·.·c |
| 41 | ··0x000f | 41 | ··0x000f5270·68726f6d·6f736f6d·65732077·68696c65·hromosomes·while |
| 42 | ··0x000f | 42 | ··0x000f5280·20666173·74612068·61732000·20202020··fasta·has·.···· |
| 43 | ··0x000f | 43 | ··0x000f5290·20202043·68726f6d·6f736f6d·65202300····Chromosome·#. |
| 44 | ··0x000f | 44 | ··0x000f52a0·696e2042·414d2069·73200020·20202020·in·BAM·is·.····· |
| 45 | ··0x000f | 45 | ··0x000f52b0·20204368·726f6d6f·736f6d65·2000696e···Chromosome·.in |
| 46 | ··0x000f | 46 | ··0x000f52c0·2042414d·20686173·206c656e·67746820··BAM·has·length· |
| 47 | ··0x000f | 47 | ··0x000f52d0·00626300·746d6170·00000000·25733a20·.bc.tmap....%s:· |
| 48 | ··0x000f | 48 | ··0x000f52e0·5f5f706f·73202877·68696368·20697320·__pos·(which·is· |
| 49 | ··0x000f | 49 | ··0x000f52f0·257a7529·203e2074·6869732d·3e73697a·%zu)·>·this->siz |
| 50 | ··0x000f | 50 | ··0x000f5300·65282920·28776869·63682069·7320257a·e()·(which·is·%z |
| 51 | ··0x000f | 51 | ··0x000f5310·75290000·4552524f·523a2066·61696c65·u)..ERROR:·faile |
| 52 | ··0x000f | 52 | ··0x000f5320·6420746f·20616c6c·6f636174·65206d65·d·to·allocate·me |
| 53 | ··0x000f | 53 | ··0x000f5330·6d6f7279·20696e20·72656164·696e6720·mory·in·reading· |
| 54 | ··0x000f | 54 | ··0x000f5340·42414d20·696e2042·414d5761·6c6b6572·BAM·in·BAMWalker |
| 55 | ··0x000f | 55 | ··0x000f5350·456e6769·6e653a3a·52657175·65737452·Engine::RequestR |
| 56 | ··0x000f | 56 | ··0x000f5360·65616450·726f6365·7373696e·67546173·eadProcessingTas |
| 57 | ··0x000f | 57 | ··0x000f5370·6b000000·20686173·20756e65·78706563·k...·has·unexpec |
| 58 | ··0x000f | 58 | ··0x000f5380·74656420·70726f63·65737369·6e672074·ted·processing·t |
| 59 | ··0x000f | 59 | ··0x000f5390·696d6520·6f662000·4552524f·523a2043·ime·of·.ERROR:·C |
| 60 | ··0x000f | 60 | ··0x000f53a0·6f756c64·206e6f74·20736574·206d6572·ould·not·set·mer |
| 61 | ··0x000f | 61 | ··0x000f53b0·6765206f·72646572·20746f20·42616d4d·ge·order·to·BamM |
| 62 | ··0x000f | 62 | ··0x000f53c0·756c7469·52656164·65723a3a·4d657267·ultiReader::Merg |
| 63 | ··0x000f | 63 | ··0x000f53d0·65427943·6f6f7264·696e6174·65000000·eByCoordinate... |
| 64 | ··0x000f | 64 | ··0x000f53e0·4552524f·523a2043·6f756c64·206e6f74·ERROR:·Could·not |
| 65 | ··0x000f | 65 | ··0x000f53f0·206f7065·6e20696e·70757420·42414d20··open·input·BAM· |
| 66 | ··0x000f | 66 | ··0x000f5400·66696c65·28732920·3a200000·4552524f·file(s)·:·..ERRO |
| 67 | ··0x000f | 67 | ··0x000f5410·523a2043·6f756c64·206e6f74·206f7065·R:·Could·not·ope |
| 68 | ··0x000f | 68 | ··0x000f5420·6e204241·4d20696e·64657820·66696c65·n·BAM·index·file |
| 69 | ··0x000f | 69 | ··0x000f5430·28732920·3a200000·4552524f·523a2074·(s)·:·..ERROR:·t |
| 70 | ··0x000f | 70 | ··0x000f5440·68657265·20697320·6e6f2072·65616420·here·is·no·read· |
| 71 | ··0x000f | 71 | ··0x000f5450·67726f75·7020696e·2042414d·2066696c·group·in·BAM·fil |
| 72 | ··0x000f | 72 | ··0x000f5460·65732073·70656369·66696564·00000000·es·specified.... |
| 73 | ··0x000f | 73 | ··0x000f5470·76656374·6f723a3a·5f4d5f72·616e6765·vector::_M_range |
| 74 | ··0x000f | 74 | ··0x000f5480·5f636865·636b3a20·5f5f6e20·28776869·_check:·__n·(whi |
| 75 | ··0x000f | 75 | ··0x000f5490·63682069·7320257a·7529203e·3d207468·ch·is·%zu)·>=·th |
| 76 | ··0x000f | 76 | ··0x000f54a0·69732d3e·73697a65·28292028·77686963·is->size()·(whic |
| 77 | ··0x000f | 77 | ··0x000f54b0·68206973·20257a75·29000000·54564320·h·is·%zu)...TVC· |
| 78 | ··0x000f | 78 | ··0x000f54c0·4552524f·523a2046·61696c65·6420746f·ERROR:·Failed·to |
| 79 | ··0x000f | 79 | ··0x000f54d0·206f7065·6e20696e·70757420·42414d20··open·input·BAM· |
| 80 | ··0x000f | 80 | ··0x000f54e0·66696c65·20000000·20756e69·71756520·file·...·unique· |
| 81 | ··0x000f | 81 | ··0x000f54f0·636f6d6d·656e7420·6c696e65·7320696e·comment·lines·in |
| 82 | ··0x000f | 82 | ··0x000f5500·746f2063·6f6d6269·6e656420·42414d20·to·combined·BAM· |
| 83 | ··0x000f | 83 | ··0x000f5510·68656164·65722e20·456e636f·756e7465·header.·Encounte |
| 84 | ··0x000f | 84 | ··0x000f5520·72656420·00000000·4552524f·523a2052·red·....ERROR:·R |
| 85 | ··0x000f | 85 | ··0x000f5530·65666572·656e6365·20696e20·42414d20·eference·in·BAM· |
| 86 | ··0x000f | 86 | ··0x000f5540·66696c65·20646f65·73206e6f·74206d61·file·does·not·ma |
| 87 | ··0x000f | 87 | ··0x000f5550·74636820·66617374·61206669·6c650000·tch·fasta·file.. |
| 88 | ··0x000f | 88 | ··0x000f5560·4552524f·523a2043·6f756c64·206e6f74·ERROR:·Could·not |
| 89 | ··0x000f | 89 | ··0x000f5570·206f7065·6e20706f·73747072·6f636573··open·postproces |
| 90 | ··0x000f | 90 | ··0x000f5580·73656420·42414d20·66696c65·20666f72·sed·BAM·file·for |
| 91 | ··0x000f | 91 | ··0x000f5590·20777269·74696e67·203a2000·76656374··writing·:·.vect |
| 92 | ··0x000f | 92 | ··0x000f55a0·6f723a3a·5f4d5f64·65666175·6c745f61·or::_M_default_a |
| 93 | ··0x000f | 93 | ··0x000f55b0·7070656e·64000101·4552524f·523a2043·ppend...ERROR:·C |
| 94 | ··0x000f | 94 | ··0x000f55c0·6f756c64·6e277420·66696e64·20726561·ouldn't·find·rea |
| 95 | ··0x000f | 95 | ··0x000f55d0·64206772·6f757020·69642028·40524720·d·group·id·(@RG· |
| 96 | ··0x000f | 96 | ··0x000f55e0·74616729·20666f72·2042414d·20416c69·tag)·for·BAM·Ali |
| 97 | ··0x000f | 97 | ··0x000f55f0·676e6d65·6e742000·4552524f·523a204f·gnment·.ERROR:·O |
| 98 | ··0x000f | 98 | ··0x000f5600·6e65206f·66204241·4d207265·61642067·ne·of·BAM·read·g |
| 99 | ··0x000f | 99 | ··0x000f5610·726f7570·73206973·206d6973·73696e67·roups·is·missing |
| 100 | ··0x000f | 100 | ··0x000f5620·20494420·74616700·4552524f·523a206d··ID·tag.ERROR:·m |
| 101 | ··0x000f | 101 | ··0x000f5630·756c7469·706c6520·73616d70·6c657320·ultiple·samples· |
| 102 | ··0x000f | 102 | ··0x000f5640·28534d29·206d6170·20746f20·74686520·(SM)·map·to·the· |
| 103 | ··0x000f | 103 | ··0x000f5650·73616d65·20726561·64206772·6f757020·same·read·group· |
| 104 | ··0x000f | 104 | ··0x000f5660·28494429·00000000·4552524f·523a2042·(ID)....ERROR:·B |
| 105 | ··0x000f | 105 | ··0x000f5670·414d2066·696c6528·73292064·6f206e6f·AM·file(s)·do·no |
| 106 | ··0x000f | 106 | ··0x000f5680·74206861·76652061·6e792072·65616420·t·have·any·read· |
| 107 | ··0x000f | 107 | ··0x000f5690·67726f75·70206465·66696e69·74696f6e·group·definition |
| 108 | ··0x000f | 108 | ··0x000f56a0·73000000·4552524f·523a204d·756c7469·s...ERROR:·Multi |
| 109 | ··0x000f | 109 | ··0x000f56b0·706c6520·53616d70·6c657320·666f756e·ple·Samples·foun |
| 110 | ··0x000f | 110 | ··0x000f56c0·6420696e·2042414d·2066696c·652f7320·d·in·BAM·file/s· |
| 111 | ··0x000f | 111 | ··0x000f56d0·70726f76·69646564·2e20546f·7272656e·provided.·Torren |
| 112 | ··0x000f | 112 | ··0x000f56e0·74205661·7269616e·74204361·6c6c6572·t·Variant·Caller |
| 113 | ··0x000f | 113 | ··0x000f56f0·20637572·72656e74·6c792073·7570706f··currently·suppo |
| 114 | ··0x000f | 114 | ··0x000f5700·72747320·76617269·616e7420·63616c6c·rts·variant·call |
| 115 | ··0x000f | 115 | ··0x000f5710·696e6720·6f6e206f·6e6c7920·6f6e6520·ing·on·only·one· |
| 116 | ··0x000f | 116 | ··0x000f5720·73616d70·6c652e20·00000000·4552524f·sample.·....ERRO |
| 117 | ··0x000f | 117 | ··0x000f5730·523a2050·6c656173·65207365·6c656374·R:·Please·select |
| 118 | ··0x000f | 118 | ··0x000f5740·2073616d·706c6520·6e616d65·20746f20··sample·name·to· |
| 119 | ··0x000f | 119 | ··0x000f5750·70726f63·65737320·7573696e·67202d67·process·using·-g |
| 120 | ··0x000f | 120 | ··0x000f5760·20706172·616d6574·65722e20·00000000··parameter.·.... |
| 121 | ··0x000f | 121 | ··0x000f5770·6973206e·6f742061·73736f63·69617465·is·not·associate |
| 122 | ··0x000f | 122 | ··0x000f5780·64207769·74682061·6e792072·65616420·d·with·any·read· |
| 123 | ··0x000f | 123 | ··0x000f5790·67726f75·70732069·6e204241·4d206669·groups·in·BAM·fi |
| 124 | ··0x000f | 124 | ··0x000f57a0·6c652873·29000000·53616d70·6c654d61·le(s)...SampleMa |
| 125 | ··0x000f | 125 | ··0x000f57b0·6e616765·723a2041·6c6c2072·65616420·nager:·All·read· |
| Max diff block lines reached; 0/374706 bytes (0.00%) of diff not shown. | |||
| Offset 1, 750 lines modified | Offset 1, 762 lines modified | ||
| Diff chunk too large, falling back to line-by-line diff (759 lines added, 747 lines removed) | |||
| 1 | Hex·dump·of·section·'.eh_frame_hdr': | 1 | Hex·dump·of·section·'.eh_frame_hdr': |
| 2 | ··0x00 | 2 | ··0x00100384·011b033b·602f0000·eb050000·9cdcf1ff·...;`/.......... |
| 3 | ··0x000 | 3 | ··0x00100394·a82f0000·1cedf1ff·cc2f0000·2cedf1ff·./......./..,... |
| 4 | ··0x000 | 4 | ··0x001003a4·8c4c0000·7feef1ff·fc4c0000·beeef1ff·.L.......L...... |
| 5 | ··0x00 | 5 | ··0x001003b4·f84e0000·d2eef1ff·c04f0000·06eff1ff·.N.......O...... |
| 6 | ··0x00 | 6 | ··0x001003c4·60520000·92eff1ff·40590000·d2eff1ff·`R......@Y...... |
| 7 | ··0x00 | 7 | ··0x001003d4·2c5b0000·46f0f1ff·e4610000·5cf0f1ff·,[..F....a..\... |
| 8 | ··0x000 | 8 | ··0x001003e4·8c620000·22f1f1ff·cc630000·b6f1f1ff·.b.."....c...... |
| 9 | ··0x00 | 9 | ··0x001003f4·4c680000·f2f1f1ff·1c700000·18f2f1ff·Lh.......p...... |
| 10 | ··0x00 | 10 | ··0x00100404·38710000·4cf2f1ff·c8710000·62f2f1ff·8q..L....q..b... |
| 11 | ··0x00 | 11 | ··0x00100414·98730000·caf2f1ff·e4740000·10f3f1ff·.s.......t...... |
| 12 | ··0x00 | 12 | ··0x00100424·ec770000·d0f4f1ff·fc790000·88f5f1ff·.w.......y...... |
| 13 | ··0x00 | 13 | ··0x00100434·547a0000·bef5f1ff·d87a0000·e0f6f1ff·Tz.......z...... |
| 14 | ··0x00 | 14 | ··0x00100444·d4890000·dcf7f1ff·448a0000·8af8f1ff·........D....... |
| 15 | ··0x00 | 15 | ··0x00100454·c4920000·1ff9f1ff·2c930000·36f9f1ff·........,...6... |
| 16 | ··0x00 | 16 | ··0x00100464·f8990000·4ef9f1ff·109b0000·e0faf1ff·....N........... |
| 17 | ··0x00 | 17 | ··0x00100474·e09b0000·dcfbf1ff·d49d0000·e0fcf1ff·................ |
| 18 | ··0x00 | 18 | ··0x00100484·309e0000·28fdf1ff·6c9f0000·20fff1ff·0...(...l...·... |
| 19 | ··0x00 | 19 | ··0x00100494·e8a00000·3000f2ff·08a90000·4500f2ff·....0.......E... |
| 20 | ··0x00 | 20 | ··0x001004a4·a0aa0000·6200f2ff·0cab0000·7f00f2ff·....b........... |
| 21 | ··0x000 | 21 | ··0x001004b4·78ab0000·9c00f2ff·d4ab0000·ec01f2ff·x............... |
| 22 | ··0x00 | 22 | ··0x001004c4·38ac0000·3c03f2ff·94ac0000·e403f2ff·8...<........... |
| 23 | ··0x00 | 23 | ··0x001004d4·f0ac0000·4e04f2ff·8cad0000·da06f2ff·....N........... |
| 24 | ··0x000 | 24 | ··0x001004e4·e8ad0000·ce09f2ff·40ae0000·f809f2ff·........@....... |
| 25 | ··0x00 | 25 | ··0x001004f4·a0ae0000·b50af2ff·58af0000·cc0af2ff·........X....... |
| 26 | ··0x00 | 26 | ··0x00100504·ccaf0000·300bf2ff·30b00000·660bf2ff·....0...0...f... |
| 27 | ··0x00 | 27 | ··0x00100514·9cb00000·fa0bf2ff·74b10000·1a0df2ff·........t....... |
| 28 | ··0x00 | 28 | ··0x00100524·fcb10000·2e10f2ff·94be0000·6810f2ff·............h... |
| 29 | ··0x00 | 29 | ··0x00100534·94c30000·9c10f2ff·08c50000·1012f2ff·................ |
| 30 | ··0x00 | 30 | ··0x00100544·10c80000·e012f2ff·a0c90000·cc13f2ff·................ |
| 31 | ··0x00 | 31 | ··0x00100554·f8c90000·e213f2ff·5ccd0000·0715f2ff·........\....... |
| 32 | ··0x00 | 32 | ··0x00100564·f8cf0000·6c16f2ff·f0d10000·9f16f2ff·....l........... |
| 33 | ··0x00 | 33 | ··0x00100574·1cd40000·b316f2ff·74d40000·e116f2ff·........t....... |
| 34 | ··0x00 | 34 | ··0x00100584·ccd40000·f516f2ff·28d50000·0b17f2ff·........(....... |
| 35 | ··0x00 | 35 | ··0x00100594·80d50000·2117f2ff·d8d50000·3517f2ff·....!.......5... |
| 36 | ··0x00 | 36 | ··0x001005a4·34d60000·4618f2ff·74d70000·c21cf2ff·4...F...t....... |
| 37 | ··0x00 | 37 | ··0x001005b4·20d90000·f51cf2ff·a8d90000·881df2ff··............... |
| 38 | ··0x000 | 38 | ··0x001005c4·24da0000·211ef2ff·c8da0000·cf1ff2ff·$...!........... |
| 39 | ··0x00 | 39 | ··0x001005d4·34db0000·3920f2ff·8cdb0000·4d20f2ff·4...9·......M·.. |
| 40 | ··0x000 | 40 | ··0x001005e4·f0e00000·8620f2ff·34e30000·fe20f2ff·.....·..4....·.. |
| 41 | ··0x00 | 41 | ··0x001005f4·b8e30000·8a21f2ff·68e50000·a021f2ff·.....!..h....!.. |
| 42 | ··0x00 | 42 | ··0x00100604·d4e50000·da21f2ff·4ce60000·be22f2ff·.....!..L....".. |
| 43 | ··0x00 | 43 | ··0x00100614·00e70000·d422f2ff·a8f10000·4823f2ff·....."......H#.. |
| 44 | ··0x00 | 44 | ··0x00100624·48f30000·5c23f2ff·c0f30000·7023f2ff·H...\#......p#.. |
| 45 | ··0x00 | 45 | ··0x00100634·c8f40000·8423f2ff·48f50000·9823f2ff·.....#..H....#.. |
| 46 | ··0x00 | 46 | ··0x00100644·c8f60000·c423f2ff·0cf90000·da23f2ff·.....#.......#.. |
| 47 | ··0x00 | 47 | ··0x00100654·a0fc0000·fe24f2ff·18fd0000·2625f2ff·.....$......&%.. |
| 48 | ··0x00 | 48 | ··0x00100664·18ff0000·9625f2ff·bc010100·ab25f2ff·.....%.......%.. |
| 49 | ··0x00 | 49 | ··0x00100674·40020100·0426f2ff·98020100·1926f2ff·@....&.......&.. |
| 50 | ··0x00 | 50 | ··0x00100684·04030100·4226f2ff·94030100·e626f2ff·....B&.......&.. |
| 51 | ··0x00 | 51 | ··0x00100694·ec030100·fa26f2ff·1c050100·2427f2ff·.....&......$'.. |
| 52 | ··0x00 | 52 | ··0x001006a4·84050100·f327f2ff·dc050100·3628f2ff·.....'......6(.. |
| 53 | ··0x00 | 53 | ··0x001006b4·50060100·a429f2ff·b8060100·b829f2ff·P....).......).. |
| 54 | ··0x00 | 54 | ··0x001006c4·44070100·1a2bf2ff·b0070100·b02bf2ff·D....+.......+.. |
| 55 | ··0x000 | 55 | ··0x001006d4·700b0100·042cf2ff·e00b0100·822cf2ff·p....,.......,.. |
| 56 | ··0x000 | 56 | ··0x001006e4·3c0c0100·d82cf2ff·ac0c0100·f42df2ff·<....,.......-.. |
| 57 | ··0x00 | 57 | ··0x001006f4·580d0100·7230f2ff·c40d0100·fe30f2ff·X...r0.......0.. |
| 58 | ··0x00 | 58 | ··0x00100704·200e0100·7631f2ff·780e0100·9631f2ff··...v1..x....1.. |
| 59 | ··0x00 | 59 | ··0x00100714·d80e0100·da31f2ff·700f0100·1a32f2ff·.....1..p....2.. |
| 60 | ··0x00 | 60 | ··0x00100724·d00f0100·6c32f2ff·90100100·9432f2ff·....l2.......2.. |
| 61 | ··0x00 | 61 | ··0x00100734·9c120100·6033f2ff·401f0100·0a34f2ff·....`3..@....4.. |
| 62 | ··0x00 | 62 | ··0x00100744·54210100·2034f2ff·38270100·4e34f2ff·T!..·4..8'..N4.. |
| 63 | ··0x00 | 63 | ··0x00100754·28280100·b734f2ff·80280100·b335f2ff·((...4...(...5.. |
| 64 | ··0x00 | 64 | ··0x00100764·d8280100·2f37f2ff·30290100·7f37f2ff·.(../7..0)...7.. |
| 65 | ··0x00 | 65 | ··0x00100774·4c2a0100·a937f2ff·a42a0100·be37f2ff·L*...7...*...7.. |
| 66 | ··0x00 | 66 | ··0x00100784·fc2a0100·e837f2ff·542b0100·3838f2ff·.*...7..T+..88.. |
| 67 | ··0x00 | 67 | ··0x00100794·ac2b0100·4d38f2ff·0c2c0100·e738f2ff·.+..M8...,...8.. |
| 68 | ··0x00 | 68 | ··0x001007a4·742c0100·f139f2ff·dc2c0100·0d3bf2ff·t,...9...,...;.. |
| 69 | ··0x00 | 69 | ··0x001007b4·442d0100·463bf2ff·68430100·803bf2ff·D-..F;..hC...;.. |
| 70 | ··0x00 | 70 | ··0x001007c4·f0430100·943bf2ff·2c450100·aa3bf2ff·.C...;..,E...;.. |
| 71 | ··0x00 | 71 | ··0x001007d4·84450100·c63bf2ff·e0450100·0c3cf2ff·.E...;...E...<.. |
| 72 | ··0x000 | 72 | ··0x001007e4·64520100·403cf2ff·bc520100·743cf2ff·dR..@<...R..t<.. |
| 73 | ··0x00 | 73 | ··0x001007f4·84530100·263df2ff·3c540100·3c3df2ff·.S..&=..<T..<=.. |
| 74 | ··0x00 | 74 | ··0x00100804·14550100·543df2ff·a05a0100·723df2ff·.U..T=...Z..r=.. |
| 75 | ··0x00 | 75 | ··0x00100814·fc5a0100·dc3df2ff·cc5b0100·753ef2ff·.Z...=...[..u>.. |
| 76 | ··0x00 | 76 | ··0x00100824·f45b0100·ab3ef2ff·1c5c0100·6440f2ff·.[...>...\..d@.. |
| 77 | ··0x00 | 77 | ··0x00100834·f05f0100·8f40f2ff·4c640100·2f41f2ff·._...@..Ld../A.. |
| 78 | ··0x00 | 78 | ··0x00100844·74640100·cd41f2ff·9c640100·e642f2ff·td...A...d...B.. |
| 79 | ··0x00 | 79 | ··0x00100854·7c690100·e843f2ff·946a0100·3e47f2ff·|i...C...j..>G.. |
| 80 | ··0x00 | 80 | ··0x00100864·886c0100·7648f2ff·405c0100·c049f2ff·.l..vH..@\...I.. |
| 81 | ··0x00 | 81 | ··0x00100874·646b0100·f249f2ff·ac6b0100·1a4af2ff·dk...I...k...J.. |
| 82 | ··0x00 | 82 | ··0x00100884·ac740100·4b4af2ff·dc7d0100·de4af2ff·.t..KJ...}...J.. |
| 83 | ··0x00 | 83 | ··0x00100894·d87e0100·144bf2ff·387f0100·4a4bf2ff·.~...K..8...JK.. |
| 84 | ··0x00 | 84 | ··0x001008a4·60800100·044cf2ff·78810100·1a4cf2ff·`....L..x....L.. |
| 85 | ··0x00 | 85 | ··0x001008b4·d0830100·484cf2ff·30840100·764cf2ff·....HL..0...vL.. |
| 86 | ··0x00 | 86 | ··0x001008c4·c4850100·964cf2ff·20860100·be4cf2ff·.....L..·....L.. |
| 87 | ··0x00 | 87 | ··0x001008d4·38880100·f54cf2ff·90880100·2b4df2ff·8....L......+M.. |
| 88 | ··0x000 | 88 | ··0x001008e4·f0880100·7a4df2ff·50890100·c54df2ff·....zM..P....M.. |
| 89 | ··0x000 | 89 | ··0x001008f4·2c8f0100·4a4ef2ff·10900100·a24ef2ff·,...JN.......N.. |
| 90 | ··0x00 | 90 | ··0x00100904·70900100·c64ef2ff·14910100·f84ef2ff·p....N.......N.. |
| 91 | ··0x00 | 91 | ··0x00100914·b4950100·2c4ff2ff·10970100·5e4ff2ff·....,O......^O.. |
| 92 | ··0x00 | 92 | ··0x00100924·58990100·0a50f2ff·189d0100·3c50f2ff·X....P......<P.. |
| 93 | ··0x00 | 93 | ··0x00100934·8c9d0100·de51f2ff·f49d0100·1452f2ff·.....Q.......R.. |
| 94 | ··0x00 | 94 | ··0x00100944·fc9f0100·f052f2ff·dca00100·2253f2ff·.....R......"S.. |
| 95 | ··0x00 | 95 | ··0x00100954·18a20100·c657f2ff·a8a30100·f557f2ff·.....W.......W.. |
| 96 | ··0x00 | 96 | ··0x00100964·98a50100·7358f2ff·40a60100·9758f2ff·....sX..@....X.. |
| 97 | ··0x00 | 97 | ··0x00100974·14a70100·1059f2ff·6ca70100·8a59f2ff·.....Y..l....Y.. |
| 98 | ··0x00 | 98 | ··0x00100984·c4a70100·a859f2ff·1ca80100·bc59f2ff·.....Y.......Y.. |
| 99 | ··0x00 | 99 | ··0x00100994·74a80100·fa59f2ff·48a90100·ca5af2ff·t....Y..H....Z.. |
| 100 | ··0x00 | 100 | ··0x001009a4·a0a90100·ef5af2ff·80ab0100·3c5bf2ff·.....Z......<[.. |
| 101 | ··0x00 | 101 | ··0x001009b4·18ac0100·315cf2ff·e8ad0100·025df2ff·....1\.......].. |
| 102 | ··0x00 | 102 | ··0x001009c4·40ae0100·405df2ff·50af0100·435ff2ff·@...@]..P...C_.. |
| 103 | ··0x00 | 103 | ··0x001009d4·74b00100·575ff2ff·fcb00100·795ff2ff·t...W_......y_.. |
| 104 | ··0x000 | 104 | ··0x001009e4·58b10100·9e5ff2ff·80b20100·c65ff2ff·X...._......._.. |
| 105 | ··0x00 | 105 | ··0x001009f4·2cb30100·dc5ff2ff·bcd70100·0e60f2ff·,...._.......`.. |
| 106 | ··0x000 | 106 | ··0x00100a04·d0d80100·9660f2ff·d8e20100·0861f2ff·.....`.......a.. |
| 107 | ··0x00 | 107 | ··0x00100a14·fce60100·4461f2ff·b8e70100·5e61f2ff·....Da......^a.. |
| 108 | ··0x00 | 108 | ··0x00100a24·1ce80100·1c62f2ff·04eb0100·5062f2ff·.....b......Pb.. |
| 109 | ··0x00 | 109 | ··0x00100a34·54ec0100·2668f2ff·9ced0100·3e6bf2ff·T...&h......>k.. |
| 110 | ··0x00 | 110 | ··0x00100a44·00fa0100·fe6bf2ff·fc040200·146cf2ff·.....k.......l.. |
| 111 | ··0x00 | 111 | ··0x00100a54·b8060200·2c6df2ff·3c070200·446df2ff·....,m..<...Dm.. |
| 112 | ··0x00 | 112 | ··0x00100a64·a4080200·766df2ff·b0090200·286ef2ff·....vm......(n.. |
| 113 | ··0x00 | 113 | ··0x00100a74·800b0200·966ef2ff·e40e0200·bc6ef2ff·.....n.......n.. |
| 114 | ··0x00 | 114 | ··0x00100a84·50170200·5472f2ff·a8170200·7872f2ff·P...Tr......xr.. |
| 115 | ··0x00 | 115 | ··0x00100a94·ac1c0200·9272f2ff·0c1d0200·ac72f2ff·.....r.......r.. |
| 116 | ··0x00 | 116 | ··0x00100aa4·d81d0200·2073f2ff·f41f0200·7473f2ff·....·s......ts.. |
| 117 | ··0x00 | 117 | ··0x00100ab4·5c200200·8a73f2ff·c4200200·4074f2ff·\·...s...·..@t.. |
| 118 | ··0x00 | 118 | ··0x00100ac4·38210200·d175f2ff·84240200·8c77f2ff·8!...u...$...w.. |
| 119 | ··0x00 | 119 | ··0x00100ad4·6c260200·3e78f2ff·90280200·8c78f2ff·l&..>x...(...x.. |
| 120 | ··0x000 | 120 | ··0x00100ae4·bc2a0200·4c79f2ff·1c2b0200·9a79f2ff·.*..Ly...+...y.. |
| 121 | ··0x00 | 121 | ··0x00100af4·042c0200·f679f2ff·f02c0200·3c7af2ff·.,...y...,..<z.. |
| 122 | ··0x000 | 122 | ··0x00100b04·682d0200·ea7af2ff·c42d0200·287bf2ff·h-...z...-..({.. |
| 123 | ··0x000 | 123 | ··0x00100b14·282e0200·7c7bf2ff·882e0200·ec7bf2ff·(...|{.......{.. |
| 124 | ··0x000 | 124 | ··0x00100b24·e82e0200·607cf2ff·502f0200·9c7cf2ff·....`|..P/...|.. |
| 125 | ··0x000 | 125 | ··0x00100b34·b82f0200·d87cf2ff·24300200·5e7df2ff·./...|..$0..^}.. |
| Max diff block lines reached; 0/100940 bytes (0.00%) of diff not shown. | |||
| Offset 1, 8759 lines modified | Offset 1, 8917 lines modified | ||
| Diff chunk too large, falling back to line-by-line diff (8914 lines added, 8756 lines removed) | |||
| 1 | Hex·dump·of·section·'.eh_frame': | 1 | Hex·dump·of·section·'.eh_frame': |
| 2 | ··0x00 | 2 | ··0x001032e8·14000000·00000000·017a5200·017c0801·.........zR..|.. |
| 3 | ··0x00 | 3 | ··0x001032f8·1b0c0404·88010708·10000000·1c000000·................ |
| 4 | ··0x00 | 4 | ··0x00103308·a87ef2ff·2c000000·00000000·14000000·.~..,........... |
| 5 | ··0x00 | 5 | ··0x00103318·00000000·017a5200·017c0801·1b0c0404·.....zR..|...... |
| 6 | ··0x00 | 6 | ··0x00103328·88010000·20000000·1c000000·ecacf1ff·....·........... |
| 7 | ··0x00 | 7 | ··0x00103338·80100000·000e0846·0e0c4a0f·0b740478·.......F..J..t.x |
| 8 | ··0x00 | 8 | ··0x00103348·003f1a3b·2a322422·10000000·40000000·.?.;*2$"....@... |
| 9 | ··0x00 | 9 | ··0x00103358·48bdf1ff·08000000·00000000·10000000·H............... |
| 10 | ··0x00 | 10 | ··0x00103368·54000000·b49ff2ff·06000000·00000000·T............... |
| 11 | ··0x00 | 11 | ··0x00103378·4c000000·68000000·607ff2ff·75000000·L...h...`...u... |
| 12 | ··0x00 | 12 | ··0x00103388·00410e08·8702410e·0c860343·0e108304·.A....A....C.... |
| 13 | ··0x000 | 13 | ··0x00103398·650e1841·0e1c410e·20500e10·410ac30e·e..A..A.·P..A... |
| 14 | ··0x00 | 14 | ··0x001033a8·0c41c60e·0841c70e·04410b43·0e1c410e·.A...A...A.C..A. |
| 15 | ··0x00 | 15 | ··0x001033b8·20500e10·4f0e1842·0e1c410e·20480e10··P..O..B..A.·H.. |
| 16 | ··0x00 | 16 | ··0x001033c8·a4000000·b8000000·907ff2ff·63020000·............c... |
| 17 | ··0x000 | 17 | ··0x001033d8·00410e08·8502410e·0c870343·0e108604·.A....A....C.... |
| 18 | ··0x00 | 18 | ··0x001033e8·430e1483·054e0e30·5c0a0e14·41c30e10·C....N.0\...A... |
| 19 | ··0x00 | 19 | ··0x001033f8·41c60e0c·41c70e08·41c50e04·4a0b0257·A...A...A...J..W |
| 20 | ··0x00 | 20 | ··0x00103408·0e3c450e·404b0e30·710a0e14·41c30e10·.<E.@K.0q...A... |
| 21 | ··0x00 | 21 | ··0x00103418·41c60e0c·41c70e08·41c50e04·440b760e·A...A...A...D.v. |
| 22 | ··0x00 | 22 | ··0x00103428·3c410e40·540e3057·0e34430e·38410e3c·<A.@T.0W.4C.8A.< |
| 23 | ··0x00 | 23 | ··0x00103438·410e4050·0e304a0e·38440e3c·420e404f·A.@P.0J.8D.<B.@O |
| 24 | ··0x00 | 24 | ··0x00103448·0e30026b·0e34410e·38410e3c·410e404c·.0.k.4A.8A.<A.@L |
| 25 | ··0x00 | 25 | ··0x00103458·0e305f0e·34410e38·410e3c51·0e40480e·.0_.4A.8A.<Q.@H. |
| 26 | ··0x00 | 26 | ··0x00103468·306d0e3c·470e4000·58000000·60010000·0m.<G.@.X...`... |
| 27 | ··0x00 | 27 | ··0x00103478·5881f2ff·a7000000·00410e08·8502450e·X........A....E. |
| 28 | ··0x00 | 28 | ··0x00103488·0c870343·0e108604·430e1483·054e0e30·...C....C....N.0 |
| 29 | ··0x00 | 29 | ··0x00103498·7e0a0e14·41c30e10·41c60e0c·41c70e08·~...A...A...A... |
| 30 | ··0x000 | 30 | ··0x001034a8·41c50e04·440b530e·34420e38·450e3c41·A...D.S.4B.8E.<A |
| 31 | ··0x00 | 31 | ··0x001034b8·0e404c0e·30480e34·410e3841·0e3c410e·.@L.0H.4A.8A.<A. |
| 32 | ··0x00 | 32 | ··0x001034c8·404e0e30·a4000000·bc010000·5c9ef2ff·@N.0........\... |
| 33 | ··0x000 | 33 | ··0x001034d8·be010000·00410e08·8502430e·0c870341·.....A....C....A |
| 34 | ··0x00 | 34 | ··0x001034e8·0e108604·410e1483·054e0e40·027d0e48·....A....N.@.}.H |
| 35 | ··0x00 | 35 | ··0x001034f8·470e4c41·0e50480e·404b0e48·450e4c41·G.LA.PH.@K.HE.LA |
| 36 | ··0x00 | 36 | ··0x00103508·0e50480e·404b0e48·450e4c41·0e50480e·.PH.@K.HE.LA.PH. |
| 37 | ··0x00 | 37 | ··0x00103518·405b0e48·460e4c41·0e504c0e·40550e48·@[.HF.LA.PL.@U.H |
| 38 | ··0x00 | 38 | ··0x00103528·460e4c41·0e504c0e·40540e48·450e4c41·F.LA.PL.@T.HE.LA |
| 39 | ··0x00 | 39 | ··0x00103538·0e50480e·40540e48·450e4c41·0e50480e·.PH.@T.HE.LA.PH. |
| 40 | ··0x00 | 40 | ··0x00103548·40540e48·450e4c41·0e50480e·404e0e48·@T.HE.LA.PH.@N.H |
| 41 | ··0x00 | 41 | ··0x00103558·450e4c41·0e50480e·404e0e14·41c30e10·E.LA.PH.@N..A... |
| 42 | ··0x00 | 42 | ··0x00103568·41c60e0c·41c70e08·41c50e04·68000000·A...A...A...h... |
| 43 | ··0x00 | 43 | ··0x00103578·64020000·0481f2ff·bc000000·00410e08·d............A.. |
| 44 | ··0x00 | 44 | ··0x00103588·8502410e·0c870341·0e108604·410e1483·..A....A....A... |
| 45 | ··0x00 | 45 | ··0x00103598·054e0e30·7e0e3844·0e3c410e·40480e30·.N.0~.8D.<A.@H.0 |
| 46 | ··0x00 | 46 | ··0x001035a8·540e3843·0e3c410e·40480e30·500e3844·T.8C.<A.@H.0P.8D |
| 47 | ··0x000 | 47 | ··0x001035b8·0e3c410e·40480e30·430e3842·0e3c410e·.<A.@H.0C.8B.<A. |
| 48 | ··0x00 | 48 | ··0x001035c8·404c0e30·4b0e1441·c30e1041·c60e0c41·@L.0K..A...A...A |
| 49 | ··0x000 | 49 | ··0x001035d8·c70e0841·c50e0400·80000000·d0020000·...A............ |
| 50 | ··0x00 | 50 | ··0x001035e8·5881f2ff·26010000·00410e08·8502410e·X...&....A....A. |
| 51 | ··0x00 | 51 | ··0x001035f8·0c870341·0e108604·410e1483·054e0e30·...A....A....N.0 |
| 52 | ··0x00 | 52 | ··0x00103608·025d0e38·440e3c41·0e40480e·30580e38·.].8D.<A.@H.0X.8 |
| 53 | ··0x00 | 53 | ··0x00103618·470e3c41·0e404c0e·30500e38·480e3c41·G.<A.@L.0P.8H.<A |
| 54 | ··0x00 | 54 | ··0x00103628·0e404c0e·30430e38·420e3c41·0e40480e·.@L.0C.8B.<A.@H. |
| 55 | ··0x00 | 55 | ··0x00103638·30600e38·440e3c41·0e40480e·30430e38·0`.8D.<A.@H.0C.8 |
| 56 | ··0x00 | 56 | ··0x00103648·420e3c41·0e40480e·304b0e14·41c30e10·B.<A.@H.0K..A... |
| 57 | ··0x00 | 57 | ··0x00103658·41c60e0c·41c70e08·41c50e04·a4000000·A...A...A....... |
| 58 | ··0x00 | 58 | ··0x00103668·54030000·849ef2ff·60010000·00410e08·T.......`....A.. |
| 59 | ··0x00 | 59 | ··0x00103678·8502410e·0c870341·0e108604·410e1483·..A....A....A... |
| 60 | ··0x00 | 60 | ··0x00103688·054e0e30·7a0e3844·0e3c410e·40480e30·.N.0z.8D.<A.@H.0 |
| 61 | ··0x00 | 61 | ··0x00103698·560e3844·0e3c410e·40480e30·500e3844·V.8D.<A.@H.0P.8D |
| 62 | ··0x00 | 62 | ··0x001036a8·0e3c410e·40480e30·5e0e3844·0e3c410e·.<A.@H.0^.8D.<A. |
| 63 | ··0x00 | 63 | ··0x001036b8·40480e30·540e3843·0e3c410e·40480e30·@H.0T.8C.<A.@H.0 |
| 64 | ··0x000 | 64 | ··0x001036c8·500e3844·0e3c410e·40480e30·500e3844·P.8D.<A.@H.0P.8D |
| 65 | ··0x000 | 65 | ··0x001036d8·0e3c410e·40480e30·500e3844·0e3c410e·.<A.@H.0P.8D.<A. |
| 66 | ··0x00 | 66 | ··0x001036e8·40480e30·430e3845·0e3c410e·404c0e30·@H.0C.8E.<A.@L.0 |
| 67 | ··0x00 | 67 | ··0x001036f8·4b0e1441·c30e1041·c60e0c41·c70e0841·K..A...A...A...A |
| 68 | ··0x00 | 68 | ··0x00103708·c50e0400·1c010000·fc030000·3c9ff2ff·............<... |
| 69 | ··0x00 | 69 | ··0x00103718·69030000·00410e08·8502410e·0c870341·i....A....A....A |
| 70 | ··0x00 | 70 | ··0x00103728·0e108604·410e1483·054e0e40·700e4844·....A....N.@p.HD |
| 71 | ··0x00 | 71 | ··0x00103738·0e4c410e·50480e40·02550e48·430e4c41·.LA.PH.@.U.HC.LA |
| 72 | ··0x00 | 72 | ··0x00103748·0e50480e·40530e48·430e4c41·0e50480e·.PH.@S.HC.LA.PH. |
| 73 | ··0x00 | 73 | ··0x00103758·405a0e48·430e4c41·0e50480e·40770e48·@Z.HC.LA.PH.@w.H |
| 74 | ··0x00 | 74 | ··0x00103768·430e4c41·0e50480e·40530e48·430e4c41·C.LA.PH.@S.HC.LA |
| 75 | ··0x00 | 75 | ··0x00103778·0e50480e·405a0e48·430e4c41·0e50480e·.PH.@Z.HC.LA.PH. |
| 76 | ··0x00 | 76 | ··0x00103788·406f0e48·430e4c41·0e50480e·40530e48·@o.HC.LA.PH.@S.H |
| 77 | ··0x00 | 77 | ··0x00103798·430e4c41·0e50480e·405a0e48·430e4c41·C.LA.PH.@Z.HC.LA |
| 78 | ··0x00 | 78 | ··0x001037a8·0e50480e·406f0e48·430e4c41·0e50480e·.PH.@o.HC.LA.PH. |
| 79 | ··0x00 | 79 | ··0x001037b8·40530e48·430e4c41·0e50480e·405a0e48·@S.HC.LA.PH.@Z.H |
| 80 | ··0x00 | 80 | ··0x001037c8·430e4c41·0e50480e·406f0e48·430e4c41·C.LA.PH.@o.HC.LA |
| 81 | ··0x000 | 81 | ··0x001037d8·0e50480e·40530e48·430e4c41·0e50480e·.PH.@S.HC.LA.PH. |
| 82 | ··0x00 | 82 | ··0x001037e8·405a0e48·430e4c41·0e50480e·40620e48·@Z.HC.LA.PH.@b.H |
| 83 | ··0x00 | 83 | ··0x001037f8·430e4c41·0e50480e·40500e48·440e4c41·C.LA.PH.@P.HD.LA |
| 84 | ··0x00 | 84 | ··0x00103808·0e50480e·40430e48·450e4c41·0e50480e·.PH.@C.HE.LA.PH. |
| 85 | ··0x00 | 85 | ··0x00103818·404b0e14·41c30e10·41c60e0c·41c70e08·@K..A...A...A... |
| 86 | ··0x00 | 86 | ··0x00103828·41c50e04·10010000·1c050000·3c80f2ff·A...........<... |
| 87 | ··0x00 | 87 | ··0x00103838·cc020000·00410e08·8502410e·0c870341·.....A....A....A |
| 88 | ··0x00 | 88 | ··0x00103848·0e108604·430e1483·054e0e40·02950e48·....C....N.@...H |
| 89 | ··0x00 | 89 | ··0x00103858·480e4c41·0e504c0e·40430e48·420e4c41·H.LA.PL.@C.HB.LA |
| 90 | ··0x00 | 90 | ··0x00103868·0e50480e·40570e48·440e4c41·0e50480e·.PH.@W.HD.LA.PH. |
| 91 | ··0x00 | 91 | ··0x00103878·40430e48·420e4c41·0e50480e·405e0e48·@C.HB.LA.PH.@^.H |
| 92 | ··0x00 | 92 | ··0x00103888·440e4c41·0e50480e·40430e48·420e4c41·D.LA.PH.@C.HB.LA |
| 93 | ··0x00 | 93 | ··0x00103898·0e50480e·40700e48·440e4c41·0e50480e·.PH.@p.HD.LA.PH. |
| 94 | ··0x00 | 94 | ··0x001038a8·40430e48·420e4c41·0e50480e·40650e48·@C.HB.LA.PH.@e.H |
| 95 | ··0x00 | 95 | ··0x001038b8·440e4c41·0e50480e·40430e48·420e4c41·D.LA.PH.@C.HB.LA |
| 96 | ··0x00 | 96 | ··0x001038c8·0e50480e·406a0e48·440e4c41·0e50480e·.PH.@j.HD.LA.PH. |
| 97 | ··0x000 | 97 | ··0x001038d8·40430e48·420e4c41·0e50480e·405f0e48·@C.HB.LA.PH.@_.H |
| 98 | ··0x000 | 98 | ··0x001038e8·440e4c41·0e50480e·40430e48·420e4c41·D.LA.PH.@C.HB.LA |
| 99 | ··0x00 | 99 | ··0x001038f8·0e50480e·40640e48·440e4c41·0e50480e·.PH.@d.HD.LA.PH. |
| 100 | ··0x00 | 100 | ··0x00103908·40430e48·420e4c41·0e50480e·405e0e48·@C.HB.LA.PH.@^.H |
| 101 | ··0x00 | 101 | ··0x00103918·440e4c41·0e50480e·40430e48·420e4c41·D.LA.PH.@C.HB.LA |
| 102 | ··0x00 | 102 | ··0x00103928·0e50480e·404e0e14·41c30e10·41c60e0c·.PH.@N..A...A... |
| 103 | ··0x00 | 103 | ··0x00103938·41c70e08·41c50e04·10010000·30060000·A...A.......0... |
| 104 | ··0x00 | 104 | ··0x00103948·78a0f2ff·cc020000·00410e08·8502410e·x........A....A. |
| 105 | ··0x00 | 105 | ··0x00103958·0c870341·0e108604·430e1483·054e0e40·...A....C....N.@ |
| 106 | ··0x00 | 106 | ··0x00103968·02950e48·480e4c41·0e504c0e·40430e48·...HH.LA.PL.@C.H |
| 107 | ··0x00 | 107 | ··0x00103978·420e4c41·0e50480e·40570e48·440e4c41·B.LA.PH.@W.HD.LA |
| 108 | ··0x00 | 108 | ··0x00103988·0e50480e·40430e48·420e4c41·0e50480e·.PH.@C.HB.LA.PH. |
| 109 | ··0x00 | 109 | ··0x00103998·405e0e48·440e4c41·0e50480e·40430e48·@^.HD.LA.PH.@C.H |
| 110 | ··0x00 | 110 | ··0x001039a8·420e4c41·0e50480e·40700e48·440e4c41·B.LA.PH.@p.HD.LA |
| 111 | ··0x00 | 111 | ··0x001039b8·0e50480e·40430e48·420e4c41·0e50480e·.PH.@C.HB.LA.PH. |
| 112 | ··0x00 | 112 | ··0x001039c8·40650e48·440e4c41·0e50480e·40430e48·@e.HD.LA.PH.@C.H |
| 113 | ··0x000 | 113 | ··0x001039d8·420e4c41·0e50480e·406a0e48·440e4c41·B.LA.PH.@j.HD.LA |
| 114 | ··0x00 | 114 | ··0x001039e8·0e50480e·40430e48·420e4c41·0e50480e·.PH.@C.HB.LA.PH. |
| 115 | ··0x000 | 115 | ··0x001039f8·405f0e48·440e4c41·0e50480e·40430e48·@_.HD.LA.PH.@C.H |
| 116 | ··0x00 | 116 | ··0x00103a08·420e4c41·0e50480e·40640e48·440e4c41·B.LA.PH.@d.HD.LA |
| 117 | ··0x00 | 117 | ··0x00103a18·0e50480e·40430e48·420e4c41·0e50480e·.PH.@C.HB.LA.PH. |
| 118 | ··0x00 | 118 | ··0x00103a28·405e0e48·440e4c41·0e50480e·40430e48·@^.HD.LA.PH.@C.H |
| 119 | ··0x00 | 119 | ··0x00103a38·420e4c41·0e50480e·404e0e14·41c30e10·B.LA.PH.@N..A... |
| 120 | ··0x00 | 120 | ··0x00103a48·41c60e0c·41c70e08·41c50e04·10010000·A...A...A....... |
| 121 | ··0x00 | 121 | ··0x00103a58·44070000·e480f2ff·cc020000·00410e08·D............A.. |
| 122 | ··0x00 | 122 | ··0x00103a68·8502410e·0c870341·0e108604·430e1483·..A....A....C... |
| 123 | ··0x00 | 123 | ··0x00103a78·054e0e40·02950e48·480e4c41·0e504c0e·.N.@...HH.LA.PL. |
| 124 | ··0x00 | 124 | ··0x00103a88·40430e48·420e4c41·0e50480e·40570e48·@C.HB.LA.PH.@W.H |
| 125 | ··0x00 | 125 | ··0x00103a98·440e4c41·0e50480e·40430e48·420e4c41·D.LA.PH.@C.HB.LA |
| Max diff block lines reached; 0/1183938 bytes (0.00%) of diff not shown. | |||
| Offset 1, 1455 lines modified | Offset 1, 1463 lines modified | ||
| Diff chunk too large, falling back to line-by-line diff (1460 lines added, 1452 lines removed) | |||
| 1 | Hex·dump·of·section·'.gcc_except_table': | 1 | Hex·dump·of·section·'.gcc_except_table': |
| 2 | ··0x001 | 2 | ··0x00126008·ff9b0d01·057405ca·07010100·00000000·.....t.......... |
| 3 | ··0x001 | 3 | ··0x00126018·ffff0100·ffff0132·ba028202·880b00c5·.......2........ |
| 4 | ··0x001 | 4 | ··0x00126028·04a3018c·0b00cc06·05880b00·8407688c·..............h. |
| 5 | ··0x001 | 5 | ··0x00126038·0b008908·dd02880b·00e80a0a·8c0b00fe·................ |
| 6 | ··0x001 | 6 | ··0x00126048·0a05880b·00ae0b05·0000ffff·010d2a05·..............*. |
| 7 | ··0x001 | 7 | ··0x00126058·00005123·74008601·05000000·ff9b2101·..Q#t.........!. |
| 8 | ··0x001 | 8 | ··0x00126068·16900105·9b0601dd·053e0000·c60605e5·.........>...... |
| 9 | ··0x001 | 9 | ··0x00126078·0600f406·05000001·00000000·00000000·................ |
| 10 | ··0x001 | 10 | ··0x00126088·ff9b2501·1a420500·007305dc·01019002·..%..B...s...... |
| 11 | ··0x001 | 11 | ··0x00126098·05950203·c20205c7·0200d502·05000001·................ |
| 12 | ··0x001 | 12 | ··0x001260a8·00007d00·00000000·ff9b2901·1f3e0500·..}.......)..>.. |
| 13 | ··0x001 | 13 | ··0x001260b8·00730595·02018202·130000cd·0205d202·.s.............. |
| 14 | ··0x001 | 14 | ··0x001260c8·038b0305·9003009e·03050000·0100007d·...............} |
| 15 | ··0x001 | 15 | ··0x001260d8·00000000·ff9b2501·1c920105·0000bb01·......%......... |
| 16 | ··0x001 | 16 | ··0x001260e8·05e70501·9303d402·00008806·058d0600·................ |
| 17 | ··0x001 | 17 | ··0x001260f8·9b060500·00010000·00000000·ff9b5501·..............U. |
| 18 | ··0x001 | 18 | ··0x00126108·4a557d00·00fe0105·8a180092·02558618·JU}..........U.. |
| 19 | ··0x001 | 19 | ··0x00126118·00990583·059f1700·c40a059d·1701940d·................ |
| 20 | ··0x001 | 20 | ··0x00126128·059f1700·b70d0586·1800ca11·050000c4·................ |
| 21 | ··0x001 | 21 | ··0x00126138·15058a18·00de1548·0000c516·4e861800·.......H....N... |
| 22 | ··0x001 | 22 | ··0x00126148·bf170582·1800fd17·05000001·00000000·................ |
| 23 | ··0x001 | 23 | ··0x00126158·00000000·ffff0114·51050000·7505db03·........Q...u... |
| 24 | ··0x001 | 24 | ··0x00126168·00e30205·d70300ff·03050000·ff9b1501·................ |
| 25 | ··0x001 | 25 | ··0x00126178·0c830105·a30301a0·0205a503·01010000·................ |
| 26 | ··0x001 | 26 | ··0x00126188·00000000·ff9b7d01·73470500·00630590·......}.sG...c.. |
| 27 | ··0x001 | 27 | ··0x00126198·0a01b101·05830f00·cd010581·0f01ef02·................ |
| 28 | ··0x001 | 28 | ··0x001261a8·05a90f00·980305a5·0f00a803·05f60f00·................ |
| 29 | ··0x001 | 29 | ··0x001261b8·8a04059e·0f00ad04·05a00a00·b8040594·................ |
| 30 | ··0x001 | 30 | ··0x001261c8·0a00f008·059c0a00·99090592·0a00a409·................ |
| 31 | ··0x001 | 31 | ··0x001261d8·05e50e00·ca0905e1·0e00b60a·05c90c03·................ |
| 32 | ··0x001 | 32 | ··0x001261e8·c40c0500·00f80c05·fd0c008b·0d050000·................ |
| 33 | ··0x001 | 33 | ··0x001261f8·990f05fa·0f01a910·05ae1000·0100007d·...............} |
| 34 | ··0x001 | 34 | ··0x00126208·00000000·ffff0181·01530500·006b05ad·.........S...k.. |
| 35 | ··0x001 | 35 | ··0x00126218·13008301·05f11200·9e0105bb·1300e401·................ |
| 36 | ··0x001 | 36 | ··0x00126228·05000097·0205ea12·00ae031b·b41300e2·................ |
| 37 | ··0x001 | 37 | ··0x00126238·0319f812·00a30430·941300da·051bdc12·.......0........ |
| 38 | ··0x001 | 38 | ··0x00126248·008c0611·8d1300bd·0605d512·00d90605·................ |
| 39 | ··0x001 | 39 | ··0x00126258·ce1200a0·0805e312·00c80805·d51200d4·................ |
| 40 | ··0x001 | 40 | ··0x00126268·0805c213·00ea082b·86130098·0cd601a6·.......+........ |
| 41 | ··0x001 | 41 | ··0x00126278·1300f70d·059b1300·8d0e58a6·1300aa10·..........X..... |
| 42 | ··0x001 | 42 | ··0x00126288·05ff1200·b81205a6·1300ffff·0105b401·................ |
| 43 | ··0x001 | 43 | ··0x00126298·430000ff·ff012a60·05000081·0105a119·C.....*`........ |
| 44 | ··0x001 | 44 | ··0x001262a8·009b01ec·04af1900·ba0605a8·1900cd0a·................ |
| 45 | ··0x001 | 45 | ··0x001262b8·ae0aaf19·00ad1605·a8190097·1705af19·................ |
| 46 | ··0x001 | 46 | ··0x001262c8·00ffff01·04390500·00000000·ffff0114·.....9.......... |
| 47 | ··0x001 | 47 | ··0x001262d8·4b050000·7905cc02·00ab0205·0000c702·K...y........... |
| 48 | ··0x001 | 48 | ··0x001262e8·05cc0200·ffff0104·0f050000·ff9b1501·................ |
| 49 | ··0x001 | 49 | ··0x001262f8·0be80105·00008802·05d70301·01000000·................ |
| 50 | ··0x001 | 50 | ··0x00126308·00000000·ff9b1101·081a051f·002e0500·................ |
| 51 | ··0x001 | 51 | ··0x00126318·00010000·00000000·ff9b2501·1a1d0500·..........%..... |
| 52 | ··0x001 | 52 | ··0x00126328·003b05e8·01016722·f201019f·0105ed01·.;....g"........ |
| 53 | ··0x001 | 53 | ··0x00126338·01ce0105·f2010101·00007d00·00000000·..........}..... |
| 54 | ··0x001 | 54 | ··0x00126348·ff9b2101·151b0566·0039053e·03610579·..!....f.9.>.a.y |
| 55 | ··0x001 | 55 | ··0x00126358·00740500·00870105·00000100·007d0000·.t...........}.. |
| 56 | ··0x001 | 56 | ··0x00126368·00000000·ffff0125·7c050000·8801058b·.......%|....... |
| 57 | ··0x001 | 57 | ··0x00126378·0300c401·050000d0·01058403·008e0205·................ |
| 58 | ··0x001 | 58 | ··0x00126388·00009a02·05fd0200·ce020500·00ffff01·................ |
| 59 | ··0x001 | 59 | ··0x00126398·04102f00·00000000·ff9b1901·0c930505·../............. |
| 60 | ··0x001 | 60 | ··0x001263a8·9b09019d·0505a409·03010000·7d000000·............}... |
| 61 | ··0x001 | 61 | ··0x001263b8·7c700000·ff9b1501·08361061·005c1800·|p.......6.a.\.. |
| 62 | ··0x001 | 62 | ··0x001263c8·00010000·7d000000·64700000·ff9b2901·....}...dp....). |
| 63 | ··0x001 | 63 | ··0x001263d8·20540500·00960105·f60101ac·0105fa01··T.............. |
| 64 | ··0x001 | 64 | ··0x001263e8·01f10105·0000ed02·05f20200·a0030500·................ |
| 65 | ··0x001 | 65 | ··0x001263f8·00010000·00000000·ffff010c·aa021c00·................ |
| 66 | ··0x001 | 66 | ··0x00126408·00dc02cc·02a80500·ffff0104·10050000·................ |
| 67 | ··0x001 | 67 | ··0x00126418·ff9b3d01·315705e9·0d01b601·050000d7·..=.1W.......... |
| 68 | ··0x001 | 68 | ··0x00126428·0105eb0d·01e40d05·0000c10e·05c60e00·................ |
| 69 | ··0x001 | 69 | ··0x00126438·cd0e05e3·0e03de0e·0500008a·0f058f0f·................ |
| 70 | ··0x0012 | 70 | ··0x00126448·009d0f05·00000100·007d0000·00000000·.........}...... |
| 71 | ··0x0012 | 71 | ··0x00126458·ffff0115·2f050000·5505c907·00e10105·..../...U....... |
| 72 | ··0x0012 | 72 | ··0x00126468·c20700b0·0705d007·00ffff01·047b0500·.............{.. |
| 73 | ··0x0012 | 73 | ··0x00126478·00000000·ff9b2101·16900105·e604019d·......!......... |
| 74 | ··0x0012 | 74 | ··0x00126488·04490000·910505b0·0500bf05·05000001·.I.............. |
| 75 | ··0x0012 | 75 | ··0x00126498·00000000·00000000·ffff0187·014ff519·.............O.. |
| 76 | ··0x0012 | 76 | ··0x001264a8·00008b1b·2ad63c00·a11e4900·00e81f3d·....*.<...I....= |
| 77 | ··0x0012 | 77 | ··0x001264b8·dd3c00c4·205c0000·b6228602·cf3c00a6·.<..·\..."...<.. |
| 78 | ··0x0012 | 78 | ··0x001264c8·269606c8·3c009831·020000c4·321ac83c·&...<..1....2..< |
| 79 | ··0x0012 | 79 | ··0x001264d8·00f33293·03cf3c00·a03605c8·3c00af36·..2...<..6..<..6 |
| 80 | ··0x0012 | 80 | ··0x001264e8·28cf3c00·f7364f00·00d5370d·ba3c0091·(.<..6O...7..<.. |
| 81 | ··0x0012 | 81 | ··0x001264f8·381b0000·bb380dc1·3c00f638·18d63c00·8....8..<..8..<. |
| 82 | ··0x0012 | 82 | ··0x00126508·9d3940b3·3c00a63a·05d63c00·b53a3ab3·.9@.<..:..<..::. |
| 83 | ··0x0012 | 83 | ··0x00126518·3c00f53a·05000090·3b05c83c·009b3b98·<..:....;..<..;. |
| 84 | ··0x0012 | 84 | ··0x00126528·01cf3c00·ffff0104·2e530000·ff9b4d01·..<......S....M. |
| 85 | ··0x0012 | 85 | ··0x00126538·454e0500·009e0105·a10501b9·01059d05·EN.............. |
| 86 | ··0x0012 | 86 | ··0x00126548·01d40105·a90501ef·0105f003·01870205·................ |
| 87 | ··0x0012 | 87 | ··0x00126558·f40301a6·02058d05·01bc0205·95050187·................ |
| 88 | ··0x0012 | 88 | ··0x00126568·0305a505·00eb03d8·010000c6·0505cb05·................ |
| 89 | ··0x0012 | 89 | ··0x00126578·00fc0505·00000100·00000000·ffff014e·...............N |
| 90 | ··0x0012 | 90 | ··0x00126588·2d050000·4505d403·006005d6·05007b05·-...E....`....{. |
| 91 | ··0x0012 | 91 | ··0x00126598·d2050096·0105ce05·00b40105·ca0500de·................ |
| 92 | ··0x0012 | 92 | ··0x001265a8·0105e105·00880205·da0500b2·0205e805·................ |
| 93 | ··0x0012 | 93 | ··0x001265b8·00dc0205·c3050083·0305bc05·00ae0305·................ |
| 94 | ··0x0012 | 94 | ··0x001265c8·b40500c4·0305db03·00af0505·00000000·................ |
| 95 | ··0x0012 | 95 | ··0x001265d8·ff9b2901·204e0500·008d0105·ad0201d1·..).·N.......... |
| 96 | ··0x0012 | 96 | ··0x001265e8·0105af02·00a80250·0000fb02·05800300·.......P........ |
| 97 | ··0x0012 | 97 | ··0x001265f8·ab030500·00010000·00000000·ff9b8801·................ |
| 98 | ··0x0012 | 98 | ··0x00126608·017f2d05·00004e05·900b006f·05fb0a00·..-...N....o.... |
| 99 | ··0x0012 | 99 | ··0x00126618·87010582·0b009e01·05a10800·b50105d5·................ |
| 100 | ··0x0012 | 100 | ··0x00126628·06008302·05a50a00·d60205ac·0a01f202·................ |
| 101 | ··0x0012 | 101 | ··0x00126638·05b70a01·8e0305a5·0801aa03·05a90801·................ |
| 102 | ··0x0012 | 102 | ··0x00126648·c60305b8·0901db03·05bc0901·830405c3·................ |
| 103 | ··0x0012 | 103 | ··0x00126658·0901e904·05ca0900·be0505d9·0601f905·................ |
| 104 | ··0x0012 | 104 | ··0x00126668·05b30a00·c80605a5·0a00d006·05ca0900·................ |
| 105 | ··0x0012 | 105 | ··0x00126678·ea070500·009c0805·890b0099·0a059e0a·................ |
| 106 | ··0x0012 | 106 | ··0x00126688·00010000·00000000·ffff011c·3d6b0000·............=k.. |
| 107 | ··0x0012 | 107 | ··0x00126698·8d0236ca·0400d902·05d10400·87041bca·..6............. |
| 108 | ··0x0012 | 108 | ··0x001266a8·0400b104·05d80400·ffff0104·23050000·............#... |
| 109 | ··0x0012 | 109 | ··0x001266b8·ffff0112·a70105fa·0400e801·1bf00400·................ |
| 110 | ··0x0012 | 110 | ··0x001266c8·b70205fa·0400ffff·01042005·00000000·..........·..... |
| 111 | ··0x0012 | 111 | ··0x001266d8·ff9b2101·16900105·e604019d·04490000·..!..........I.. |
| 112 | ··0x0012 | 112 | ··0x001266e8·910505b0·0500bf05·05000001·00000000·................ |
| 113 | ··0x0012 | 113 | ··0x001266f8·00000000·ff9b1101·09320500·005905ac·.........2...Y.. |
| 114 | ··0x0012 | 114 | ··0x00126708·07010100·00000000·ff9b1101·081a051f·................ |
| 115 | ··0x0012 | 115 | ··0x00126718·002e0500·00010000·00000000·ffff0124·...............$ |
| 116 | ··0x0012 | 116 | ··0x00126728·57360000·d101da09·da1700df·0dc60600·W6.............. |
| 117 | ··0x0012 | 117 | ··0x00126738·00bf14d9·01da1700·b2160d00·00d71683·................ |
| 118 | ··0x0012 | 118 | ··0x00126748·01da1700·ffff0104·11050000·ffff011d·................ |
| 119 | ··0x0012 | 119 | ··0x00126758·b50305fb·0a00fa05·050000b7·0705fb0a·................ |
| 120 | ··0x0012 | 120 | ··0x00126768·00bf0905·820b00a7·0a05890b·00ffff01·................ |
| 121 | ··0x0012 | 121 | ··0x00126778·04490500·00ffff01·32577000·00f00205·.I......2Wp..... |
| 122 | ··0x0012 | 122 | ··0x00126788·c51700f3·06a40100·00c30971·be1700d7·...........q.... |
| 123 | ··0x0012 | 123 | ··0x00126798·0cf70800·00de1505·be1700f8·15480000·.............H.. |
| 124 | ··0x0012 | 124 | ··0x001267a8·da1605be·1700f416·360000ff·ff010423·........6......# |
| 125 | ··0x0012 | 125 | ··0x001267b8·22000000·ff9b2101·16a40105·d605018d·".....!......... |
| Max diff block lines reached; 0/195144 bytes (0.00%) of diff not shown. | |||
| Offset 1, 13 lines modified | Offset 1, 13 lines modified | ||
| 1 | Hex·dump·of·section·'.init_array': | 1 | Hex·dump·of·section·'.init_array': |
| 2 | ··0x0012 | 2 | ··0x0012cda0·d0b20200·b0930200·10940200·50940200·............P... |
| 3 | ··0x00126db4·40910200·80910200·c0910200·20920200·@...........·... | ||
| 4 | ··0x00126dc4·60920200·a0920200·e0920200·20930200·`...........·... | ||
| 5 | ··0x00126dd4·60930200·a0930200·e0930200·20940200·`...........·... | ||
| 6 | ··0x0012 | 3 | ··0x0012cdb0·90940200·d0940200·10950200·70950200·............p... |
| 4 | ··0x0012cdc0·b0950200·f0950200·30960200·70960200·........0...p... | ||
| 5 | ··0x0012cdd0·b0960200·f0960200·30970200·70970200·........0...p... | ||
| 7 | ··0x0012 | 6 | ··0x0012cde0·b0970200·10980200·70980200·d0980200·........p....... |
| 7 | ··0x0012cdf0·10990200·50990200·b0990200·109a0200·....P........... | ||
| 8 | ··0x0012 | 8 | ··0x0012ce00·709a0200·d09a0200·309b0200·909b0200·p.......0....... |
| 9 | ··0x0012 | 9 | ··0x0012ce10·f09b0200·509c0200·909c0200·d09c0200·....P........... |
| 10 | ··0x0012 | 10 | ··0x0012ce20·109d0200·509d0200·909d0200·d09d0200·....P........... |
| 11 | ··0x0012 | 11 | ··0x0012ce30·109e0200·509e0200···················....P... |
| Offset 1, 4 lines modified | Offset 1, 4 lines modified | ||
| 1 | Hex·dump·of·section·'.fini_array': | 1 | Hex·dump·of·section·'.fini_array': |
| 2 | ··0x0012 | 2 | ··0x0012ce38·80b20200····························.... |
| Offset 1, 11 lines modified | Offset 1, 11 lines modified | ||
| 1 | Hex·dump·of·section·'.got': | 1 | Hex·dump·of·section·'.got': |
| 2 | ··0x0012 | 2 | ··0x0012cf74·00000000·00000000·00000000·00000000·................ |
| 3 | ··0x0012 | 3 | ··0x0012cf84·e0890200·00000000·00000000·00000000·................ |
| 4 | ··0x0012 | 4 | ··0x0012cf94·00000000·00000000·00000000·00000000·................ |
| 5 | ··0x0012 | 5 | ··0x0012cfa4·00000000·00000000·00000000·00000000·................ |
| 6 | ··0x0012 | 6 | ··0x0012cfb4·00000000·00000000·00000000·00000000·................ |
| 7 | ··0x0012 | 7 | ··0x0012cfc4·00000000·00000000·00000000·00000000·................ |
| 8 | ··0x0012 | 8 | ··0x0012cfd4·00000000·00000000·00000000·00000000·................ |
| 9 | ··0x0012 | 9 | ··0x0012cfe4·00000000·00000000·00000000·00000000·................ |
| Offset 1, 71 lines modified | Offset 1, 71 lines modified | ||
| 1 | Hex·dump·of·section·'.got.plt': | 1 | Hex·dump·of·section·'.got.plt': |
| 2 | ·NOTE:·This·section·has·relocations·against·it,·but·these·have·NOT·been·applied·to·this·dump. | 2 | ·NOTE:·This·section·has·relocations·against·it,·but·these·have·NOT·been·applied·to·this·dump. |
| 3 | ··0x0012 | 3 | ··0x0012cff4·3cce1200·00000000·00000000·36e00100·<...........6... |
| 4 | ··0x0012 | 4 | ··0x0012d004·46e00100·56e00100·66e00100·76e00100·F...V...f...v... |
| 5 | ··0x0012 | 5 | ··0x0012d014·86e00100·96e00100·a6e00100·b6e00100·................ |
| 6 | ··0x0012 | 6 | ··0x0012d024·c6e00100·d6e00100·e6e00100·f6e00100·................ |
| 7 | ··0x0012 | 7 | ··0x0012d034·06e10100·16e10100·26e10100·36e10100·........&...6... |
| 8 | ··0x0012 | 8 | ··0x0012d044·46e10100·56e10100·66e10100·76e10100·F...V...f...v... |
| 9 | ··0x0012 | 9 | ··0x0012d054·86e10100·96e10100·a6e10100·b6e10100·................ |
| 10 | ··0x0012 | 10 | ··0x0012d064·c6e10100·d6e10100·e6e10100·f6e10100·................ |
| 11 | ··0x0012 | 11 | ··0x0012d074·06e20100·16e20100·26e20100·36e20100·........&...6... |
| 12 | ··0x0012 | 12 | ··0x0012d084·46e20100·56e20100·66e20100·76e20100·F...V...f...v... |
| 13 | ··0x0012 | 13 | ··0x0012d094·86e20100·96e20100·a6e20100·b6e20100·................ |
| 14 | ··0x0012 | 14 | ··0x0012d0a4·c6e20100·d6e20100·e6e20100·f6e20100·................ |
| 15 | ··0x0012 | 15 | ··0x0012d0b4·06e30100·16e30100·26e30100·36e30100·........&...6... |
| 16 | ··0x0012 | 16 | ··0x0012d0c4·46e30100·56e30100·66e30100·76e30100·F...V...f...v... |
| 17 | ··0x0012 | 17 | ··0x0012d0d4·86e30100·96e30100·a6e30100·b6e30100·................ |
| 18 | ··0x0012 | 18 | ··0x0012d0e4·c6e30100·d6e30100·e6e30100·f6e30100·................ |
| 19 | ··0x0012 | 19 | ··0x0012d0f4·06e40100·16e40100·26e40100·36e40100·........&...6... |
| 20 | ··0x0012 | 20 | ··0x0012d104·46e40100·56e40100·66e40100·76e40100·F...V...f...v... |
| 21 | ··0x0012 | 21 | ··0x0012d114·86e40100·96e40100·a6e40100·b6e40100·................ |
| 22 | ··0x0012 | 22 | ··0x0012d124·c6e40100·d6e40100·e6e40100·f6e40100·................ |
| 23 | ··0x0012 | 23 | ··0x0012d134·06e50100·16e50100·26e50100·36e50100·........&...6... |
| 24 | ··0x0012 | 24 | ··0x0012d144·46e50100·56e50100·66e50100·76e50100·F...V...f...v... |
| 25 | ··0x0012 | 25 | ··0x0012d154·86e50100·96e50100·a6e50100·b6e50100·................ |
| 26 | ··0x0012 | 26 | ··0x0012d164·c6e50100·d6e50100·e6e50100·f6e50100·................ |
| 27 | ··0x0012 | 27 | ··0x0012d174·06e60100·16e60100·26e60100·36e60100·........&...6... |
| 28 | ··0x0012 | 28 | ··0x0012d184·46e60100·56e60100·66e60100·76e60100·F...V...f...v... |
| 29 | ··0x0012 | 29 | ··0x0012d194·86e60100·96e60100·a6e60100·b6e60100·................ |
| 30 | ··0x0012 | 30 | ··0x0012d1a4·c6e60100·d6e60100·e6e60100·f6e60100·................ |
| 31 | ··0x0012 | 31 | ··0x0012d1b4·06e70100·16e70100·26e70100·36e70100·........&...6... |
| 32 | ··0x0012 | 32 | ··0x0012d1c4·46e70100·56e70100·66e70100·76e70100·F...V...f...v... |
| 33 | ··0x0012 | 33 | ··0x0012d1d4·86e70100·96e70100·a6e70100·b6e70100·................ |
| 34 | ··0x0012 | 34 | ··0x0012d1e4·c6e70100·d6e70100·e6e70100·f6e70100·................ |
| 35 | ··0x0012 | 35 | ··0x0012d1f4·06e80100·16e80100·26e80100·36e80100·........&...6... |
| 36 | ··0x0012 | 36 | ··0x0012d204·46e80100·56e80100·66e80100·76e80100·F...V...f...v... |
| 37 | ··0x0012 | 37 | ··0x0012d214·86e80100·96e80100·a6e80100·b6e80100·................ |
| 38 | ··0x0012 | 38 | ··0x0012d224·c6e80100·d6e80100·e6e80100·f6e80100·................ |
| 39 | ··0x0012 | 39 | ··0x0012d234·06e90100·16e90100·26e90100·36e90100·........&...6... |
| 40 | ··0x0012 | 40 | ··0x0012d244·46e90100·56e90100·66e90100·76e90100·F...V...f...v... |
| 41 | ··0x0012 | 41 | ··0x0012d254·86e90100·96e90100·a6e90100·b6e90100·................ |
| 42 | ··0x0012 | 42 | ··0x0012d264·c6e90100·d6e90100·e6e90100·f6e90100·................ |
| 43 | ··0x0012 | 43 | ··0x0012d274·06ea0100·16ea0100·26ea0100·36ea0100·........&...6... |
| 44 | ··0x0012 | 44 | ··0x0012d284·46ea0100·56ea0100·66ea0100·76ea0100·F...V...f...v... |
| 45 | ··0x0012 | 45 | ··0x0012d294·86ea0100·96ea0100·a6ea0100·b6ea0100·................ |
| 46 | ··0x0012 | 46 | ··0x0012d2a4·c6ea0100·d6ea0100·e6ea0100·f6ea0100·................ |
| 47 | ··0x0012 | 47 | ··0x0012d2b4·06eb0100·16eb0100·26eb0100·36eb0100·........&...6... |
| 48 | ··0x0012 | 48 | ··0x0012d2c4·46eb0100·56eb0100·66eb0100·76eb0100·F...V...f...v... |
| 49 | ··0x0012 | 49 | ··0x0012d2d4·86eb0100·96eb0100·a6eb0100·b6eb0100·................ |
| 50 | ··0x0012 | 50 | ··0x0012d2e4·c6eb0100·d6eb0100·e6eb0100·f6eb0100·................ |
| 51 | ··0x0012 | 51 | ··0x0012d2f4·06ec0100·16ec0100·26ec0100·36ec0100·........&...6... |
| 52 | ··0x0012 | 52 | ··0x0012d304·46ec0100·56ec0100·66ec0100·76ec0100·F...V...f...v... |
| 53 | ··0x0012 | 53 | ··0x0012d314·86ec0100·96ec0100·a6ec0100·b6ec0100·................ |
| 54 | ··0x0012 | 54 | ··0x0012d324·c6ec0100·d6ec0100·e6ec0100·f6ec0100·................ |
| 55 | ··0x0012 | 55 | ··0x0012d334·06ed0100·16ed0100·26ed0100·36ed0100·........&...6... |
| 56 | ··0x0012 | 56 | ··0x0012d344·46ed0100·56ed0100·66ed0100·76ed0100·F...V...f...v... |
| 57 | ··0x0012 | 57 | ··0x0012d354·86ed0100·96ed0100·a6ed0100·b6ed0100·................ |
| 58 | ··0x0012 | 58 | ··0x0012d364·c6ed0100·d6ed0100·e6ed0100·f6ed0100·................ |
| 59 | ··0x0012 | 59 | ··0x0012d374·06ee0100·16ee0100·26ee0100·36ee0100·........&...6... |
| 60 | ··0x0012 | 60 | ··0x0012d384·46ee0100·56ee0100·66ee0100·76ee0100·F...V...f...v... |
| 61 | ··0x0012 | 61 | ··0x0012d394·86ee0100·96ee0100·a6ee0100·b6ee0100·................ |
| 62 | ··0x0012 | 62 | ··0x0012d3a4·c6ee0100·d6ee0100·e6ee0100·f6ee0100·................ |
| 63 | ··0x0012 | 63 | ··0x0012d3b4·06ef0100·16ef0100·26ef0100·36ef0100·........&...6... |
| 64 | ··0x0012 | 64 | ··0x0012d3c4·46ef0100·56ef0100·66ef0100·76ef0100·F...V...f...v... |
| 65 | ··0x0012 | 65 | ··0x0012d3d4·86ef0100·96ef0100·a6ef0100·b6ef0100·................ |
| 66 | ··0x0012 | 66 | ··0x0012d3e4·c6ef0100·d6ef0100·e6ef0100·f6ef0100·................ |
| 67 | ··0x0012 | 67 | ··0x0012d3f4·06f00100·16f00100·26f00100·36f00100·........&...6... |
| 68 | ··0x0012 | 68 | ··0x0012d404·46f00100·56f00100·66f00100·76f00100·F...V...f...v... |
| 69 | ··0x0012 | 69 | ··0x0012d414·86f00100·96f00100···················........ |
| Offset 1, 87 lines modified | Offset 1, 87 lines modified | ||
| 1 | Hex·dump·of·section·'.data': | 1 | Hex·dump·of·section·'.data': |
| 2 | ··0x0012 | 2 | ··0x0012d420·00000000·24d41200·00000000·00000000·....$........... |
| 3 | ··0x0012 | 3 | ··0x0012d430·06000000·00000000·02000000·01000000·................ |
| 4 | ··0x0012 | 4 | ··0x0012d440·02000000·00000000·23000000·00000000·........#....... |
| 5 | ··0x0012 | 5 | ··0x0012d450·01000000·03000000·04000000·00000000·................ |
| 6 | ··0x0012 | 6 | ··0x0012d460·40000000·00000000·00000100·0f000000·@............... |
| 7 | ··0x0012 | 7 | ··0x0012d470·11000000·12000000·23000000·00000000·........#....... |
| 8 | ··0x0012 | 8 | ··0x0012d480·00000100·01000000·02000000·03000000·................ |
| 9 | ··0x0012 | 9 | ··0x0012d490·23000000·00000000·00000000·01000000·#............... |
| 10 | ··0x0012 | 10 | ··0x0012d4a0·04000000·05000000·23000000·00000000·........#....... |
| 11 | ··0x0012 | 11 | ··0x0012d4b0·1f8b0804·00000000·00ff0600·42430200·............BC.. |
| 12 | ··0x0012 | 12 | ··0x0012d4c0·1b000300·00000000·00000000·00000000·................ |
| 13 | ··0x0012 | 13 | ··0x0012d4d0·00000000·00000000·00000000·00000000·................ |
| 14 | ··0x0012 | 14 | ··0x0012d4e0·4e4e4e4e·4e4e4e4e·4e4e4e4e·4e4e4e4e·NNNNNNNNNNNNNNNN |
| 15 | ··0x0012 | 15 | ··0x0012d4f0·4e4e4e4e·4e4e4e4e·4e4e4e4e·4e4e4e4e·NNNNNNNNNNNNNNNN |
| 16 | ··0x0012 | 16 | ··0x0012d500·4e4e4e4e·4e4e4e4e·4e4e4e4e·4e4e4e4e·NNNNNNNNNNNNNNNN |
| 17 | ··0x0012 | 17 | ··0x0012d510·4e4e4e4e·4e4e4e4e·4e4e4e4e·4e4e4e4e·NNNNNNNNNNNNNNNN |
| 18 | ··0x0012 | 18 | ··0x0012d520·4e544e47·4e4e4e43·4e4e4e4e·4e4e4e4e·NTNGNNNCNNNNNNNN |
| 19 | ··0x0012 | 19 | ··0x0012d530·4e4e4e4e·414e4e4e·4e4e4e4e·4e4e4e4e·NNNNANNNNNNNNNNN |
| 20 | ··0x0012 | 20 | ··0x0012d540·4e544e47·4e4e4e43·4e4e4e4e·4e4e4e4e·NTNGNNNCNNNNNNNN |
| 21 | ··0x0012 | 21 | ··0x0012d550·4e4e4e4e·414e4e4e·4e4e4e4e·4e4e4e4e·NNNNANNNNNNNNNNN |
| 22 | ··0x0012 | 22 | ··0x0012d560·4e4e4e4e·4e4e4e4e·4e4e4e4e·4e4e4e4e·NNNNNNNNNNNNNNNN |
| 23 | ··0x0012 | 23 | ··0x0012d570·4e4e4e4e·4e4e4e4e·4e4e4e4e·4e4e4e4e·NNNNNNNNNNNNNNNN |
| 24 | ··0x0012 | 24 | ··0x0012d580·4e4e4e4e·4e4e4e4e·4e4e4e4e·4e4e4e4e·NNNNNNNNNNNNNNNN |
| 25 | ··0x0012 | 25 | ··0x0012d590·4e4e4e4e·4e4e4e4e·4e4e4e4e·4e4e4e4e·NNNNNNNNNNNNNNNN |
| 26 | ··0x0012 | 26 | ··0x0012d5a0·4e4e4e4e·4e4e4e4e·4e4e4e4e·4e4e4e4e·NNNNNNNNNNNNNNNN |
| 27 | ··0x0012 | 27 | ··0x0012d5b0·4e4e4e4e·4e4e4e4e·4e4e4e4e·4e4e4e4e·NNNNNNNNNNNNNNNN |
| 28 | ··0x0012 | 28 | ··0x0012d5c0·4e4e4e4e·4e4e4e4e·4e4e4e4e·4e4e4e4e·NNNNNNNNNNNNNNNN |
| 29 | ··0x0012 | 29 | ··0x0012d5d0·4e4e4e4e·4e4e4e4e·4e4e4e4e·4e4e4e4e·NNNNNNNNNNNNNNNN |
| 30 | ··0x0012 | 30 | ··0x0012d5e0·04040404·04040404·04040404·04040404·................ |
| 31 | ··0x0012 | 31 | ··0x0012d5f0·04040404·04040404·04040404·04040404·................ |
| 32 | ··0x0012 | 32 | ··0x0012d600·04040404·04040404·04040404·04040404·................ |
| 33 | ··0x0012 | 33 | ··0x0012d610·04040404·04040404·04040404·04040404·................ |
| 34 | ··0x0012 | 34 | ··0x0012d620·04000401·04040402·04040404·04040404·................ |
| 35 | ··0x0012 | 35 | ··0x0012d630·04040404·03040404·04040404·04040404·................ |
| 36 | ··0x0012 | 36 | ··0x0012d640·04000401·04040402·04040404·04040404·................ |
| 37 | ··0x0012 | 37 | ··0x0012d650·04040404·03040404·04040404·04040404·................ |
| 38 | ··0x0012 | 38 | ··0x0012d660·04040404·04040404·04040404·04040404·................ |
| 39 | ··0x0012 | 39 | ··0x0012d670·04040404·04040404·04040404·04040404·................ |
| 40 | ··0x0012 | 40 | ··0x0012d680·04040404·04040404·04040404·04040404·................ |
| 41 | ··0x0012 | 41 | ··0x0012d690·04040404·04040404·04040404·04040404·................ |
| 42 | ··0x0012 | 42 | ··0x0012d6a0·04040404·04040404·04040404·04040404·................ |
| 43 | ··0x0012 | 43 | ··0x0012d6b0·04040404·04040404·04040404·04040404·................ |
| 44 | ··0x0012 | 44 | ··0x0012d6c0·04040404·04040404·04040404·04040404·................ |
| 45 | ··0x0012 | 45 | ··0x0012d6d0·04040404·04040404·04040404·04040404·................ |
| 46 | ··0x0012 | 46 | ··0x0012d6e0·46617461·6c204572·726f7200·00000000·Fatal·Error..... |
| 47 | ··0x0012 | 47 | ··0x0012d6f0·00000000·5761726e·696e6700·00000000·....Warning..... |
| 48 | ··0x0012 | 48 | ··0x0012d700·00000000·00000000·4c617374·41637469·........LastActi |
| 49 | ··0x0012 | 49 | ··0x0012d710·6f6e5479·70650000·00000000·00000000·onType.......... |
| 50 | ··0x0012 | 50 | ··0x0012d720·76616c75·65206f75·74206f66·2072616e·value·out·of·ran |
| 51 | ··0x0012 | 51 | ··0x0012d730·67650000·00000000·00000000·00000000·ge.............. |
| 52 | ··0x0012 | 52 | ··0x0012d740·00000000·00000000·00000000·00000000·................ |
| 53 | ··0x0012 | 53 | ··0x0012d750·00000000·00000000·00000000·00000000·................ |
| 54 | ··0x0012 | 54 | ··0x0012d760·636f6d6d·616e6420·6c696e65·20617267·command·line·arg |
| 55 | ··0x0012 | 55 | ··0x0012d770·756d656e·74000000·00000000·00000000·ument........... |
| 56 | ··0x0012 | 56 | ··0x0012d780·00000000·00000000·00000000·00000000·................ |
| 57 | ··0x0012 | 57 | ··0x0012d790·00000000·00000000·00000000·00000000·................ |
| 58 | ··0x0012 | 58 | ··0x0012d7a0·636f756c·64206e6f·74207265·2d616c6c·could·not·re-all |
| 59 | ··0x0012 | 59 | ··0x0012d7b0·6f636174·65206d65·6d6f7279·00000000·ocate·memory.... |
| 60 | ··0x0012 | 60 | ··0x0012d7c0·00000000·00000000·00000000·00000000·................ |
| 61 | ··0x0012 | 61 | ··0x0012d7d0·00000000·00000000·00000000·00000000·................ |
| 62 | ··0x0012 | 62 | ··0x0012d7e0·636f756c·64206e6f·7420616c·6c6f6361·could·not·alloca |
| 63 | ··0x0012 | 63 | ··0x0012d7f0·7465206d·656d6f72·79000000·00000000·te·memory....... |
| 64 | ··0x0012 | 64 | ··0x0012d800·00000000·00000000·00000000·00000000·................ |
| 65 | ··0x0012 | 65 | ··0x0012d810·00000000·00000000·00000000·00000000·................ |
| 66 | ··0x0012 | 66 | ··0x0012d820·636f756c·64206e6f·74206f70·656e2066·could·not·open·f |
| 67 | ··0x0012 | 67 | ··0x0012d830·696c6500·00000000·00000000·00000000·ile............. |
| 68 | ··0x0012 | 68 | ··0x0012d840·00000000·00000000·00000000·00000000·................ |
| 69 | ··0x0012 | 69 | ··0x0012d850·00000000·00000000·00000000·00000000·................ |
| 70 | ··0x0012 | 70 | ··0x0012d860·636f756c·64206e6f·74207265·61642066·could·not·read·f |
| 71 | ··0x0012 | 71 | ··0x0012d870·726f6d20·66696c65·00000000·00000000·rom·file........ |
| 72 | ··0x0012 | 72 | ··0x0012d880·00000000·00000000·00000000·00000000·................ |
| 73 | ··0x0012 | 73 | ··0x0012d890·00000000·00000000·00000000·00000000·................ |
| 74 | ··0x0012 | 74 | ··0x0012d8a0·636f756c·64206e6f·74207772·69746520·could·not·write· |
| 75 | ··0x0012 | 75 | ··0x0012d8b0·746f2066·696c6500·00000000·00000000·to·file......... |
| 76 | ··0x0012 | 76 | ··0x0012d8c0·00000000·00000000·00000000·00000000·................ |
| 77 | ··0x0012 | 77 | ··0x0012d8d0·00000000·00000000·00000000·00000000·................ |
| 78 | ··0x0012 | 78 | ··0x0012d8e0·656e636f·756e7465·72656420·6561726c·encountered·earl |
| 79 | ··0x0012 | 79 | ··0x0012d8f0·7920656e·642d6f66·2d66696c·65000000·y·end-of-file... |
| 80 | ··0x0012 | 80 | ··0x0012d900·00000000·00000000·00000000·00000000·................ |
| 81 | ··0x0012 | 81 | ··0x0012d910·00000000·00000000·00000000·00000000·................ |
| 82 | ··0x0012 | 82 | ··0x0012d920·6c617374·20657272·6f722074·79706500·last·error·type. |
| 83 | ··0x0012 | 83 | ··0x0012d930·00000000·00000000·00000000·00000000·................ |
| 84 | ··0x0012 | 84 | ··0x0012d940·00000000·00000000·00000000·00000000·................ |
| 85 | ··0x0012 | 85 | ··0x0012d950·00000000·00000000·00000000·00000000·................ |
| Offset 1, 8 lines modified | Offset 1, 8 lines modified | ||
| 1 | Hex·dump·of·section·'.gnu_debugaltlink': | 1 | Hex·dump·of·section·'.gnu_debugaltlink': |
| 2 | ··0x00000000·2f757372·2f6c6962·2f646562·75672f2e·/usr/lib/debug/. | 2 | ··0x00000000·2f757372·2f6c6962·2f646562·75672f2e·/usr/lib/debug/. |
| 3 | ··0x00000010·64777a2f·69333836·2d6c696e·75782d67·dwz/i386-linux-g | 3 | ··0x00000010·64777a2f·69333836·2d6c696e·75782d67·dwz/i386-linux-g |
| 4 | ··0x00000020·6e752f74·76632e64·65627567·00 | 4 | ··0x00000020·6e752f74·76632e64·65627567·00baab79·nu/tvc.debug...y |
| 5 | ··0x00000030· | 5 | ··0x00000030·896f6c2f·e012d0a5·f1bd009f·e4175a15·.ol/..........Z. |
| 6 | ··0x00000040· | 6 | ··0x00000040·a6··································. |
| Offset 1, 7 lines modified | Offset 1, 7 lines modified | ||
| 1 | Hex·dump·of·section·'.gnu_debuglink': | 1 | Hex·dump·of·section·'.gnu_debuglink': |
| 2 | ··0x00000000·35643664·39356562·66353266·33656537·5d6d95ebf52f3ee7 | ||
| 3 | ··0x000000 | 2 | ··0x00000000·62353666·36366665·35636563·35653666·b56f66fe5cec5e6f |
| 3 | ··0x00000010·30333132·34356638·34306263·66373065·031245f840bcf70e | ||
| 4 | ··0x00000020· | 4 | ··0x00000020·31336565·33392e64·65627567·00000000·13ee39.debug.... |
| 5 | ··0x00000030·0 | 5 | ··0x00000030·01e2d4c1····························.... |
| Offset 4, 17 lines modified | Offset 4, 17 lines modified | ||
| 4 | ··Data:······························2's·complement,·little·endian | 4 | ··Data:······························2's·complement,·little·endian |
| 5 | ··Version:···························1·(current) | 5 | ··Version:···························1·(current) |
| 6 | ··OS/ABI:····························UNIX·-·System·V | 6 | ··OS/ABI:····························UNIX·-·System·V |
| 7 | ··ABI·Version:·······················0 | 7 | ··ABI·Version:·······················0 |
| 8 | ··Type:······························DYN·(Position-Independent·Executable·file) | 8 | ··Type:······························DYN·(Position-Independent·Executable·file) |
| 9 | ··Machine:···························Intel·80386 | 9 | ··Machine:···························Intel·80386 |
| 10 | ··Version:···························0x1 | 10 | ··Version:···························0x1 |
| 11 | ··Entry·point·address:···············0xa3 | 11 | ··Entry·point·address:···············0xa390 |
| 12 | ··Start·of·program·headers:··········52·(bytes·into·file) | 12 | ··Start·of·program·headers:··········52·(bytes·into·file) |
| 13 | ··Start·of·section·headers:··········22 | 13 | ··Start·of·section·headers:··········222240·(bytes·into·file) |
| 14 | ··Flags:·····························0x0 | 14 | ··Flags:·····························0x0 |
| 15 | ··Size·of·this·header:···············52·(bytes) | 15 | ··Size·of·this·header:···············52·(bytes) |
| 16 | ··Size·of·program·headers:···········32·(bytes) | 16 | ··Size·of·program·headers:···········32·(bytes) |
| 17 | ··Number·of·program·headers:·········11 | 17 | ··Number·of·program·headers:·········11 |
| 18 | ··Size·of·section·headers:···········40·(bytes) | 18 | ··Size·of·section·headers:···········40·(bytes) |
| 19 | ··Number·of·section·headers:·········30 | 19 | ··Number·of·section·headers:·········30 |
| 20 | ··Section·header·string·table·index:·29 | 20 | ··Section·header·string·table·index:·29 |
| Offset 1, 26 lines modified | Offset 1, 26 lines modified | ||
| 1 | Elf·file·type·is·DYN·(Position-Independent·Executable·file) | 1 | Elf·file·type·is·DYN·(Position-Independent·Executable·file) |
| 2 | Entry·point·0xa3 | 2 | Entry·point·0xa390 |
| 3 | There·are·11·program·headers,·starting·at·offset·52 | 3 | There·are·11·program·headers,·starting·at·offset·52 |
| 4 | Program·Headers: | 4 | Program·Headers: |
| 5 | ··Type···········Offset···VirtAddr···PhysAddr···FileSiz·MemSiz··Flg·Align | 5 | ··Type···········Offset···VirtAddr···PhysAddr···FileSiz·MemSiz··Flg·Align |
| 6 | ··PHDR···········0x000034·0x00000034·0x00000034·0x00160·0x00160·R···0x4 | 6 | ··PHDR···········0x000034·0x00000034·0x00000034·0x00160·0x00160·R···0x4 |
| 7 | ··INTERP·········0x000194·0x00000194·0x00000194·0x00013·0x00013·R···0x1 | 7 | ··INTERP·········0x000194·0x00000194·0x00000194·0x00013·0x00013·R···0x1 |
| 8 | ······[Requesting·program·interpreter:·/lib/ld-linux.so.2] | 8 | ······[Requesting·program·interpreter:·/lib/ld-linux.so.2] |
| 9 | ··LOAD···········0x000000·0x00000000·0x00000000·0x07 | 9 | ··LOAD···········0x000000·0x00000000·0x00000000·0x07788·0x07788·R···0x1000 |
| 10 | ··LOAD···········0x008000·0x00008000·0x00008000·0x2 | 10 | ··LOAD···········0x008000·0x00008000·0x00008000·0x23a58·0x23a58·R·E·0x1000 |
| 11 | ··LOAD···········0x02 | 11 | ··LOAD···········0x02c000·0x0002c000·0x0002c000·0x09281·0x09281·R···0x1000 |
| 12 | ··LOAD···········0x03 | 12 | ··LOAD···········0x035e6c·0x00036e6c·0x00036e6c·0x0041c·0x00424·RW··0x1000 |
| 13 | ··DYNAMIC········0x03 | 13 | ··DYNAMIC········0x035e88·0x00036e88·0x00036e88·0x00110·0x00110·RW··0x4 |
| 14 | ··NOTE···········0x0001a8·0x000001a8·0x000001a8·0x00044·0x00044·R···0x4 | 14 | ··NOTE···········0x0001a8·0x000001a8·0x000001a8·0x00044·0x00044·R···0x4 |
| 15 | ··GNU_EH_FRAME···0x02 | 15 | ··GNU_EH_FRAME···0x02e398·0x0002e398·0x0002e398·0x00814·0x00814·R···0x4 |
| 16 | ··GNU_STACK······0x000000·0x00000000·0x00000000·0x00000·0x00000·RW··0x10 | 16 | ··GNU_STACK······0x000000·0x00000000·0x00000000·0x00000·0x00000·RW··0x10 |
| 17 | ··GNU_RELRO······0x03 | 17 | ··GNU_RELRO······0x035e6c·0x00036e6c·0x00036e6c·0x00194·0x00194·R···0x1 |
| 18 | ·Section·to·Segment·mapping: | 18 | ·Section·to·Segment·mapping: |
| 19 | ··Segment·Sections... | 19 | ··Segment·Sections... |
| 20 | ···00····· | 20 | ···00····· |
| 21 | ···01·····.interp· | 21 | ···01·····.interp· |
| 22 | ···02·····.interp·.note.gnu.build-id·.note.ABI-tag·.gnu.hash·.dynsym·.dynstr·.gnu.version·.gnu.version_r·.rel.dyn·.rel.plt· | 22 | ···02·····.interp·.note.gnu.build-id·.note.ABI-tag·.gnu.hash·.dynsym·.dynstr·.gnu.version·.gnu.version_r·.rel.dyn·.rel.plt· |
| 23 | ···03·····.init·.plt·.plt.got·.text·.fini· | 23 | ···03·····.init·.plt·.plt.got·.text·.fini· |
| Offset 1, 39 lines modified | Offset 1, 39 lines modified | ||
| 1 | There·are·30·section·headers,·starting·at·offset·0x3 | 1 | There·are·30·section·headers,·starting·at·offset·0x36420: |
| 2 | Section·Headers: | 2 | Section·Headers: |
| 3 | ··[Nr]·Name··············Type············Addr·····Off····Size···ES·Flg·Lk·Inf·Al | 3 | ··[Nr]·Name··············Type············Addr·····Off····Size···ES·Flg·Lk·Inf·Al |
| 4 | ··[·0]···················NULL············00000000·000000·000000·00······0···0··0 | 4 | ··[·0]···················NULL············00000000·000000·000000·00······0···0··0 |
| 5 | ··[·1]·.interp···········PROGBITS········00000194·000194·000013·00···A··0···0··1 | 5 | ··[·1]·.interp···········PROGBITS········00000194·000194·000013·00···A··0···0··1 |
| 6 | ··[·2]·.note.gnu.build-id·NOTE············000001a8·0001a8·000024·00···A··0···0··4 | 6 | ··[·2]·.note.gnu.build-id·NOTE············000001a8·0001a8·000024·00···A··0···0··4 |
| 7 | ··[·3]·.note.ABI-tag·····NOTE············000001cc·0001cc·000020·00···A··0···0··4 | 7 | ··[·3]·.note.ABI-tag·····NOTE············000001cc·0001cc·000020·00···A··0···0··4 |
| 8 | ··[·4]·.gnu.hash·········GNU_HASH········000001ec·0001ec·00073 | 8 | ··[·4]·.gnu.hash·········GNU_HASH········000001ec·0001ec·00073c·04···A··5···0··4 |
| 9 | ··[·5]·.dynsym···········DYNSYM··········0000092 | 9 | ··[·5]·.dynsym···········DYNSYM··········00000928·000928·0017d0·10···A··6···1··4 |
| 10 | ··[·6]·.dynstr···········STRTAB··········00002 | 10 | ··[·6]·.dynstr···········STRTAB··········000020f8·0020f8·004c2b·00···A··0···0··1 |
| 11 | ··[·7]·.gnu.version······VERSYM··········00006 | 11 | ··[·7]·.gnu.version······VERSYM··········00006d24·006d24·0002fa·02···A··5···0··2 |
| 12 | ··[·8]·.gnu.version_r····VERNEED·········00007 | 12 | ··[·8]·.gnu.version_r····VERNEED·········00007020·007020·000170·00···A··6···3··4 |
| 13 | ··[·9]·.rel.dyn··········REL·············00007 | 13 | ··[·9]·.rel.dyn··········REL·············00007190·007190·000100·08···A··5···0··4 |
| 14 | ··[10]·.rel.plt··········REL·············00007 | 14 | ··[10]·.rel.plt··········REL·············00007290·007290·0004f8·08··AI··5··24··4 |
| 15 | ··[11]·.init·············PROGBITS········00008000·008000·000020·00··AX··0···0··4 | 15 | ··[11]·.init·············PROGBITS········00008000·008000·000020·00··AX··0···0··4 |
| 16 | ··[12]·.plt··············PROGBITS········00008020·008020·000a | 16 | ··[12]·.plt··············PROGBITS········00008020·008020·000a00·04··AX··0···0·16 |
| 17 | ··[13]·.plt.got··········PROGBITS········00008a | 17 | ··[13]·.plt.got··········PROGBITS········00008a20·008a20·000008·08··AX··0···0··8 |
| 18 | ··[14]·.text·············PROGBITS········00008a | 18 | ··[14]·.text·············PROGBITS········00008a30·008a30·023014·00··AX··0···0·16 |
| 19 | ··[15]·.fini·············PROGBITS········0002 | 19 | ··[15]·.fini·············PROGBITS········0002ba44·02ba44·000014·00··AX··0···0··4 |
| 20 | ··[16]·.rodata···········PROGBITS········0002 | 20 | ··[16]·.rodata···········PROGBITS········0002c000·02c000·002396·00···A··0···0·16 |
| 21 | ··[17]·.eh_frame_hdr·····PROGBITS········0002 | 21 | ··[17]·.eh_frame_hdr·····PROGBITS········0002e398·02e398·000814·00···A··0···0··4 |
| 22 | ··[18]·.eh_frame·········PROGBITS········0002 | 22 | ··[18]·.eh_frame·········PROGBITS········0002ebac·02ebac·0054b0·00···A··0···0··4 |
| 23 | ··[19]·.gcc_except_table·PROGBITS········00034 | 23 | ··[19]·.gcc_except_table·PROGBITS········0003405c·03405c·001225·00···A··0···0··4 |
| 24 | ··[20]·.init_array·······INIT_ARRAY······0003 | 24 | ··[20]·.init_array·······INIT_ARRAY······00036e6c·035e6c·000018·04··WA··0···0··4 |
| 25 | ··[21]·.fini_array·······FINI_ARRAY······0003 | 25 | ··[21]·.fini_array·······FINI_ARRAY······00036e84·035e84·000004·04··WA··0···0··4 |
| 26 | ··[22]·.dynamic··········DYNAMIC·········0003 | 26 | ··[22]·.dynamic··········DYNAMIC·········00036e88·035e88·000110·08··WA··6···0··4 |
| 27 | ··[23]·.got··············PROGBITS········0003 | 27 | ··[23]·.got··············PROGBITS········00036f98·035f98·00005c·04··WA··0···0··4 |
| 28 | ··[24]·.got.plt··········PROGBITS········0003 | 28 | ··[24]·.got.plt··········PROGBITS········00036ff4·035ff4·000288·04··WA··0···0··4 |
| 29 | ··[25]·.data·············PROGBITS········0003 | 29 | ··[25]·.data·············PROGBITS········0003727c·03627c·00000c·00··WA··0···0··4 |
| 30 | ··[26]·.bss··············NOBITS··········0003 | 30 | ··[26]·.bss··············NOBITS··········00037288·036288·000008·00··WA··0···0··1 |
| 31 | ··[27]·.gnu_debugaltlink·PROGBITS········00000000·03 | 31 | ··[27]·.gnu_debugaltlink·PROGBITS········00000000·036288·000041·00······0···0··1 |
| 32 | ··[28]·.gnu_debuglink····PROGBITS········00000000·03 | 32 | ··[28]·.gnu_debuglink····PROGBITS········00000000·0362cc·000034·00······0···0··4 |
| 33 | ··[29]·.shstrtab·········STRTAB··········00000000·03 | 33 | ··[29]·.shstrtab·········STRTAB··········00000000·036300·00011f·00······0···0··1 |
| 34 | Key·to·Flags: | 34 | Key·to·Flags: |
| 35 | ··W·(write),·A·(alloc),·X·(execute),·M·(merge),·S·(strings),·I·(info), | 35 | ··W·(write),·A·(alloc),·X·(execute),·M·(merge),·S·(strings),·I·(info), |
| 36 | ··L·(link·order),·O·(extra·OS·processing·required),·G·(group),·T·(TLS), | 36 | ··L·(link·order),·O·(extra·OS·processing·required),·G·(group),·T·(TLS), |
| 37 | ··C·(compressed),·x·(unknown),·o·(OS·specific),·E·(exclude), | 37 | ··C·(compressed),·x·(unknown),·o·(OS·specific),·E·(exclude), |
| 38 | ··D·(mbind),·p·(processor·specific) | 38 | ··D·(mbind),·p·(processor·specific) |
| Offset 1, 9 lines modified | Offset 1, 9 lines modified | ||
| 1 | Symbol·table·'.dynsym'·contains·38 | 1 | Symbol·table·'.dynsym'·contains·381·entries: |
| 2 | ···Num:····Value··Size·Type····Bind···Vis······Ndx·Name | 2 | ···Num:····Value··Size·Type····Bind···Vis······Ndx·Name |
| 3 | ·····0:·00000000·····0·NOTYPE··LOCAL··DEFAULT··UND· | 3 | ·····0:·00000000·····0·NOTYPE··LOCAL··DEFAULT··UND· |
| 4 | ·····1:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__printf_chk@GLIBC_2.3.4·(2) | 4 | ·····1:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__printf_chk@GLIBC_2.3.4·(2) |
| 5 | ·····2:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·pclose@GLIBC_2.1·(3) | 5 | ·····2:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·pclose@GLIBC_2.1·(3) |
| 6 | ·····3:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·open@GLIBC_2.0·(4) | 6 | ·····3:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·open@GLIBC_2.0·(4) |
| 7 | ·····4:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSo3putEc@GLIBCXX_3.4·(5) | 7 | ·····4:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSo3putEc@GLIBCXX_3.4·(5) |
| 8 | ·····5:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_Znwj@GLIBCXX_3.4·(5) | 8 | ·····5:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_Znwj@GLIBCXX_3.4·(5) |
| Offset 27, 360 lines modified | Offset 27, 358 lines modified | ||
| 27 | ····23:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTVNSt7__cxx1119basic_istringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21·(8) | 27 | ····23:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTVNSt7__cxx1119basic_istringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21·(8) |
| 28 | ····24:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN8BamTools12BamAlignmentC1Ev | 28 | ····24:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN8BamTools12BamAlignmentC1Ev |
| 29 | ····25:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt8ios_baseD2Ev@GLIBCXX_3.4·(5) | 29 | ····25:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt8ios_baseD2Ev@GLIBCXX_3.4·(5) |
| 30 | ····26:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·realpath@GLIBC_2.3·(9) | 30 | ····26:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·realpath@GLIBC_2.3·(9) |
| 31 | ····27:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE6substrEjj@GLIBCXX_3.4.21·(8) | 31 | ····27:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE6substrEjj@GLIBCXX_3.4.21·(8) |
| 32 | ····28:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTTNSt7__cxx1118basic_stringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21·(8) | 32 | ····28:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTTNSt7__cxx1118basic_stringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21·(8) |
| 33 | ····29:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt17__throw_bad_allocv@GLIBCXX_3.4·(5) | 33 | ····29:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt17__throw_bad_allocv@GLIBCXX_3.4·(5) |
| 34 | ····30:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEC1ERKS4_jj@GLIBCXX_3.4.21·(8) | ||
| 35 | ····3 | 34 | ····30:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN4Json5ValueixEPKc |
| 36 | ····3 | 35 | ····31:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE10_M_replaceEjjPKcj@GLIBCXX_3.4.21·(8) |
| 37 | ····3 | 36 | ····32:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__cxa_begin_catch@CXXABI_1.3·(10) |
| 38 | ····3 | 37 | ····33:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE7reserveEj@GLIBCXX_3.4.21·(8) |
| 39 | ····3 | 38 | ····34:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·calloc@GLIBC_2.0·(4) |
| 40 | ····3 | 39 | ····35:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN4Json5ValueC1ENS_9ValueTypeE |
| 41 | ····3 | 40 | ····36:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN8BamTools14BamMultiReader16GetNextAlignmentERNS_12BamAlignmentE |
| 42 | ····3 | 41 | ····37:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEC1ERKS4_@GLIBCXX_3.4.21·(8) |
| 43 | ····3 | 42 | ····38:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1119basic_istringstreamIcSt11char_traitsIcESaIcEED1Ev@GLIBCXX_3.4.21·(8) |
| 44 | ···· | 43 | ····39:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·getpid@GLIBC_2.0·(4) |
| 45 | ····4 | 44 | ····40:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·isspace@GLIBC_2.0·(4) |
| 46 | ····4 | 45 | ····41:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·fgets@GLIBC_2.0·(4) |
| 47 | ····4 | 46 | ····42:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN4Json5ValueD1Ev |
| 48 | ····4 | 47 | ····43:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·fwrite@GLIBC_2.0·(4) |
| 49 | ····4 | 48 | ····44:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE14_M_replace_auxEjjjc@GLIBCXX_3.4.21·(8) |
| 50 | ····4 | 49 | ····45:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·memcpy@GLIBC_2.0·(4) |
| 51 | ····4 | 50 | ····46:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt20__throw_length_errorPKc@GLIBCXX_3.4·(5) |
| 52 | ····4 | 51 | ····47:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE9_M_assignERKS4_@GLIBCXX_3.4.21·(8) |
| 53 | ····4 | 52 | ····48:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·malloc@GLIBC_2.0·(4) |
| 54 | ···· | 53 | ····49:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·strlen@GLIBC_2.0·(4) |
| 55 | ····5 | 54 | ····50:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK4Json5Value3getEPKcRKS0_ |
| 56 | ····5 | 55 | ····51:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·munmap@GLIBC_2.0·(4) |
| 57 | ····5 | 56 | ····52:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEC1EOS4_@GLIBCXX_3.4.21·(8) |
| 58 | ····5 | 57 | ····53:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·getcwd@GLIBC_2.0·(4) |
| 59 | ····5 | 58 | ····54:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__sprintf_chk@GLIBC_2.3.4·(2) |
| 60 | ····5 | 59 | ····55:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK4Json5Value9asCStringEv |
| 61 | ····5 | 60 | ····56:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__snprintf_chk@GLIBC_2.3.4·(2) |
| 62 | ····5 | 61 | ····57:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSirsERi@GLIBCXX_3.4·(5) |
| 63 | ····5 | 62 | ····58:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN8BamTools14BamMultiReader4OpenERKSt6vectorINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS7_EE |
| 64 | ···· | 63 | ····59:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTVSt15basic_streambufIcSt11char_traitsIcEE@GLIBCXX_3.4·(5) |
| 65 | ····6 | 64 | ····60:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·stdout@GLIBC_2.0·(4) |
| 66 | ····6 | 65 | ····61:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSi10_M_extractIdEERSiRT_@GLIBCXX_3.4.9·(11) |
| 67 | ····6 | 66 | ····62:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSo9_M_insertImEERSoT_@GLIBCXX_3.4.9·(11) |
| 68 | ····6 | 67 | ····63:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSo5flushEv@GLIBCXX_3.4·(5) |
| 69 | ····6 | 68 | ····64:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__cxa_atexit@GLIBC_2.1.3·(7) |
| 70 | ····6 | 69 | ····65:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZdlPvj@CXXABI_1.3.9·(12) |
| 71 | ····6 | 70 | ····66:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt18_Rb_tree_incrementPSt18_Rb_tree_node_base@GLIBCXX_3.4·(5) |
| 72 | ····6 | 71 | ····67:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK4Json5Value8asDoubleEv |
| 73 | ····6 | 72 | ····68:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt19__throw_logic_errorPKc@GLIBCXX_3.4·(5) |
| 74 | ···· | 73 | ····69:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__libc_start_main@GLIBC_2.34·(13) |
| 75 | ····7 | 74 | ····70:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTTSt14basic_ofstreamIcSt11char_traitsIcEE@GLIBCXX_3.4·(5) |
| 76 | ····7 | 75 | ····71:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK8BamTools14BamMultiReader9GetHeaderEv |
| 77 | ····7 | 76 | ····72:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1118basic_stringstreamIcSt11char_traitsIcESaIcEED1Ev@GLIBCXX_3.4.21·(8) |
| 78 | ····74:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE6insertEjPKc@GLIBCXX_3.4.21·(8) | ||
| 79 | ····7 | 77 | ····73:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·toupper@GLIBC_2.0·(4) |
| 80 | ····7 | 78 | ····74:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt28__throw_bad_array_new_lengthv@GLIBCXX_3.4.29·(14) |
| 81 | ····7 | 79 | ····75:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·tolower@GLIBC_2.0·(4) |
| 82 | ····7 | 80 | ····76:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_Znaj@GLIBCXX_3.4·(5) |
| 83 | ····7 | 81 | ····77:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK8BamTools22SamReadGroupDictionary3EndEv |
| 84 | ···· | 82 | ····78:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__errno_location@GLIBC_2.0·(4) |
| 85 | ···· | 83 | ····79:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·strncpy@GLIBC_2.0·(4) |
| 86 | ····8 | 84 | ····80:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·memcmp@GLIBC_2.0·(4) |
| 87 | ····8 | 85 | ····81:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNKSt3tr14hashINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEEclES6_@GLIBCXX_3.4.21·(8) |
| 88 | ····8 | 86 | ····82:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·strrchr@GLIBC_2.0·(4) |
| 89 | ····8 | 87 | ····83:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt13basic_filebufIcSt11char_traitsIcEE4openEPKcSt13_Ios_Openmode@GLIBCXX_3.4·(5) |
| 90 | ····8 | 88 | ····84:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·stat@GLIBC_2.33·(15) |
| 91 | ····8 | 89 | ····85:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK4Json5Value8isMemberEPKc |
| 92 | ····8 | 90 | ····86:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·getenv@GLIBC_2.0·(4) |
| 93 | ····8 | 91 | ····87:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK8BamTools12BamAlignment14GetEndPositionEbb |
| 94 | ···· | 92 | ····88:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·strchr@GLIBC_2.0·(4) |
| 95 | ···· | 93 | ····89:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTTNSt7__cxx1119basic_istringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21·(8) |
| 96 | ····9 | 94 | ····90:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSo9_M_insertIlEERSoT_@GLIBCXX_3.4.9·(11) |
| 97 | ····9 | 95 | ····91:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__isoc99_sscanf@GLIBC_2.7·(16) |
| 98 | ····9 | 96 | ····92:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTVSt14basic_ifstreamIcSt11char_traitsIcEE@GLIBCXX_3.4·(5) |
| 99 | ····9 | 97 | ····93:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE9_M_appendEPKcj@GLIBCXX_3.4.21·(8) |
| 100 | ····9 | 98 | ····94:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK4Json5Value8isStringEv |
| 101 | ····9 | 99 | ····95:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZStlsISt11char_traitsIcEERSt13basic_ostreamIcT_ES5_PKc@GLIBCXX_3.4·(5) |
| 102 | ····9 | 100 | ····96:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN8BamTools12BamAlignment13BuildCharDataEv |
| 103 | ····9 | 101 | ····97:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE4findEcj@GLIBCXX_3.4.21·(8) |
| 104 | ··· | 102 | ····98:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN8BamTools14BamMultiReader21SetExplicitMergeOrderENS0_10MergeOrderE |
| 105 | ··· | 103 | ····99:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12_M_constructEjc@GLIBCXX_3.4.21·(8) |
| 106 | ···10 | 104 | ···100:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTVNSt7__cxx1118basic_stringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21·(8) |
| 107 | ···10 | 105 | ···101:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt13basic_filebufIcSt11char_traitsIcEEC1Ev@GLIBCXX_3.4·(5) |
| 108 | ···10 | 106 | ···102:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt18_Rb_tree_decrementPSt18_Rb_tree_node_base@GLIBCXX_3.4·(5) |
| 109 | ···10 | 107 | ···103:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK8BamTools12BamAlignment11IsValidSizeERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES8_ |
| 110 | ···10 | 108 | ···104:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__stack_chk_fail@GLIBC_2.4·(17) |
| 111 | ···10 | 109 | ···105:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNKSt5ctypeIcE13_M_widen_initEv@GLIBCXX_3.4.11·(18) |
| 112 | ···10 | 110 | ···106:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·strtol@GLIBC_2.0·(4) |
| 113 | ···10 | 111 | ···107:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt18_Rb_tree_incrementPKSt18_Rb_tree_node_base@GLIBCXX_3.4·(5) |
| 114 | ···1 | 112 | ···108:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN4Json5ValueaSEOS0_ |
| 115 | ···1 | 113 | ···109:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK8BamTools12BamAlignment7FindTagERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERPcRKjRj |
| 116 | ···11 | 114 | ···110:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE10_M_disposeEv@GLIBCXX_3.4.21·(8) |
| 117 | ···11 | 115 | ···111:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·free@GLIBC_2.0·(4) |
| 118 | ···11 | 116 | ···112:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt16__throw_bad_castv@GLIBCXX_3.4·(5) |
| 119 | ···11 | 117 | ···113:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZSt4cout@GLIBCXX_3.4·(5) |
| 120 | ···11 | 118 | ···114:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZdaPv@GLIBCXX_3.4·(5) |
| 121 | ···11 | 119 | ···115:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt16__ostream_insertIcSt11char_traitsIcEERSt13basic_ostreamIT_T0_ES6_PKS3_i@GLIBCXX_3.4.9·(11) |
| 122 | ···11 | 120 | ···116:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE17find_first_not_ofEcj@GLIBCXX_3.4.21·(8) |
| 123 | ···11 | 121 | ···117:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt9basic_iosIcSt11char_traitsIcEE4initEPSt15basic_streambufIcS1_E@GLIBCXX_3.4·(5) |
| 124 | ···1 | 122 | ···118:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·popen@GLIBC_2.1·(3) |
| 125 | ···1 | 123 | ···119:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·fgetc@GLIBC_2.0·(4) |
| 126 | ···12 | 124 | ···120:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK8BamTools12BamAlignment15IsReverseStrandEv |
| 127 | ···12 | 125 | ···121:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt6localeD1Ev@GLIBCXX_3.4·(5) |
| 128 | ···12 | 126 | ···122:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN4Json5ValueaSERKS0_ |
| 129 | ···12 | 127 | ···123:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·exit@GLIBC_2.0·(4) |
| 130 | ···12 | 128 | ···124:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__cxa_rethrow@CXXABI_1.3·(10) |
| 131 | ···12 | 129 | ···125:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·strerror@GLIBC_2.0·(4) |
| 132 | ···12 | 130 | ···126:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt14basic_ofstreamIcSt11char_traitsIcEED1Ev@GLIBCXX_3.4·(5) |
| 133 | ···12 | 131 | ···127:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK4Json5Value5asIntEv |
| 134 | ···1 | 132 | ···128:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt24__throw_out_of_range_fmtPKcz@GLIBCXX_3.4.20·(19) |
| 135 | ···1 | 133 | ···129:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTVSt13basic_filebufIcSt11char_traitsIcEE@GLIBCXX_3.4·(5) |
| 136 | ···13 | 134 | ···130:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·feof@GLIBC_2.0·(4) |
| 137 | ···13 | 135 | ···131:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·puts@GLIBC_2.0·(4) |
| 138 | ···13 | 136 | ···132:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt8ios_base4InitC1Ev@GLIBCXX_3.4·(5) |
| 139 | ···13 | 137 | ···133:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·perror@GLIBC_2.0·(4) |
| 140 | ···13 | 138 | ···134:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTVSt14basic_ofstreamIcSt11char_traitsIcEE@GLIBCXX_3.4·(5) |
| 141 | ···13 | 139 | ···135:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt13basic_filebufIcSt11char_traitsIcEED1Ev@GLIBCXX_3.4·(5) |
| 142 | ···13 | 140 | ···136:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·readlink@GLIBC_2.0·(4) |
| 143 | ···13 | 141 | ···137:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE6resizeEjc@GLIBCXX_3.4.21·(8) |
| Max diff block lines reached; -1/78834 bytes (-0.00%) of diff not shown. | |||
| Offset 1, 200 lines modified | Offset 1, 197 lines modified | ||
| 1 | Relocation·section·'.rel.dyn'·at·offset·0x7 | 1 | Relocation·section·'.rel.dyn'·at·offset·0x7190·contains·32·entries: |
| 2 | ·Offset·····Info····Type················Sym.·Value··Symbol's·Name | 2 | ·Offset·····Info····Type················Sym.·Value··Symbol's·Name |
| 3 | 0003 | 3 | 00036e6c··00000008·R_386_RELATIVE········ |
| 4 | 0003 | 4 | 00036e70··00000008·R_386_RELATIVE········ |
| 5 | 0003 | 5 | 00036e74··00000008·R_386_RELATIVE········ |
| 6 | 0003 | 6 | 00036e78··00000008·R_386_RELATIVE········ |
| 7 | 0003 | 7 | 00036e7c··00000008·R_386_RELATIVE········ |
| 8 | 0003 | 8 | 00036e80··00000008·R_386_RELATIVE········ |
| 9 | 0003 | 9 | 00036e84··00000008·R_386_RELATIVE········ |
| 10 | 0003 | 10 | 00036fa8··00000008·R_386_RELATIVE········ |
| 11 | 0003 | 11 | 00037280··00000008·R_386_RELATIVE········ |
| 12 | 0003 | 12 | 00036f98··00000906·R_386_GLOB_DAT·········00000000···__cxa_finalize@GLIBC_2.1.3 |
| 13 | 0003 | 13 | 00036f9c··00000e06·R_386_GLOB_DAT·········00000000···_ZTVSt9basic_iosIcSt11char_traitsIcEE@GLIBCXX_3.4 |
| 14 | 0003 | 14 | 00036fa0··00001706·R_386_GLOB_DAT·········00000000···_ZTVNSt7__cxx1119basic_istringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21 |
| 15 | 0003 | 15 | 00036fa4··00001c06·R_386_GLOB_DAT·········00000000···_ZTTNSt7__cxx1118basic_stringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21 |
| 16 | 0003 | 16 | 00036fac··00003b06·R_386_GLOB_DAT·········00000000···_ZTVSt15basic_streambufIcSt11char_traitsIcEE@GLIBCXX_3.4 |
| 17 | 0003 | 17 | 00036fb0··00003c06·R_386_GLOB_DAT·········00000000···stdout@GLIBC_2.0 |
| 18 | 0003 | 18 | 00036fb4··00004606·R_386_GLOB_DAT·········00000000···_ZTTSt14basic_ofstreamIcSt11char_traitsIcEE@GLIBCXX_3.4 |
| 19 | 0003 | 19 | 00036fb8··00005906·R_386_GLOB_DAT·········00000000···_ZTTNSt7__cxx1119basic_istringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21 |
| 20 | 0003 | 20 | 00036fbc··00005c06·R_386_GLOB_DAT·········00000000···_ZTVSt14basic_ifstreamIcSt11char_traitsIcEE@GLIBCXX_3.4 |
| 21 | 0003 | 21 | 00036fc0··00006406·R_386_GLOB_DAT·········00000000···_ZTVNSt7__cxx1118basic_stringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21 |
| 22 | 0003 | 22 | 00036fc4··00007106·R_386_GLOB_DAT·········00000000···_ZSt4cout@GLIBCXX_3.4 |
| 23 | 0003 | 23 | 00036fc8··00008106·R_386_GLOB_DAT·········00000000···_ZTVSt13basic_filebufIcSt11char_traitsIcEE@GLIBCXX_3.4 |
| 24 | 0003 | 24 | 00036fcc··00008606·R_386_GLOB_DAT·········00000000···_ZTVSt14basic_ofstreamIcSt11char_traitsIcEE@GLIBCXX_3.4 |
| 25 | 0003 | 25 | 00036fd0··00009906·R_386_GLOB_DAT·········00000000···_ITM_deregisterTMCloneTable |
| 26 | 0003 | 26 | 00036fd4··0000a206·R_386_GLOB_DAT·········00000000···_ZNSt3tr18__detail12__prime_listE@GLIBCXX_3.4.10 |
| 27 | 0003 | 27 | 00036fd8··0000a306·R_386_GLOB_DAT·········00000000···stderr@GLIBC_2.0 |
| 28 | 0003 | 28 | 00036fdc··0000a506·R_386_GLOB_DAT·········00000000···__gmon_start__ |
| 29 | 0003 | 29 | 00036fe0··0000aa06·R_386_GLOB_DAT·········00000000···_ITM_registerTMCloneTable |
| 30 | 0003 | 30 | 00036fe4··0000ae06·R_386_GLOB_DAT·········00000000···_ZSt4cerr@GLIBCXX_3.4 |
| 31 | 0003 | 31 | 00036fe8··0000af06·R_386_GLOB_DAT·········00000000···_ZTTSt14basic_ifstreamIcSt11char_traitsIcEE@GLIBCXX_3.4 |
| 32 | 0003 | 32 | 00036fec··0000b106·R_386_GLOB_DAT·········00000000···_ZTVNSt7__cxx1115basic_stringbufIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21 |
| 33 | 0003 | 33 | 00036ff0··0000b606·R_386_GLOB_DAT·········00000000···_ZNSt8ios_base4InitD1Ev@GLIBCXX_3.4 |
| 34 | 0003 | 34 | 00037284··00009001·R_386_32···············00000000···__gxx_personality_v0@CXXABI_1.3 |
| 35 | Relocation·section·'.rel.plt'·at·offset·0x7 | 35 | Relocation·section·'.rel.plt'·at·offset·0x7290·contains·159·entries: |
| 36 | ·Offset·····Info····Type················Sym.·Value··Symbol's·Name | 36 | ·Offset·····Info····Type················Sym.·Value··Symbol's·Name |
| 37 | 0003 | 37 | 00037000··00000107·R_386_JUMP_SLOT········00000000···__printf_chk@GLIBC_2.3.4 |
| 38 | 0003 | 38 | 00037004··00000207·R_386_JUMP_SLOT········00000000···pclose@GLIBC_2.1 |
| 39 | 0003 | 39 | 00037008··00000307·R_386_JUMP_SLOT········00000000···open@GLIBC_2.0 |
| 40 | 0003 | 40 | 0003700c··00000407·R_386_JUMP_SLOT········00000000···_ZNSo3putEc@GLIBCXX_3.4 |
| 41 | 0003 | 41 | 00037010··00000507·R_386_JUMP_SLOT········00000000···_Znwj@GLIBCXX_3.4 |
| 42 | 0003 | 42 | 00037014··00000607·R_386_JUMP_SLOT········00000000···strcat@GLIBC_2.0 |
| 43 | 0003 | 43 | 00037018··00000707·R_386_JUMP_SLOT········00000000···_ZNK8BamTools14BamMultiReader14GetErrorStringB5cxx11Ev |
| 44 | 0003 | 44 | 0003701c··00000807·R_386_JUMP_SLOT········00000000···_ZNSt8__detail15_List_node_base7_M_hookEPS0_@GLIBCXX_3.4.15 |
| 45 | 0003 | 45 | 00037020··00000a07·R_386_JUMP_SLOT········00000000···_ZNK8BamTools12BamAlignment8IsMappedEv |
| 46 | 0003 | 46 | 00037024··00000b07·R_386_JUMP_SLOT········00000000···_ZNSt7__cxx1115basic_stringbufIcSt11char_traitsIcESaIcEE7_M_syncEPcjj@GLIBCXX_3.4.21 |
| 47 | 0003 | 47 | 00037028··00000c07·R_386_JUMP_SLOT········00000000···_ZSt29_Rb_tree_insert_and_rebalancebPSt18_Rb_tree_node_baseS0_RS_@GLIBCXX_3.4 |
| 48 | 0003 | 48 | 0003702c··00000d07·R_386_JUMP_SLOT········00000000···_ZNSdD2Ev@GLIBCXX_3.4 |
| 49 | 0003 | 49 | 00037030··00000f07·R_386_JUMP_SLOT········00000000···_ZN8BamTools14BamMultiReaderD1Ev |
| 50 | 0003 | 50 | 00037034··00001007·R_386_JUMP_SLOT········00000000···_ZNSt13basic_filebufIcSt11char_traitsIcEE5closeEv@GLIBCXX_3.4 |
| 51 | 0003 | 51 | 00037038··00001107·R_386_JUMP_SLOT········00000000···mkdir@GLIBC_2.0 |
| 52 | 0003 | 52 | 0003703c··00001207·R_386_JUMP_SLOT········00000000···_ZNSt14basic_ifstreamIcSt11char_traitsIcEED1Ev@GLIBCXX_3.4 |
| 53 | 0003 | 53 | 00037040··00001307·R_386_JUMP_SLOT········00000000···strstr@GLIBC_2.0 |
| 54 | 0003 | 54 | 00037044··00001407·R_386_JUMP_SLOT········00000000···_ZN8BamTools14BamMultiReader5CloseEv |
| 55 | 0003 | 55 | 00037048··00001507·R_386_JUMP_SLOT········00000000···_ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE7compareEPKc@GLIBCXX_3.4.21 |
| 56 | 0003 | 56 | 0003704c··00001607·R_386_JUMP_SLOT········00000000···_ZNSt8ios_baseC2Ev@GLIBCXX_3.4 |
| 57 | 0003 | 57 | 00037050··00001807·R_386_JUMP_SLOT········00000000···_ZN8BamTools12BamAlignmentC1Ev |
| 58 | 0003 | 58 | 00037054··00001907·R_386_JUMP_SLOT········00000000···_ZNSt8ios_baseD2Ev@GLIBCXX_3.4 |
| 59 | 0003 | 59 | 00037058··00001a07·R_386_JUMP_SLOT········00000000···realpath@GLIBC_2.3 |
| 60 | 0003 | 60 | 0003705c··00001b07·R_386_JUMP_SLOT········00000000···_ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE6substrEjj@GLIBCXX_3.4.21 |
| 61 | 0003 | 61 | 00037060··00001d07·R_386_JUMP_SLOT········00000000···_ZSt17__throw_bad_allocv@GLIBCXX_3.4 |
| 62 | 00038064··00001e07·R_386_JUMP_SLOT········00000000···_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEC1ERKS4_jj@GLIBCXX_3.4.21 | ||
| 63 | 0003 | 62 | 00037064··00001e07·R_386_JUMP_SLOT········00000000···_ZN4Json5ValueixEPKc |
| 64 | 0003 | 63 | 00037068··00001f07·R_386_JUMP_SLOT········00000000···_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE10_M_replaceEjjPKcj@GLIBCXX_3.4.21 |
| 65 | 0003 | 64 | 0003706c··00002007·R_386_JUMP_SLOT········00000000···__cxa_begin_catch@CXXABI_1.3 |
| 66 | 0003 | 65 | 00037070··00002107·R_386_JUMP_SLOT········00000000···_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE7reserveEj@GLIBCXX_3.4.21 |
| 67 | 0003 | 66 | 00037074··00002207·R_386_JUMP_SLOT········00000000···calloc@GLIBC_2.0 |
| 68 | 0003 | 67 | 00037078··00002307·R_386_JUMP_SLOT········00000000···_ZN4Json5ValueC1ENS_9ValueTypeE |
| 69 | 0003 | 68 | 0003707c··00002407·R_386_JUMP_SLOT········00000000···_ZN8BamTools14BamMultiReader16GetNextAlignmentERNS_12BamAlignmentE |
| 70 | 0003 | 69 | 00037080··00002507·R_386_JUMP_SLOT········00000000···_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEC1ERKS4_@GLIBCXX_3.4.21 |
| 71 | 0003 | 70 | 00037084··00002607·R_386_JUMP_SLOT········00000000···_ZNSt7__cxx1119basic_istringstreamIcSt11char_traitsIcESaIcEED1Ev@GLIBCXX_3.4.21 |
| 72 | 0003 | 71 | 00037088··00002707·R_386_JUMP_SLOT········00000000···getpid@GLIBC_2.0 |
| 73 | 0003 | 72 | 0003708c··00002807·R_386_JUMP_SLOT········00000000···isspace@GLIBC_2.0 |
| 74 | 0003 | 73 | 00037090··00002907·R_386_JUMP_SLOT········00000000···fgets@GLIBC_2.0 |
| 75 | 0003 | 74 | 00037094··00002a07·R_386_JUMP_SLOT········00000000···_ZN4Json5ValueD1Ev |
| 76 | 0003 | 75 | 00037098··00002b07·R_386_JUMP_SLOT········00000000···fwrite@GLIBC_2.0 |
| 77 | 0003 | 76 | 0003709c··00002c07·R_386_JUMP_SLOT········00000000···_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE14_M_replace_auxEjjjc@GLIBCXX_3.4.21 |
| 78 | 0003 | 77 | 000370a0··00002d07·R_386_JUMP_SLOT········00000000···memcpy@GLIBC_2.0 |
| 79 | 0003 | 78 | 000370a4··00002e07·R_386_JUMP_SLOT········00000000···_ZSt20__throw_length_errorPKc@GLIBCXX_3.4 |
| 80 | 0003 | 79 | 000370a8··00002f07·R_386_JUMP_SLOT········00000000···_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE9_M_assignERKS4_@GLIBCXX_3.4.21 |
| 81 | 0003 | 80 | 000370ac··00003007·R_386_JUMP_SLOT········00000000···malloc@GLIBC_2.0 |
| 82 | 0003 | 81 | 000370b0··00003107·R_386_JUMP_SLOT········00000000···strlen@GLIBC_2.0 |
| 83 | 0003 | 82 | 000370b4··00003207·R_386_JUMP_SLOT········00000000···_ZNK4Json5Value3getEPKcRKS0_ |
| 84 | 0003 | 83 | 000370b8··00003307·R_386_JUMP_SLOT········00000000···munmap@GLIBC_2.0 |
| 85 | 0003 | 84 | 000370bc··00003407·R_386_JUMP_SLOT········00000000···_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEC1EOS4_@GLIBCXX_3.4.21 |
| 86 | 0003 | 85 | 000370c0··00003507·R_386_JUMP_SLOT········00000000···getcwd@GLIBC_2.0 |
| 87 | 0003 | 86 | 000370c4··00003607·R_386_JUMP_SLOT········00000000···__sprintf_chk@GLIBC_2.3.4 |
| 88 | 0003 | 87 | 000370c8··00003707·R_386_JUMP_SLOT········00000000···_ZNK4Json5Value9asCStringEv |
| 89 | 0003 | 88 | 000370cc··00003807·R_386_JUMP_SLOT········00000000···__snprintf_chk@GLIBC_2.3.4 |
| 90 | 0003 | 89 | 000370d0··00003907·R_386_JUMP_SLOT········00000000···_ZNSirsERi@GLIBCXX_3.4 |
| 91 | 0003 | 90 | 000370d4··00003a07·R_386_JUMP_SLOT········00000000···_ZN8BamTools14BamMultiReader4OpenERKSt6vectorINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS7_EE |
| 92 | 0003 | 91 | 000370d8··00003d07·R_386_JUMP_SLOT········00000000···_ZNSi10_M_extractIdEERSiRT_@GLIBCXX_3.4.9 |
| 93 | 0003 | 92 | 000370dc··00003e07·R_386_JUMP_SLOT········00000000···_ZNSo9_M_insertImEERSoT_@GLIBCXX_3.4.9 |
| 94 | 0003 | 93 | 000370e0··00003f07·R_386_JUMP_SLOT········00000000···_ZNSo5flushEv@GLIBCXX_3.4 |
| 95 | 0003 | 94 | 000370e4··00004007·R_386_JUMP_SLOT········00000000···__cxa_atexit@GLIBC_2.1.3 |
| 96 | 0003 | 95 | 000370e8··00004107·R_386_JUMP_SLOT········00000000···_ZdlPvj@CXXABI_1.3.9 |
| 97 | 0003 | 96 | 000370ec··00004207·R_386_JUMP_SLOT········00000000···_ZSt18_Rb_tree_incrementPSt18_Rb_tree_node_base@GLIBCXX_3.4 |
| 98 | 0003 | 97 | 000370f0··00004307·R_386_JUMP_SLOT········00000000···_ZNK4Json5Value8asDoubleEv |
| 99 | 0003 | 98 | 000370f4··00004407·R_386_JUMP_SLOT········00000000···_ZSt19__throw_logic_errorPKc@GLIBCXX_3.4 |
| 100 | 0003 | 99 | 000370f8··00004507·R_386_JUMP_SLOT········00000000···__libc_start_main@GLIBC_2.34 |
| 101 | 0003 | 100 | 000370fc··00004707·R_386_JUMP_SLOT········00000000···_ZNK8BamTools14BamMultiReader9GetHeaderEv |
| 102 | 0003 | 101 | 00037100··00004807·R_386_JUMP_SLOT········00000000···_ZNSt7__cxx1118basic_stringstreamIcSt11char_traitsIcESaIcEED1Ev@GLIBCXX_3.4.21 |
| 103 | 00038108··00004a07·R_386_JUMP_SLOT········00000000···_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE6insertEjPKc@GLIBCXX_3.4.21 | ||
| 104 | 0003 | 102 | 00037104··00004907·R_386_JUMP_SLOT········00000000···toupper@GLIBC_2.0 |
| 105 | 0003 | 103 | 00037108··00004a07·R_386_JUMP_SLOT········00000000···_ZSt28__throw_bad_array_new_lengthv@GLIBCXX_3.4.29 |
| 106 | 0003 | 104 | 0003710c··00004b07·R_386_JUMP_SLOT········00000000···tolower@GLIBC_2.0 |
| 107 | 0003 | 105 | 00037110··00004c07·R_386_JUMP_SLOT········00000000···_Znaj@GLIBCXX_3.4 |
| 108 | 0003 | 106 | 00037114··00004d07·R_386_JUMP_SLOT········00000000···_ZNK8BamTools22SamReadGroupDictionary3EndEv |
| 109 | 0003 | 107 | 00037118··00004e07·R_386_JUMP_SLOT········00000000···__errno_location@GLIBC_2.0 |
| 110 | 0003 | 108 | 0003711c··00004f07·R_386_JUMP_SLOT········00000000···strncpy@GLIBC_2.0 |
| 111 | 0003 | 109 | 00037120··00005007·R_386_JUMP_SLOT········00000000···memcmp@GLIBC_2.0 |
| 112 | 0003 | 110 | 00037124··00005107·R_386_JUMP_SLOT········00000000···_ZNKSt3tr14hashINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEEclES6_@GLIBCXX_3.4.21 |
| 113 | 0003 | 111 | 00037128··00005207·R_386_JUMP_SLOT········00000000···strrchr@GLIBC_2.0 |
| 114 | 0003 | 112 | 0003712c··00005307·R_386_JUMP_SLOT········00000000···_ZNSt13basic_filebufIcSt11char_traitsIcEE4openEPKcSt13_Ios_Openmode@GLIBCXX_3.4 |
| 115 | 0003 | 113 | 00037130··00005407·R_386_JUMP_SLOT········00000000···stat@GLIBC_2.33 |
| 116 | 0003 | 114 | 00037134··00005507·R_386_JUMP_SLOT········00000000···_ZNK4Json5Value8isMemberEPKc |
| 117 | 0003 | 115 | 00037138··00005607·R_386_JUMP_SLOT········00000000···getenv@GLIBC_2.0 |
| 118 | 0003 | 116 | 0003713c··00005707·R_386_JUMP_SLOT········00000000···_ZNK8BamTools12BamAlignment14GetEndPositionEbb |
| 119 | 0003 | 117 | 00037140··00005807·R_386_JUMP_SLOT········00000000···strchr@GLIBC_2.0 |
| 120 | 0003 | 118 | 00037144··00005a07·R_386_JUMP_SLOT········00000000···_ZNSo9_M_insertIlEERSoT_@GLIBCXX_3.4.9 |
| 121 | 0003 | 119 | 00037148··00005b07·R_386_JUMP_SLOT········00000000···__isoc99_sscanf@GLIBC_2.7 |
| 122 | 0003 | 120 | 0003714c··00005d07·R_386_JUMP_SLOT········00000000···_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE9_M_appendEPKcj@GLIBCXX_3.4.21 |
| 123 | 0003 | 121 | 00037150··00005e07·R_386_JUMP_SLOT········00000000···_ZNK4Json5Value8isStringEv |
| 124 | 0003 | 122 | 00037154··00005f07·R_386_JUMP_SLOT········00000000···_ZStlsISt11char_traitsIcEERSt13basic_ostreamIcT_ES5_PKc@GLIBCXX_3.4 |
| 125 | 0003 | 123 | 00037158··00006007·R_386_JUMP_SLOT········00000000···_ZN8BamTools12BamAlignment13BuildCharDataEv |
| Max diff block lines reached; -1/36305 bytes (-0.00%) of diff not shown. | |||
| Offset 1, 33 lines modified | Offset 1, 33 lines modified | ||
| 1 | Dynamic·section·at·offset·0x3 | 1 | Dynamic·section·at·offset·0x35e88·contains·30·entries: |
| 2 | ··Tag········Type·························Name/Value | 2 | ··Tag········Type·························Name/Value |
| 3 | ·0x00000001·(NEEDED)·····················Shared·library:·[libbamtools.so.2.5.2] | 3 | ·0x00000001·(NEEDED)·····················Shared·library:·[libbamtools.so.2.5.2] |
| 4 | ·0x00000001·(NEEDED)·····················Shared·library:·[libjsoncpp.so.25] | 4 | ·0x00000001·(NEEDED)·····················Shared·library:·[libjsoncpp.so.25] |
| 5 | ·0x00000001·(NEEDED)·····················Shared·library:·[libstdc++.so.6] | 5 | ·0x00000001·(NEEDED)·····················Shared·library:·[libstdc++.so.6] |
| 6 | ·0x00000001·(NEEDED)·····················Shared·library:·[libgcc_s.so.1] | 6 | ·0x00000001·(NEEDED)·····················Shared·library:·[libgcc_s.so.1] |
| 7 | ·0x00000001·(NEEDED)·····················Shared·library:·[libc.so.6] | 7 | ·0x00000001·(NEEDED)·····················Shared·library:·[libc.so.6] |
| 8 | ·0x0000000c·(INIT)·······················0x8000 | 8 | ·0x0000000c·(INIT)·······················0x8000 |
| 9 | ·0x0000000d·(FINI)·······················0x2 | 9 | ·0x0000000d·(FINI)·······················0x2ba44 |
| 10 | ·0x00000019·(INIT_ARRAY)·················0x3 | 10 | ·0x00000019·(INIT_ARRAY)·················0x36e6c |
| 11 | ·0x0000001b·(INIT_ARRAYSZ)···············24·(bytes) | 11 | ·0x0000001b·(INIT_ARRAYSZ)···············24·(bytes) |
| 12 | ·0x0000001a·(FINI_ARRAY)·················0x3 | 12 | ·0x0000001a·(FINI_ARRAY)·················0x36e84 |
| 13 | ·0x0000001c·(FINI_ARRAYSZ)···············4·(bytes) | 13 | ·0x0000001c·(FINI_ARRAYSZ)···············4·(bytes) |
| 14 | ·0x6ffffef5·(GNU_HASH)···················0x1ec | 14 | ·0x6ffffef5·(GNU_HASH)···················0x1ec |
| 15 | ·0x00000005·(STRTAB)·····················0x2 | 15 | ·0x00000005·(STRTAB)·····················0x20f8 |
| 16 | ·0x00000006·(SYMTAB)·····················0x92 | 16 | ·0x00000006·(SYMTAB)·····················0x928 |
| 17 | ·0x0000000a·(STRSZ)······················19 | 17 | ·0x0000000a·(STRSZ)······················19499·(bytes) |
| 18 | ·0x0000000b·(SYMENT)·····················16·(bytes) | 18 | ·0x0000000b·(SYMENT)·····················16·(bytes) |
| 19 | ·0x00000015·(DEBUG)······················0x0 | 19 | ·0x00000015·(DEBUG)······················0x0 |
| 20 | ·0x00000003·(PLTGOT)·····················0x3 | 20 | ·0x00000003·(PLTGOT)·····················0x36ff4 |
| 21 | ·0x00000002·(PLTRELSZ)···················12 | 21 | ·0x00000002·(PLTRELSZ)···················1272·(bytes) |
| 22 | ·0x00000014·(PLTREL)·····················REL | 22 | ·0x00000014·(PLTREL)·····················REL |
| 23 | ·0x00000017·(JMPREL)·····················0x7 | 23 | ·0x00000017·(JMPREL)·····················0x7290 |
| 24 | ·0x00000011·(REL)························0x7 | 24 | ·0x00000011·(REL)························0x7190 |
| 25 | ·0x00000012·(RELSZ)······················256·(bytes) | 25 | ·0x00000012·(RELSZ)······················256·(bytes) |
| 26 | ·0x00000013·(RELENT)·····················8·(bytes) | 26 | ·0x00000013·(RELENT)·····················8·(bytes) |
| 27 | ·0x6ffffffb·(FLAGS_1)····················Flags:·PIE | 27 | ·0x6ffffffb·(FLAGS_1)····················Flags:·PIE |
| 28 | ·0x6ffffffe·(VERNEED)····················0x7 | 28 | ·0x6ffffffe·(VERNEED)····················0x7020 |
| 29 | ·0x6fffffff·(VERNEEDNUM)·················3 | 29 | ·0x6fffffff·(VERNEEDNUM)·················3 |
| 30 | ·0x6ffffff0·(VERSYM)·····················0x6 | 30 | ·0x6ffffff0·(VERSYM)·····················0x6d24 |
| 31 | ·0x6ffffffa·(RELCOUNT)···················9 | 31 | ·0x6ffffffa·(RELCOUNT)···················9 |
| 32 | ·0x00000000·(NULL)·······················0x0 | 32 | ·0x00000000·(NULL)·······················0x0 |
| Offset 1, 8 lines modified | Offset 1, 8 lines modified | ||
| 1 | Displaying·notes·found·in:·.note.gnu.build-id | 1 | Displaying·notes·found·in:·.note.gnu.build-id |
| 2 | ··Owner················Data·size·» Description | 2 | ··Owner················Data·size·» Description |
| 3 | ··GNU··················0x00000014» NT_GNU_BUILD_ID·(unique·build·ID·bitstring)» ····Build·ID:· | 3 | ··GNU··················0x00000014» NT_GNU_BUILD_ID·(unique·build·ID·bitstring)» ····Build·ID:·7f881d3d0ddd19d7d9be275b50257cc1b12b65cc |
| 4 | Displaying·notes·found·in:·.note.ABI-tag | 4 | Displaying·notes·found·in:·.note.ABI-tag |
| 5 | ··Owner················Data·size·» Description | 5 | ··Owner················Data·size·» Description |
| 6 | ··GNU··················0x00000010» NT_GNU_ABI_TAG·(ABI·version·tag)» ····OS:·Linux,·ABI:·3.2.0 | 6 | ··GNU··················0x00000010» NT_GNU_ABI_TAG·(ABI·version·tag)» ····OS:·Linux,·ABI:·3.2.0 |
| Offset 1, 57 lines modified | Offset 1, 57 lines modified | ||
| 1 | Version·symbols·section·'.gnu.version'·contains·38 | 1 | Version·symbols·section·'.gnu.version'·contains·381·entries: |
| 2 | ·Addr:·0x0000000000006 | 2 | ·Addr:·0x0000000000006d24··Offset:·0x00006d24··Link:·5·(.dynsym) |
| 3 | ··000:···0·(*local*)·······2·(GLIBC_2.3.4)···3·(GLIBC_2.1)·····4·(GLIBC_2.0)·· | 3 | ··000:···0·(*local*)·······2·(GLIBC_2.3.4)···3·(GLIBC_2.1)·····4·(GLIBC_2.0)·· |
| 4 | ··004:···5·(GLIBCXX_3.4)···5·(GLIBCXX_3.4)···4·(GLIBC_2.0)·····1·(*global*)··· | 4 | ··004:···5·(GLIBCXX_3.4)···5·(GLIBCXX_3.4)···4·(GLIBC_2.0)·····1·(*global*)··· |
| 5 | ··008:···6·(GLIBCXX_3.4.15)····7·(GLIBC_2.1.3)···1·(*global*)······8·(GLIBCXX_3.4.21)· | 5 | ··008:···6·(GLIBCXX_3.4.15)····7·(GLIBC_2.1.3)···1·(*global*)······8·(GLIBCXX_3.4.21)· |
| 6 | ··00c:···5·(GLIBCXX_3.4)···5·(GLIBCXX_3.4)···5·(GLIBCXX_3.4)···1·(*global*)··· | 6 | ··00c:···5·(GLIBCXX_3.4)···5·(GLIBCXX_3.4)···5·(GLIBCXX_3.4)···1·(*global*)··· |
| 7 | ··010:···5·(GLIBCXX_3.4)···4·(GLIBC_2.0)·····5·(GLIBCXX_3.4)···4·(GLIBC_2.0)·· | 7 | ··010:···5·(GLIBCXX_3.4)···4·(GLIBC_2.0)·····5·(GLIBCXX_3.4)···4·(GLIBC_2.0)·· |
| 8 | ··014:···1·(*global*)······8·(GLIBCXX_3.4.21)····5·(GLIBCXX_3.4)···8·(GLIBCXX_3.4.21)· | 8 | ··014:···1·(*global*)······8·(GLIBCXX_3.4.21)····5·(GLIBCXX_3.4)···8·(GLIBCXX_3.4.21)· |
| 9 | ··018:···1·(*global*)······5·(GLIBCXX_3.4)···9·(GLIBC_2.3)·····8·(GLIBCXX_3.4.21)· | 9 | ··018:···1·(*global*)······5·(GLIBCXX_3.4)···9·(GLIBC_2.3)·····8·(GLIBCXX_3.4.21)· |
| 10 | ··01c:···8·(GLIBCXX_3.4.21)····5·(GLIBCXX_3.4)··· | 10 | ··01c:···8·(GLIBCXX_3.4.21)····5·(GLIBCXX_3.4)···1·(*global*)······8·(GLIBCXX_3.4.21)· |
| 11 | ··020:···8·(GLIBCXX_3.4.21)····a·(CXXABI_1.3)····8·(GLIBCXX_3.4.21)····4·(GLIBC_2.0)·· | ||
| 12 | ··024:···1·(*global*)······1·(*global*)······8·(GLIBCXX_3.4.21)····8·(GLIBCXX_3.4.21)· | ||
| 13 | ··028:···4·(GLIBC_2.0)·····4·(GLIBC_2.0)·····4·(GLIBC_2.0)·····1·(*global*)··· | ||
| 14 | ··02c:···4·(GLIBC_2.0)·····8·(GLIBCXX_3.4.21)····4·(GLIBC_2.0)·····5·(GLIBCXX_3.4) | ||
| 15 | ··0 | 11 | ··020:···a·(CXXABI_1.3)····8·(GLIBCXX_3.4.21)····4·(GLIBC_2.0)·····1·(*global*)··· |
| 16 | ··034:···4·(GLIBC_2.0)·····8·(GLIBCXX_3.4.21)····4·(GLIBC_2.0)·····2·(GLIBC_2.3.4) | ||
| 17 | ··038:···1·(*global*)······2·(GLIBC_2.3.4)···5·(GLIBCXX_3.4)···1·(*global*)··· | ||
| 18 | ··03c:···5·(GLIBCXX_3.4)···4·(GLIBC_2.0)·····b·(GLIBCXX_3.4.9)···b·(GLIBCXX_3.4.9) | ||
| 19 | ··040:···5·(GLIBCXX_3.4)···7·(GLIBC_2.1.3)···c·(CXXABI_1.3.9)···5·(GLIBCXX_3.4) | ||
| 20 | ··044:···1·(*global*)······5·(GLIBCXX_3.4)···d·(GLIBC_2.34)····5·(GLIBCXX_3.4) | ||
| 21 | ··0 | 12 | ··024:···1·(*global*)······8·(GLIBCXX_3.4.21)····8·(GLIBCXX_3.4.21)····4·(GLIBC_2.0)·· |
| 13 | ··028:···4·(GLIBC_2.0)·····4·(GLIBC_2.0)·····1·(*global*)······4·(GLIBC_2.0)·· | ||
| 14 | ··02c:···8·(GLIBCXX_3.4.21)····4·(GLIBC_2.0)·····5·(GLIBCXX_3.4)···8·(GLIBCXX_3.4.21)· | ||
| 15 | ··030:···4·(GLIBC_2.0)·····4·(GLIBC_2.0)·····1·(*global*)······4·(GLIBC_2.0)·· | ||
| 22 | ··0 | 16 | ··034:···8·(GLIBCXX_3.4.21)····4·(GLIBC_2.0)·····2·(GLIBC_2.3.4)···1·(*global*)··· |
| 23 | ··0 | 17 | ··038:···2·(GLIBC_2.3.4)···5·(GLIBCXX_3.4)···1·(*global*)······5·(GLIBCXX_3.4) |
| 18 | ··03c:···4·(GLIBC_2.0)·····b·(GLIBCXX_3.4.9)···b·(GLIBCXX_3.4.9)···5·(GLIBCXX_3.4) | ||
| 19 | ··040:···7·(GLIBC_2.1.3)···c·(CXXABI_1.3.9)···5·(GLIBCXX_3.4)···1·(*global*)··· | ||
| 20 | ··044:···5·(GLIBCXX_3.4)···d·(GLIBC_2.34)····5·(GLIBCXX_3.4)···1·(*global*)··· | ||
| 21 | ··048:···8·(GLIBCXX_3.4.21)····4·(GLIBC_2.0)·····e·(GLIBCXX_3.4.29)····4·(GLIBC_2.0)·· | ||
| 22 | ··04c:···5·(GLIBCXX_3.4)···1·(*global*)······4·(GLIBC_2.0)·····4·(GLIBC_2.0)·· | ||
| 23 | ··050:···4·(GLIBC_2.0)·····8·(GLIBCXX_3.4.21)····4·(GLIBC_2.0)·····5·(GLIBCXX_3.4) | ||
| 24 | ··054:···f·(GLIBC_2.33)····1·(*global*)······4·(GLIBC_2.0)·····1·(*global*)··· | ||
| 25 | ··058:···4·(GLIBC_2.0)·····8·(GLIBCXX_3.4.21)····b·(GLIBCXX_3.4.9)··10·(GLIBC_2.7)·· | ||
| 26 | ··05c:···5·(GLIBCXX_3.4)···8·(GLIBCXX_3.4.21)····1·(*global*)······5·(GLIBCXX_3.4) | ||
| 27 | ··060:···1·(*global*)······8·(GLIBCXX_3.4.21)····1·(*global*)······8·(GLIBCXX_3.4.21)· | ||
| 24 | ··0 | 28 | ··064:···8·(GLIBCXX_3.4.21)····5·(GLIBCXX_3.4)···5·(GLIBCXX_3.4)···1·(*global*)··· |
| 25 | ··0 | 29 | ··068:··11·(GLIBC_2.4)····12·(GLIBCXX_3.4.11)····4·(GLIBC_2.0)·····5·(GLIBCXX_3.4) |
| 30 | ··06c:···1·(*global*)······1·(*global*)······8·(GLIBCXX_3.4.21)····4·(GLIBC_2.0)·· | ||
| 31 | ··070:···5·(GLIBCXX_3.4)···5·(GLIBCXX_3.4)···5·(GLIBCXX_3.4)···b·(GLIBCXX_3.4.9) | ||
| 32 | ··074:···8·(GLIBCXX_3.4.21)····5·(GLIBCXX_3.4)···3·(GLIBC_2.1)·····4·(GLIBC_2.0)·· | ||
| 33 | ··078:···1·(*global*)······5·(GLIBCXX_3.4)···1·(*global*)······4·(GLIBC_2.0)·· | ||
| 34 | ··07c:···a·(CXXABI_1.3)····4·(GLIBC_2.0)·····5·(GLIBCXX_3.4)···1·(*global*)··· | ||
| 35 | ··080:··13·(GLIBCXX_3.4.20)····5·(GLIBCXX_3.4)···4·(GLIBC_2.0)·····4·(GLIBC_2.0)·· | ||
| 26 | ··0 | 36 | ··084:···5·(GLIBCXX_3.4)···4·(GLIBC_2.0)·····5·(GLIBCXX_3.4)···5·(GLIBCXX_3.4) |
| 37 | ··088:···4·(GLIBC_2.0)·····8·(GLIBCXX_3.4.21)····b·(GLIBCXX_3.4.9)···a·(CXXABI_1.3)· | ||
| 38 | ··08c:···4·(GLIBC_2.0)·····2·(GLIBC_2.3.4)···4·(GLIBC_2.0)·····4·(GLIBC_2.0)·· | ||
| 39 | ··090:···a·(CXXABI_1.3)····f·(GLIBC_2.33)····4·(GLIBC_2.0)·····5·(GLIBCXX_3.4) | ||
| 40 | ··094:···8·(GLIBCXX_3.4.21)····1·(*global*)······8·(GLIBCXX_3.4.21)····4·(GLIBC_2.0)·· | ||
| 41 | ··098:···5·(GLIBCXX_3.4)···1·(*global*)·····14·(GCC_3.0)·······8·(GLIBCXX_3.4.21)· | ||
| 42 | ··09c:···1·(*global*)······3·(GLIBC_2.1)·····4·(GLIBC_2.0)····10·(GLIBC_2.7)·· | ||
| 43 | ··0a0:···5·(GLIBCXX_3.4)···1·(*global*)·····15·(GLIBCXX_3.4.10)····4·(GLIBC_2.0)·· | ||
| 44 | ··0a4:···4·(GLIBC_2.0)·····1·(*global*)······1·(*global*)······4·(GLIBC_2.0)·· | ||
| 27 | ··0 | 45 | ··0a8:···1·(*global*)······4·(GLIBC_2.0)·····1·(*global*)······8·(GLIBCXX_3.4.21)· |
| 28 | ··064:···1·(*global*)······8·(GLIBCXX_3.4.21)····8·(GLIBCXX_3.4.21)····5·(GLIBCXX_3.4) | ||
| 29 | ··068:···5·(GLIBCXX_3.4)···1·(*global*)·····11·(GLIBC_2.4)····12·(GLIBCXX_3.4.11)· | ||
| 30 | ··06c:···4·(GLIBC_2.0)·····5·(GLIBCXX_3.4)···1·(*global*)······1·(*global*)··· | ||
| 31 | ··0 | 46 | ··0ac:···8·(GLIBCXX_3.4.21)····4·(GLIBC_2.0)·····5·(GLIBCXX_3.4)···5·(GLIBCXX_3.4) |
| 32 | ··074:···5·(GLIBCXX_3.4)···b·(GLIBCXX_3.4.9)···8·(GLIBCXX_3.4.21)····5·(GLIBCXX_3.4) | ||
| 33 | ··078:···3·(GLIBC_2.1)·····4·(GLIBC_2.0)·····1·(*global*)······5·(GLIBCXX_3.4) | ||
| 34 | ··07c:···1·(*global*)······4·(GLIBC_2.0)·····a·(CXXABI_1.3)····4·(GLIBC_2.0)·· | ||
| 35 | ··080:···5·(GLIBCXX_3.4)···1·(*global*)·····13·(GLIBCXX_3.4.20)····5·(GLIBCXX_3.4) | ||
| 36 | ··084:···4·(GLIBC_2.0)·····4·(GLIBC_2.0)·····5·(GLIBCXX_3.4)···4·(GLIBC_2.0)·· | ||
| 37 | ··088:···5·(GLIBCXX_3.4)···5·(GLIBCXX_3.4)···4·(GLIBC_2.0)·····8·(GLIBCXX_3.4.21)· | ||
| 38 | ··08c:···b·(GLIBCXX_3.4.9)···a·(CXXABI_1.3)····4·(GLIBC_2.0)·····2·(GLIBC_2.3.4) | ||
| 39 | ··090:···4·(GLIBC_2.0)·····4·(GLIBC_2.0)·····a·(CXXABI_1.3)····f·(GLIBC_2.33)· | ||
| 40 | ··094:···4·(GLIBC_2.0)·····5·(GLIBCXX_3.4)···8·(GLIBCXX_3.4.21)····1·(*global*)··· | ||
| 41 | ··098:···8·(GLIBCXX_3.4.21)····4·(GLIBC_2.0)·····5·(GLIBCXX_3.4)···1·(*global*)··· | ||
| 42 | ··09c:··14·(GCC_3.0)·······8·(GLIBCXX_3.4.21)····1·(*global*)······3·(GLIBC_2.1)·· | ||
| 43 | ··0a0:···4·(GLIBC_2.0)····10·(GLIBC_2.7)·····5·(GLIBCXX_3.4)···1·(*global*)··· | ||
| 44 | ··0a4:··15·(GLIBCXX_3.4.10)····4·(GLIBC_2.0)·····4·(GLIBC_2.0)·····1·(*global*)··· | ||
| 45 | ··0a8:···1·(*global*)······4·(GLIBC_2.0)·····1·(*global*)······4·(GLIBC_2.0)·· | ||
| 46 | ··0ac:···1·(*global*)······8·(GLIBCXX_3.4.21)····8·(GLIBCXX_3.4.21)····8·(GLIBCXX_3.4.21)· | ||
| 47 | ··0b0:···4·(GLIBC_2.0)····· | 47 | ··0b0:···4·(GLIBC_2.0)·····8·(GLIBCXX_3.4.21)····8·(GLIBCXX_3.4.21)····4·(GLIBC_2.0)·· |
| 48 | ··0b4:···8·(GLIBCXX_3.4.21)····8·(GLIBCXX_3.4.21)····4·(GLIBC_2.0)·····3·(GLIBC_2.1)·· | ||
| 49 | ··0b | 48 | ··0b4:···3·(GLIBC_2.1)·····5·(GLIBCXX_3.4)···5·(GLIBCXX_3.4)···1·(*global*)··· |
| 49 | ··0b8:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | ||
| 50 | ··0bc:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 50 | ··0bc:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 51 | ··0c0:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 51 | ··0c0:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 52 | ··0c4:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 52 | ··0c4:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 53 | ··0c8:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 53 | ··0c8:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 54 | ··0cc:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 54 | ··0cc:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 55 | ··0d0:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 55 | ··0d0:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 56 | ··0d4:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 56 | ··0d4:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| Offset 92, 18 lines modified | Offset 92, 18 lines modified | ||
| 92 | ··160:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 92 | ··160:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 93 | ··164:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 93 | ··164:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 94 | ··168:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 94 | ··168:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 95 | ··16c:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 95 | ··16c:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 96 | ··170:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 96 | ··170:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 97 | ··174:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 97 | ··174:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 98 | ··178:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 98 | ··178:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 99 | ··17c:···1·(*global*)··· | 99 | ··17c:···1·(*global*)··· |
| 100 | Version·needs·section·'.gnu.version_r'·contains·3·entries: | 100 | Version·needs·section·'.gnu.version_r'·contains·3·entries: |
| 101 | ·Addr:·0x0000000000007 | 101 | ·Addr:·0x0000000000007020··Offset:·0x00007020··Link:·6·(.dynstr) |
| 102 | ··000000:·Version:·1··File:·libgcc_s.so.1··Cnt:·1 | 102 | ··000000:·Version:·1··File:·libgcc_s.so.1··Cnt:·1 |
| 103 | ··0x0010:···Name:·GCC_3.0··Flags:·none··Version:·20 | 103 | ··0x0010:···Name:·GCC_3.0··Flags:·none··Version:·20 |
| 104 | ··0x0020:·Version:·1··File:·libstdc++.so.6··Cnt:·10 | 104 | ··0x0020:·Version:·1··File:·libstdc++.so.6··Cnt:·10 |
| 105 | ··0x0030:···Name:·GLIBCXX_3.4.10··Flags:·none··Version:·21 | 105 | ··0x0030:···Name:·GLIBCXX_3.4.10··Flags:·none··Version:·21 |
| 106 | ··0x0040:···Name:·GLIBCXX_3.4.20··Flags:·none··Version:·19 | 106 | ··0x0040:···Name:·GLIBCXX_3.4.20··Flags:·none··Version:·19 |
| 107 | ··0x0050:···Name:·GLIBCXX_3.4.11··Flags:·none··Version:·18 | 107 | ··0x0050:···Name:·GLIBCXX_3.4.11··Flags:·none··Version:·18 |
| 108 | ··0x0060:···Name:·GLIBCXX_3.4.29··Flags:·none··Version:·14 | 108 | ··0x0060:···Name:·GLIBCXX_3.4.29··Flags:·none··Version:·14 |
| Offset 8, 15 lines modified | Offset 8, 15 lines modified | ||
| 8 | ··Data·alignment·factor:·-4 | 8 | ··Data·alignment·factor:·-4 |
| 9 | ··Return·address·column:·8 | 9 | ··Return·address·column:·8 |
| 10 | ··Augmentation·data:·····1b | 10 | ··Augmentation·data:·····1b |
| 11 | ··DW_CFA_def_cfa:·r4·(esp)·ofs·4 | 11 | ··DW_CFA_def_cfa:·r4·(esp)·ofs·4 |
| 12 | ··DW_CFA_offset:·r8·(eip)·at·cfa-4 | 12 | ··DW_CFA_offset:·r8·(eip)·at·cfa-4 |
| 13 | ··DW_CFA_undefined:·r8·(eip) | 13 | ··DW_CFA_undefined:·r8·(eip) |
| 14 | 00000018·00000010·0000001c·FDE·cie=00000000·pc=0000a3 | 14 | 00000018·00000010·0000001c·FDE·cie=00000000·pc=0000a390..0000a3bc |
| 15 | ··DW_CFA_nop | 15 | ··DW_CFA_nop |
| 16 | ··DW_CFA_nop | 16 | ··DW_CFA_nop |
| 17 | ··DW_CFA_nop | 17 | ··DW_CFA_nop |
| 18 | 0000002c·00000014·00000000·CIE | 18 | 0000002c·00000014·00000000·CIE |
| 19 | ··Version:···············1 | 19 | ··Version:···············1 |
| 20 | ··Augmentation:··········"zR" | 20 | ··Augmentation:··········"zR" |
| Offset 25, 11512 lines modified | Offset 25, 11598 lines modified | ||
| 25 | ··Return·address·column:·8 | 25 | ··Return·address·column:·8 |
| 26 | ··Augmentation·data:·····1b | 26 | ··Augmentation·data:·····1b |
| 27 | ··DW_CFA_def_cfa:·r4·(esp)·ofs·4 | 27 | ··DW_CFA_def_cfa:·r4·(esp)·ofs·4 |
| 28 | ··DW_CFA_offset:·r8·(eip)·at·cfa-4 | 28 | ··DW_CFA_offset:·r8·(eip)·at·cfa-4 |
| 29 | ··DW_CFA_nop | 29 | ··DW_CFA_nop |
| 30 | ··DW_CFA_nop | 30 | ··DW_CFA_nop |
| 31 | 00000044·00000020·0000001c·FDE·cie=0000002c·pc=00008020..00008a | 31 | 00000044·00000020·0000001c·FDE·cie=0000002c·pc=00008020..00008a20 |
| 32 | ··DW_CFA_def_cfa_offset:·8 | 32 | ··DW_CFA_def_cfa_offset:·8 |
| 33 | ··DW_CFA_advance_loc:·6·to·00008026 | 33 | ··DW_CFA_advance_loc:·6·to·00008026 |
| 34 | ··DW_CFA_def_cfa_offset:·12 | 34 | ··DW_CFA_def_cfa_offset:·12 |
| 35 | ··DW_CFA_advance_loc:·10·to·00008030 | 35 | ··DW_CFA_advance_loc:·10·to·00008030 |
| 36 | ··DW_CFA_def_cfa_expression·(DW_OP_breg4·(esp):·4;·DW_OP_breg8·(eip):·0;·DW_OP_lit15;·DW_OP_and;·DW_OP_lit11;·DW_OP_ge;·DW_OP_lit2;·DW_OP_shl;·DW_OP_plus) | 36 | ··DW_CFA_def_cfa_expression·(DW_OP_breg4·(esp):·4;·DW_OP_breg8·(eip):·0;·DW_OP_lit15;·DW_OP_and;·DW_OP_lit11;·DW_OP_ge;·DW_OP_lit2;·DW_OP_shl;·DW_OP_plus) |
| 37 | 00000068·00000010·00000040·FDE·cie=0000002c·pc=00008a | 37 | 00000068·00000010·00000040·FDE·cie=0000002c·pc=00008a20..00008a28 |
| 38 | ··DW_CFA_nop | 38 | ··DW_CFA_nop |
| 39 | ··DW_CFA_nop | 39 | ··DW_CFA_nop |
| 40 | ··DW_CFA_nop | 40 | ··DW_CFA_nop |
| 41 | 0000007c·00000010·00000054·FDE·cie=0000002c·pc=0000be | 41 | 0000007c·00000010·00000054·FDE·cie=0000002c·pc=0000be10..0000be16 |
| 42 | ··DW_CFA_nop | 42 | ··DW_CFA_nop |
| 43 | ··DW_CFA_nop | 43 | ··DW_CFA_nop |
| 44 | ··DW_CFA_nop | 44 | ··DW_CFA_nop |
| 45 | 00000090·00000038·00000068·FDE·cie=0000002c·pc=0000a | 45 | 00000090·00000038·00000068·FDE·cie=0000002c·pc=0000a4c0..0000a4f9 |
| 46 | ··DW_CFA_advance_loc:·1·to·0000a | 46 | ··DW_CFA_advance_loc:·1·to·0000a4c1 |
| 47 | ··DW_CFA_def_cfa_offset:·8 | 47 | ··DW_CFA_def_cfa_offset:·8 |
| 48 | ··DW_CFA_offset:·r7·(edi)·at·cfa-8 | 48 | ··DW_CFA_offset:·r7·(edi)·at·cfa-8 |
| 49 | ··DW_CFA_advance_loc:·1·to·0000a | 49 | ··DW_CFA_advance_loc:·1·to·0000a4c2 |
| 50 | ··DW_CFA_def_cfa_offset:·12 | 50 | ··DW_CFA_def_cfa_offset:·12 |
| 51 | ··DW_CFA_offset:·r6·(esi)·at·cfa-12 | 51 | ··DW_CFA_offset:·r6·(esi)·at·cfa-12 |
| 52 | ··DW_CFA_advance_loc:·3·to·0000a | 52 | ··DW_CFA_advance_loc:·3·to·0000a4c5 |
| 53 | ··DW_CFA_def_cfa_offset:·16 | 53 | ··DW_CFA_def_cfa_offset:·16 |
| 54 | ··DW_CFA_offset:·r3·(ebx)·at·cfa-16 | 54 | ··DW_CFA_offset:·r3·(ebx)·at·cfa-16 |
| 55 | ··DW_CFA_advance_loc:·29·to·0000a | 55 | ··DW_CFA_advance_loc:·29·to·0000a4e2 |
| 56 | ··DW_CFA_def_cfa_offset:·20 | 56 | ··DW_CFA_def_cfa_offset:·20 |
| 57 | ··DW_CFA_advance_loc:·1·to·0000a | 57 | ··DW_CFA_advance_loc:·1·to·0000a4e3 |
| 58 | ··DW_CFA_def_cfa_offset:·24 | 58 | ··DW_CFA_def_cfa_offset:·24 |
| 59 | ··DW_CFA_advance_loc:·1·to·0000a | 59 | ··DW_CFA_advance_loc:·1·to·0000a4e4 |
| 60 | ··DW_CFA_def_cfa_offset:·28 | 60 | ··DW_CFA_def_cfa_offset:·28 |
| 61 | ··DW_CFA_advance_loc:·1·to·0000a | 61 | ··DW_CFA_advance_loc:·1·to·0000a4e5 |
| 62 | ··DW_CFA_def_cfa_offset:·32 | 62 | ··DW_CFA_def_cfa_offset:·32 |
| 63 | ··DW_CFA_advance_loc:·8·to·0000a | 63 | ··DW_CFA_advance_loc:·8·to·0000a4ed |
| 64 | ··DW_CFA_def_cfa_offset:·16 | 64 | ··DW_CFA_def_cfa_offset:·16 |
| 65 | ··DW_CFA_advance_loc:·9·to·0000a | 65 | ··DW_CFA_advance_loc:·9·to·0000a4f6 |
| 66 | ··DW_CFA_restore:·r3·(ebx) | 66 | ··DW_CFA_restore:·r3·(ebx) |
| 67 | ··DW_CFA_def_cfa_offset:·12 | 67 | ··DW_CFA_def_cfa_offset:·12 |
| 68 | ··DW_CFA_advance_loc:·1·to·0000a | 68 | ··DW_CFA_advance_loc:·1·to·0000a4f7 |
| 69 | ··DW_CFA_restore:·r6·(esi) | 69 | ··DW_CFA_restore:·r6·(esi) |
| 70 | ··DW_CFA_def_cfa_offset:·8 | 70 | ··DW_CFA_def_cfa_offset:·8 |
| 71 | ··DW_CFA_advance_loc:·1·to·0000a | 71 | ··DW_CFA_advance_loc:·1·to·0000a4f8 |
| 72 | ··DW_CFA_restore:·r7·(edi) | 72 | ··DW_CFA_restore:·r7·(edi) |
| 73 | ··DW_CFA_def_cfa_offset:·4 | 73 | ··DW_CFA_def_cfa_offset:·4 |
| 74 | ··DW_CFA_nop | 74 | ··DW_CFA_nop |
| 75 | 000000cc·00000030·000000a4·FDE·cie=0000002c·pc=0000a5 | 75 | 000000cc·00000030·000000a4·FDE·cie=0000002c·pc=0000a500..0000a58a |
| 76 | ··DW_CFA_advance_loc:·1·to·0000a5 | 76 | ··DW_CFA_advance_loc:·1·to·0000a501 |
| 77 | ··DW_CFA_def_cfa_offset:·8 | 77 | ··DW_CFA_def_cfa_offset:·8 |
| 78 | ··DW_CFA_offset:·r6·(esi)·at·cfa-8 | 78 | ··DW_CFA_offset:·r6·(esi)·at·cfa-8 |
| 79 | ··DW_CFA_advance_loc:·1·to·0000a5 | 79 | ··DW_CFA_advance_loc:·1·to·0000a502 |
| 80 | ··DW_CFA_def_cfa_offset:·12 | 80 | ··DW_CFA_def_cfa_offset:·12 |
| 81 | ··DW_CFA_offset:·r3·(ebx)·at·cfa-12 | 81 | ··DW_CFA_offset:·r3·(ebx)·at·cfa-12 |
| 82 | ··DW_CFA_advance_loc1:· | 82 | ··DW_CFA_advance_loc1:·94·to·0000a560 |
| 83 | ··DW_CFA_remember_state | 83 | ··DW_CFA_remember_state |
| 84 | ··DW_CFA_restore:·r3·(ebx) | 84 | ··DW_CFA_restore:·r3·(ebx) |
| 85 | ··DW_CFA_def_cfa_offset:·8 | 85 | ··DW_CFA_def_cfa_offset:·8 |
| 86 | ··DW_CFA_advance_loc:·1·to·0000a5 | 86 | ··DW_CFA_advance_loc:·1·to·0000a561 |
| 87 | ··DW_CFA_restore:·r6·(esi) | 87 | ··DW_CFA_restore:·r6·(esi) |
| 88 | ··DW_CFA_def_cfa_offset:·4 | 88 | ··DW_CFA_def_cfa_offset:·4 |
| 89 | ··DW_CFA_advance_loc:· | 89 | ··DW_CFA_advance_loc:·7·to·0000a568 |
| 90 | ··DW_CFA_restore_state | 90 | ··DW_CFA_restore_state |
| 91 | ··DW_CFA_advance_loc:·9·to·0000a5 | 91 | ··DW_CFA_advance_loc:·9·to·0000a571 |
| 92 | ··DW_CFA_remember_state | 92 | ··DW_CFA_remember_state |
| 93 | ··DW_CFA_restore:·r3·(ebx) | 93 | ··DW_CFA_restore:·r3·(ebx) |
| 94 | ··DW_CFA_def_cfa_offset:·8 | 94 | ··DW_CFA_def_cfa_offset:·8 |
| 95 | ··DW_CFA_advance_loc:·1·to·0000a5 | 95 | ··DW_CFA_advance_loc:·1·to·0000a572 |
| 96 | ··DW_CFA_restore:·r6·(esi) | 96 | ··DW_CFA_restore:·r6·(esi) |
| 97 | ··DW_CFA_def_cfa_offset:·4 | 97 | ··DW_CFA_def_cfa_offset:·4 |
| 98 | ··DW_CFA_advance_loc:·6·to·0000a5 | 98 | ··DW_CFA_advance_loc:·6·to·0000a578 |
| 99 | ··DW_CFA_restore_state | 99 | ··DW_CFA_restore_state |
| 100 | ··DW_CFA_nop | 100 | ··DW_CFA_nop |
| 101 | ··DW_CFA_nop | 101 | ··DW_CFA_nop |
| 102 | 00000100·00000058·000000d8·FDE·cie=0000002c·pc=0000a5 | 102 | 00000100·00000058·000000d8·FDE·cie=0000002c·pc=0000a590..0000a637 |
| 103 | ··DW_CFA_advance_loc:·1·to·0000a5 | 103 | ··DW_CFA_advance_loc:·1·to·0000a591 |
| 104 | ··DW_CFA_def_cfa_offset:·8 | 104 | ··DW_CFA_def_cfa_offset:·8 |
| 105 | ··DW_CFA_offset:·r5·(ebp)·at·cfa-8 | 105 | ··DW_CFA_offset:·r5·(ebp)·at·cfa-8 |
| 106 | ··DW_CFA_advance_loc:·5·to·0000a5 | 106 | ··DW_CFA_advance_loc:·5·to·0000a596 |
| 107 | ··DW_CFA_def_cfa_offset:·12 | 107 | ··DW_CFA_def_cfa_offset:·12 |
| 108 | ··DW_CFA_offset:·r7·(edi)·at·cfa-12 | 108 | ··DW_CFA_offset:·r7·(edi)·at·cfa-12 |
| 109 | ··DW_CFA_advance_loc:·3·to·0000a5 | 109 | ··DW_CFA_advance_loc:·3·to·0000a599 |
| 110 | ··DW_CFA_def_cfa_offset:·16 | 110 | ··DW_CFA_def_cfa_offset:·16 |
| 111 | ··DW_CFA_offset:·r6·(esi)·at·cfa-16 | 111 | ··DW_CFA_offset:·r6·(esi)·at·cfa-16 |
| 112 | ··DW_CFA_advance_loc:·3·to·0000a5 | 112 | ··DW_CFA_advance_loc:·3·to·0000a59c |
| 113 | ··DW_CFA_def_cfa_offset:·20 | 113 | ··DW_CFA_def_cfa_offset:·20 |
| 114 | ··DW_CFA_offset:·r3·(ebx)·at·cfa-20 | 114 | ··DW_CFA_offset:·r3·(ebx)·at·cfa-20 |
| 115 | ··DW_CFA_advance_loc:·14·to·0000a5 | 115 | ··DW_CFA_advance_loc:·14·to·0000a5aa |
| 116 | ··DW_CFA_def_cfa_offset:·48 | 116 | ··DW_CFA_def_cfa_offset:·48 |
| 117 | ··DW_CFA_advance_loc:·62·to·0000a | 117 | ··DW_CFA_advance_loc:·62·to·0000a5e8 |
| 118 | ··DW_CFA_remember_state | 118 | ··DW_CFA_remember_state |
| 119 | ··DW_CFA_def_cfa_offset:·20 | 119 | ··DW_CFA_def_cfa_offset:·20 |
| 120 | ··DW_CFA_advance_loc:·1·to·0000a | 120 | ··DW_CFA_advance_loc:·1·to·0000a5e9 |
| 121 | ··DW_CFA_restore:·r3·(ebx) | 121 | ··DW_CFA_restore:·r3·(ebx) |
| 122 | ··DW_CFA_def_cfa_offset:·16 | 122 | ··DW_CFA_def_cfa_offset:·16 |
| 123 | ··DW_CFA_advance_loc:·1·to·0000a | 123 | ··DW_CFA_advance_loc:·1·to·0000a5ea |
| 124 | ··DW_CFA_restore:·r6·(esi) | 124 | ··DW_CFA_restore:·r6·(esi) |
| 125 | ··DW_CFA_def_cfa_offset:·12 | 125 | ··DW_CFA_def_cfa_offset:·12 |
| 126 | ··DW_CFA_advance_loc:·1·to·0000a | 126 | ··DW_CFA_advance_loc:·1·to·0000a5eb |
| 127 | ··DW_CFA_restore:·r7·(edi) | 127 | ··DW_CFA_restore:·r7·(edi) |
| 128 | ··DW_CFA_def_cfa_offset:·8 | 128 | ··DW_CFA_def_cfa_offset:·8 |
| 129 | ··DW_CFA_advance_loc:·1·to·0000a | 129 | ··DW_CFA_advance_loc:·1·to·0000a5ec |
| Max diff block lines reached; 568739/574287 bytes (99.03%) of diff not shown. | |||
| Offset 51, 15 lines modified | Offset 51, 14 lines modified | ||
| 51 | _ZNK4Json5Value5asIntEv | 51 | _ZNK4Json5Value5asIntEv |
| 52 | _ZNK4Json5Value9asCStringEv | 52 | _ZNK4Json5Value9asCStringEv |
| 53 | _ZSt28__throw_bad_array_new_lengthv | 53 | _ZSt28__throw_bad_array_new_lengthv |
| 54 | _ZStlsISt11char_traitsIcEERSt13basic_ostreamIcT_ES5_PKc | 54 | _ZStlsISt11char_traitsIcEERSt13basic_ostreamIcT_ES5_PKc |
| 55 | _ZTVSt13basic_filebufIcSt11char_traitsIcEE | 55 | _ZTVSt13basic_filebufIcSt11char_traitsIcEE |
| 56 | _ZSt4cout | 56 | _ZSt4cout |
| 57 | _ZNSt13basic_filebufIcSt11char_traitsIcEE5closeEv | 57 | _ZNSt13basic_filebufIcSt11char_traitsIcEE5closeEv |
| 58 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEC1ERKS4_jj | ||
| 59 | _ZTVSt9basic_iosIcSt11char_traitsIcEE | 58 | _ZTVSt9basic_iosIcSt11char_traitsIcEE |
| 60 | __cxa_end_catch | 59 | __cxa_end_catch |
| 61 | _ZNSt9basic_iosIcSt11char_traitsIcEE4initEPSt15basic_streambufIcS1_E | 60 | _ZNSt9basic_iosIcSt11char_traitsIcEE4initEPSt15basic_streambufIcS1_E |
| 62 | _ZNSo5flushEv | 61 | _ZNSo5flushEv |
| 63 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE10_M_replaceEjjPKcj | 62 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE10_M_replaceEjjPKcj |
| 64 | _ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE17find_first_not_ofEcj | 63 | _ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE17find_first_not_ofEcj |
| 65 | _ZNSt9basic_iosIcSt11char_traitsIcEE5clearESt12_Ios_Iostate | 64 | _ZNSt9basic_iosIcSt11char_traitsIcEE5clearESt12_Ios_Iostate |
| Offset 96, 15 lines modified | Offset 95, 14 lines modified | ||
| 96 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE8_M_eraseEjj | 95 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE8_M_eraseEjj |
| 97 | _ZNSt8ios_baseC2Ev | 96 | _ZNSt8ios_baseC2Ev |
| 98 | _ZNSo9_M_insertIlEERSoT_ | 97 | _ZNSo9_M_insertIlEERSoT_ |
| 99 | _ZSt17__throw_bad_allocv | 98 | _ZSt17__throw_bad_allocv |
| 100 | _ZTTSt14basic_ifstreamIcSt11char_traitsIcEE | 99 | _ZTTSt14basic_ifstreamIcSt11char_traitsIcEE |
| 101 | _ZTTSt14basic_ofstreamIcSt11char_traitsIcEE | 100 | _ZTTSt14basic_ofstreamIcSt11char_traitsIcEE |
| 102 | _ZSt24__throw_out_of_range_fmtPKcz | 101 | _ZSt24__throw_out_of_range_fmtPKcz |
| 103 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE6insertEjPKc | ||
| 104 | _ZSt4cerr | 102 | _ZSt4cerr |
| 105 | _ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE5rfindEcj | 103 | _ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE5rfindEcj |
| 106 | _ZNSt13basic_filebufIcSt11char_traitsIcEEC1Ev | 104 | _ZNSt13basic_filebufIcSt11char_traitsIcEEC1Ev |
| 107 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE14_M_replace_auxEjjjc | 105 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE14_M_replace_auxEjjjc |
| 108 | __gxx_personality_v0 | 106 | __gxx_personality_v0 |
| 109 | _ZNSo3putEc | 107 | _ZNSo3putEc |
| 110 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE9_M_createERjj | 108 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE9_M_createERjj |
| Offset 129, 15 lines modified | Offset 127, 14 lines modified | ||
| 129 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE10_M_disposeEv | 127 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE10_M_disposeEv |
| 130 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE6resizeEjc | 128 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE6resizeEjc |
| 131 | _ZSt16__throw_bad_castv | 129 | _ZSt16__throw_bad_castv |
| 132 | _ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE4findEPKcjj | 130 | _ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE4findEPKcjj |
| 133 | _ZNSolsEi | 131 | _ZNSolsEi |
| 134 | _ZNSo9_M_insertIdEERSoT_ | 132 | _ZNSo9_M_insertIdEERSoT_ |
| 135 | _ZTVSt15basic_streambufIcSt11char_traitsIcEE | 133 | _ZTVSt15basic_streambufIcSt11char_traitsIcEE |
| 136 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE6appendEPKcj | ||
| 137 | _Unwind_Resume | 134 | _Unwind_Resume |
| 138 | _IO_stdin_used | 135 | _IO_stdin_used |
| 139 | __assert_fail | 136 | __assert_fail |
| 140 | __snprintf_chk | 137 | __snprintf_chk |
| 141 | __isoc99_fscanf | 138 | __isoc99_fscanf |
| 142 | __printf_chk | 139 | __printf_chk |
| 143 | __libc_start_main | 140 | __libc_start_main |
| Offset 192, 14 lines modified | Offset 189, 15 lines modified | ||
| 192 | _ZSt16__insertion_sortIN9__gnu_cxx17__normal_iteratorIPPN14TargetsManager14UnmergedTargetESt6vectorIS4_SaIS4_EEEENS0_5__ops15_Iter_comp_iterIPFbS4_S4_EEEEvT_SF_T0_ | 189 | _ZSt16__insertion_sortIN9__gnu_cxx17__normal_iteratorIPPN14TargetsManager14UnmergedTargetESt6vectorIS4_SaIS4_EEEENS0_5__ops15_Iter_comp_iterIPFbS4_S4_EEEEvT_SF_T0_ |
| 193 | _ZN16CoverageBySampleD2Ev | 190 | _ZN16CoverageBySampleD2Ev |
| 194 | _ZSt23__copy_move_backward_a1ILb1EPN13IndelAssembly8CoverageES1_EN9__gnu_cxx11__enable_ifIXsrSt23__is_random_access_iterIT0_NSt15iterator_traitsIS6_E17iterator_categoryEE7__valueESt15_Deque_iteratorIT1_RSC_PSC_EE6__typeES6_S6_SF_ | 191 | _ZSt23__copy_move_backward_a1ILb1EPN13IndelAssembly8CoverageES1_EN9__gnu_cxx11__enable_ifIXsrSt23__is_random_access_iterIT0_NSt15iterator_traitsIS6_E17iterator_categoryEE7__valueESt15_Deque_iteratorIT1_RSC_PSC_EE6__typeES6_S6_SF_ |
| 195 | _ZN7OptArgs9GetOptionERiRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcS8_ | 192 | _ZN7OptArgs9GetOptionERiRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcS8_ |
| 196 | _ZN16CoverageBySample6AbsorbERKS_ | 193 | _ZN16CoverageBySample6AbsorbERKS_ |
| 197 | _ZNSt5dequeIN13IndelAssembly8CoverageESaIS1_EE17_M_reallocate_mapEjb | 194 | _ZNSt5dequeIN13IndelAssembly8CoverageESaIS1_EE17_M_reallocate_mapEjb |
| 198 | _ZN13IndelAssemblyC2EP17IndelAssemblyArgsP15ReferenceReaderP13SampleManager | 195 | _ZN13IndelAssemblyC2EP17IndelAssemblyArgsP15ReferenceReaderP13SampleManager |
| 196 | _ZSt13move_backwardISt15_Deque_iteratorIN13IndelAssembly8CoverageERS2_PS2_ES5_ET0_T_S7_S6_ | ||
| 199 | _ZN13IndelAssembly11WINDOW_SIZEE | 197 | _ZN13IndelAssembly11WINDOW_SIZEE |
| 200 | _ZNSt12_Vector_baseIiSaIiEED1Ev | 198 | _ZNSt12_Vector_baseIiSaIiEED1Ev |
| 201 | _ZN7OptArgs9GetOptionERSt6vectorIdSaIdEERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcSB_c | 199 | _ZN7OptArgs9GetOptionERSt6vectorIdSaIdEERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcSB_c |
| 202 | _ZN13IndelAssembly9AddCountsERN8BamTools12BamAlignmentE | 200 | _ZN13IndelAssembly9AddCountsERN8BamTools12BamAlignmentE |
| 203 | _ZN7OptArgs9GetOptionERdRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcS8_ | 201 | _ZN7OptArgs9GetOptionERdRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcS8_ |
| 204 | _ZNSt5dequeIN13IndelAssembly8CoverageESaIS1_EE15_M_erase_at_endESt15_Deque_iteratorIS1_RS1_PS1_E | 202 | _ZNSt5dequeIN13IndelAssembly8CoverageESaIS1_EE15_M_erase_at_endESt15_Deque_iteratorIS1_RS1_PS1_E |
| 205 | _ZN8Spectrum16DetectLeftAnchorERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEii | 203 | _ZN8Spectrum16DetectLeftAnchorERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEii |
| Offset 257, 18 lines modified | Offset 255, 16 lines modified | ||
| 257 | _ZN15ReferenceReader10InitializeERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE | 255 | _ZN15ReferenceReader10InitializeERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE |
| 258 | _ZN7OptArgs16HandleLongOptionERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERiiPPKc | 256 | _ZN7OptArgs16HandleLongOptionERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERiiPPKc |
| 259 | _ZN13IndelAssembly8PrintVCFERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERKN8Spectrum8TVarCallEiiS5_S5_iii | 257 | _ZN13IndelAssembly8PrintVCFERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERKN8Spectrum8TVarCallEiiS5_S5_iii |
| 260 | _ZN11OptArgumentC2Ev | 258 | _ZN11OptArgumentC2Ev |
| 261 | _ZN7OptArgs17GetFirstIntVectorEcRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES7_c | 259 | _ZN7OptArgs17GetFirstIntVectorEcRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES7_c |
| 262 | _ZN13IndelAssemblyC1EP17IndelAssemblyArgsP15ReferenceReaderP13SampleManager | 260 | _ZN13IndelAssemblyC1EP17IndelAssemblyArgsP15ReferenceReaderP13SampleManager |
| 263 | _ZN7OptArgs12PrintOptionsERSo | 261 | _ZN7OptArgs12PrintOptionsERSo |
| 264 | _ZSt15__copy_move_ditILb1EN13IndelAssembly8CoverageERS1_PS1_St15_Deque_iteratorIS1_S2_S3_EET3_S4_IT0_T1_T2_ESA_S6_ | ||
| 265 | _ZN8BamTools12BamAlignmentC2ERKS0_ | 262 | _ZN8BamTools12BamAlignmentC2ERKS0_ |
| 266 | _ZN11OptArgumentD1Ev | 263 | _ZN11OptArgumentD1Ev |
| 267 | _ZSt24__copy_move_backward_ditILb1EN13IndelAssembly8CoverageERS1_PS1_St15_Deque_iteratorIS1_S2_S3_EET3_S4_IT0_T1_T2_ESA_S6_ | ||
| 268 | _ZNSt3tr110_HashtableINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES6_SaIS6_ESt9_IdentityIS6_ESt8equal_toIS6_ENS_4hashIS6_EENS_8__detail18_Mod_range_hashingENSE_20_Default_ranged_hashENSE_20_Prime_rehash_policyELb0ELb1ELb1EE9_M_rehashEj | 264 | _ZNSt3tr110_HashtableINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES6_SaIS6_ESt9_IdentityIS6_ESt8equal_toIS6_ENS_4hashIS6_EENS_8__detail18_Mod_range_hashingENSE_20_Default_ranged_hashENSE_20_Prime_rehash_policyELb0ELb1ELb1EE9_M_rehashEj |
| 269 | _ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_N8Spectrum5TKmerEESt10_Select1stISA_ESt4lessIS5_ESaISA_EE29_M_get_insert_hint_unique_posESt23_Rb_tree_const_iteratorISA_ERS7_ | 265 | _ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_N8Spectrum5TKmerEESt10_Select1stISA_ESt4lessIS5_ESaISA_EE29_M_get_insert_hint_unique_posESt23_Rb_tree_const_iteratorISA_ERS7_ |
| 270 | _Z5isDirPKc | 266 | _Z5isDirPKc |
| 271 | _ZN7OptArgs17StringToIntVectorERSt6vectorIiSaIiEERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESB_c | 267 | _ZN7OptArgs17StringToIntVectorERSt6vectorIiSaIiEERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESB_c |
| 272 | _ZN7OptArgs9GetOptionERlRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcS8_ | 268 | _ZN7OptArgs9GetOptionERlRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcS8_ |
| 273 | _ZN8Spectrum17getRepeatFreeKmerERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEi | 269 | _ZN8Spectrum17getRepeatFreeKmerERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEi |
| 274 | __data_start | 270 | __data_start |
| Offset 318, 14 lines modified | Offset 314, 16 lines modified | ||
| 318 | _ZN7OptArgs14GetOptArgumentEcRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES7_ | 314 | _ZN7OptArgs14GetOptArgumentEcRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES7_ |
| 319 | _ZNSt6vectorIPN14TargetsManager14UnmergedTargetESaIS2_EE17_M_realloc_insertIJS2_EEEvN9__gnu_cxx17__normal_iteratorIPS2_S4_EEDpOT_ | 315 | _ZNSt6vectorIPN14TargetsManager14UnmergedTargetESaIS2_EE17_M_realloc_insertIJS2_EEEvN9__gnu_cxx17__normal_iteratorIPS2_S4_EEDpOT_ |
| 320 | _ZN17IndelAssemblyArgsC2EiPPc | 316 | _ZN17IndelAssemblyArgsC2EiPPc |
| 321 | _ZN17IndelAssemblyArgsC1EiPPc | 317 | _ZN17IndelAssemblyArgsC1EiPPc |
| 322 | _Z12get_exe_namePc | 318 | _Z12get_exe_namePc |
| 323 | _ZNSt5dequeIN13IndelAssembly8CoverageESaIS1_EE14_M_fill_insertESt15_Deque_iteratorIS1_RS1_PS1_EjRKS1_ | 319 | _ZNSt5dequeIN13IndelAssembly8CoverageESaIS1_EE14_M_fill_insertESt15_Deque_iteratorIS1_RS1_PS1_EjRKS1_ |
| 324 | _ZNSt6vectorIN8BamTools7CigarOpESaIS1_EE17_M_realloc_insertIJS1_EEEvN9__gnu_cxx17__normal_iteratorIPS1_S3_EEDpOT_ | 320 | _ZNSt6vectorIN8BamTools7CigarOpESaIS1_EE17_M_realloc_insertIJS1_EEEvN9__gnu_cxx17__normal_iteratorIPS1_S3_EEDpOT_ |
| 321 | _ZSt4moveISt15_Deque_iteratorIN13IndelAssembly8CoverageERS2_PS2_ES5_ET0_T_S7_S6_ | ||
| 322 | _ZN16CoverageBySample5ClearEi | ||
| 325 | _ZN7OptArgs20GetLeftoverArgumentsERSt6vectorINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS6_EE | 323 | _ZN7OptArgs20GetLeftoverArgumentsERSt6vectorINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS6_EE |
| 326 | _ZN7OptArgs9GetOptionERSt6vectorIiSaIiEERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcSB_c | 324 | _ZN7OptArgs9GetOptionERSt6vectorIiSaIiEERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcSB_c |
| 327 | _ZN7OptArgs9GetOptionERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERKS5_cS8_ | 325 | _ZN7OptArgs9GetOptionERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERKS5_cS8_ |
| 328 | _ZSt3hexRSt8ios_base | 326 | _ZSt3hexRSt8ios_base |
| 329 | _ZNSt5dequeIN13IndelAssembly8CoverageESaIS1_EE24_M_new_elements_at_frontEj | 327 | _ZNSt5dequeIN13IndelAssembly8CoverageESaIS1_EE24_M_new_elements_at_frontEj |
| 330 | _ZN8Spectrum15ApplyCorrectionERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcc | 328 | _ZN8Spectrum15ApplyCorrectionERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcc |
| 331 | _ZSt16__introsort_loopIN9__gnu_cxx17__normal_iteratorIPPN14TargetsManager14UnmergedTargetESt6vectorIS4_SaIS4_EEEEiNS0_5__ops15_Iter_comp_iterIPFbS4_S4_EEEEvT_SF_T0_T1_ | 329 | _ZSt16__introsort_loopIN9__gnu_cxx17__normal_iteratorIPPN14TargetsManager14UnmergedTargetESt6vectorIS4_SaIS4_EEEEiNS0_5__ops15_Iter_comp_iterIPFbS4_S4_EEEEvT_SF_T0_T1_ |
| Offset 442, 15 lines modified | Offset 440, 15 lines modified | ||
| 442 | ERROR:·Cannot·open·fasta·index·file· | 440 | ERROR:·Cannot·open·fasta·index·file· |
| 443 | %1020s» %ld» %ld» %d» %d | 441 | %1020s» %ld» %ld» %d» %d |
| 444 | basic_string::substr | 442 | basic_string::substr |
| 445 | %s:·__pos·(which·is·%zu)·>·this->size()·(which·is·%zu) | 443 | %s:·__pos·(which·is·%zu)·>·this->size()·(which·is·%zu) |
| 446 | deque::_M_new_elements_at_front | 444 | deque::_M_new_elements_at_front |
| 447 | deque::_M_new_elements_at_back | 445 | deque::_M_new_elements_at_back |
| 448 | ?ACATAGCACTCGGCGTGATCTATG | 446 | ?ACATAGCACTCGGCGTGATCTATG |
| 449 | 447 | %*s» %*d» %*d» %*s» %*s»%*s» %*s» %s | |
| 450 | void·TargetsManager::AddExtraTrim(UnmergedTarget&,·char*,·int) | 448 | void·TargetsManager::AddExtraTrim(UnmergedTarget&,·char*,·int) |
| 451 | ./VariantCaller/TargetsManager.cpp | 449 | ./VariantCaller/TargetsManager.cpp |
| 452 | ERROR:·Unable·to·open·target·file· | 450 | ERROR:·Unable·to·open·target·file· |
| 453 | ERROR:·Failed·to·parse·target·file·line· | 451 | ERROR:·Failed·to·parse·target·file·line· |
| 454 | ·has·unrecognized·chromosome·name | 452 | ·has·unrecognized·chromosome·name |
| 455 | ·is·outside·of·reference·sequence·bounds·( | 453 | ·is·outside·of·reference·sequence·bounds·( |
| 456 | ERROR:·No·targets·loaded·from· | 454 | ERROR:·No·targets·loaded·from· |
| Offset 1, 103 lines modified | Offset 1, 103 lines modified | ||
| 1 | Hex·dump·of·section·'.gnu.hash': | 1 | Hex·dump·of·section·'.gnu.hash': |
| 2 | ··0x000001ec·c5000000·b | 2 | ··0x000001ec·c5000000·b7000000·40000000·0b000000·........@....... |
| 3 | ··0x000001fc·10b14855·19a249a2·000e2021·4a300204·..HU..I...·!J0.. | 3 | ··0x000001fc·10b14855·19a249a2·000e2021·4a300204·..HU..I...·!J0.. |
| 4 | ··0x0000020c·00940200·4c000004·00084402· | 4 | ··0x0000020c·00940200·4c000004·00084402·c0000081·....L.....D..... |
| 5 | ··0x0000021c·00202084·8020c000·84015000·06048000·.··..·....P..... | 5 | ··0x0000021c·00202084·8020c000·84015000·06048000·.··..·....P..... |
| 6 | ··0x0000022c·00400002·29c00004·804c0001·4 | 6 | ··0x0000022c·00400002·29c00004·804c0001·46cc2072·.@..)....L..F.·r |
| 7 | ··0x0000023c·84100102·0110044a·09800822·8101c450·.......J..."...P | 7 | ··0x0000023c·84100102·0110044a·09800822·8101c450·.......J..."...P |
| 8 | ··0x0000024c·10000c20·00c00180·1401aa10·20210004·...·........·!.. | 8 | ··0x0000024c·10000c20·00c00180·1401aa10·20210004·...·........·!.. |
| 9 | ··0x0000025c·4809 | 9 | ··0x0000025c·48099280·30151021·30022000·a5829402·H...0..!0.·..... |
| 10 | ··0x0000026c·00005000·4066003c·08702008·00013001·..P.@f.<.p·...0. | 10 | ··0x0000026c·00005000·4066003c·08702008·00013001·..P.@f.<.p·...0. |
| 11 | ··0x0000027c·04000080·80020000·00163000·01cc8000·..........0..... | 11 | ··0x0000027c·04000080·80020000·00163000·01cc8000·..........0..... |
| 12 | ··0x0000028c·2040c031·80202700·02041020·48141001··@.1.·'....·H... | 12 | ··0x0000028c·2040c031·80202700·02041020·48141001··@.1.·'....·H... |
| 13 | ··0x0000029c·02a45060·0822 | 13 | ··0x0000029c·02a45060·08221105·5a0b0a00·1c040580·..P`."..Z....... |
| 14 | ··0x000002ac·00000000·29402022·00100808·08020000·....)@·"........ | 14 | ··0x000002ac·00000000·29402022·00100808·08020000·....)@·"........ |
| 15 | ··0x000002bc·51820203·82a1026a·4008400a·00000000·Q......j@.@..... | 15 | ··0x000002bc·51820203·82a1026a·4008400a·00000000·Q......j@.@..... |
| 16 | ··0x000002cc·20050068·00000000·0b1c4004·80080088··..h......@..... | 16 | ··0x000002cc·20050068·00000000·0b1c4004·80080088··..h......@..... |
| 17 | ··0x000002dc·00208081·38b01c34·02080000·10946440·.·..8..4......d@ | 17 | ··0x000002dc·00208081·38b01c34·02080000·10946440·.·..8..4......d@ |
| 18 | ··0x000002ec·06180024·00100200·00346011·04000080·...$.....4`..... | 18 | ··0x000002ec·06180024·00100200·00346011·04000080·...$.....4`..... |
| 19 | ··0x000002fc·b | 19 | ··0x000002fc·b7000000·b8000000·b9000000·00000000·................ |
| 20 | ··0x0000030c·b | 20 | ··0x0000030c·ba000000·bb000000·bc000000·be000000·................ |
| 21 | ··0x0000031c·00000000·00000000· | 21 | ··0x0000031c·00000000·00000000·bf000000·c0000000·................ |
| 22 | ··0x0000032c·00000000·00000000·00000000·00000000·................ | 22 | ··0x0000032c·00000000·00000000·00000000·00000000·................ |
| 23 | ··0x0000033c·00000000·c | 23 | ··0x0000033c·00000000·c2000000·00000000·00000000·................ |
| 24 | ··0x0000034c·00000000·c | 24 | ··0x0000034c·00000000·c4000000·c5000000·00000000·................ |
| 25 | ··0x0000035c·c | 25 | ··0x0000035c·c6000000·c8000000·c9000000·ca000000·................ |
| 26 | ··0x0000036c·00000000·c | 26 | ··0x0000036c·00000000·cb000000·cc000000·ce000000·................ |
| 27 | ··0x0000037c·d0000000·d1000000·d3000000·d5000000·................ | ||
| 27 | ··0x000003 | 28 | ··0x0000038c·d9000000·db000000·dc000000·de000000·................ |
| 28 | ··0x0000038c·dd000000·df000000·e0000000·e2000000·................ | ||
| 29 | ··0x0000039c· | 29 | ··0x0000039c·df000000·e0000000·00000000·00000000·................ |
| 30 | ··0x000003ac·e | 30 | ··0x000003ac·e2000000·e3000000·e4000000·e5000000·................ |
| 31 | ··0x000003bc·e | 31 | ··0x000003bc·e6000000·00000000·00000000·00000000·................ |
| 32 | ··0x000003cc·e | 32 | ··0x000003cc·e7000000·00000000·00000000·e8000000·................ |
| 33 | ··0x000003dc·00000000·e | 33 | ··0x000003dc·00000000·e9000000·ea000000·eb000000·................ |
| 34 | ··0x000003ec·e | 34 | ··0x000003ec·ec000000·ee000000·ef000000·f1000000·................ |
| 35 | ··0x000003fc·f | 35 | ··0x000003fc·f2000000·00000000·f3000000·00000000·................ |
| 36 | ··0x0000040c·f | 36 | ··0x0000040c·f5000000·f6000000·00000000·f7000000·................ |
| 37 | ··0x0000041c·00000000·f | 37 | ··0x0000041c·00000000·f8000000·fb000000·fc000000·................ |
| 38 | ··0x0000042c· | 38 | ··0x0000042c·fd000000·fe000000·00000000·ff000000·................ |
| 39 | ··0x0000043c·0 | 39 | ··0x0000043c·00000000·00010000·01010000·02010000·................ |
| 40 | ··0x0000044c·00000000·0 | 40 | ··0x0000044c·00000000·06010000·08010000·09010000·................ |
| 41 | ··0x0000045c·00000000·0 | 41 | ··0x0000045c·00000000·0a010000·0b010000·0e010000·................ |
| 42 | ··0x0000046c· | 42 | ··0x0000046c·0f010000·10010000·14010000·00000000·................ |
| 43 | ··0x0000047c·1 | 43 | ··0x0000047c·15010000·16010000·17010000·19010000·................ |
| 44 | ··0x0000048c·1 | 44 | ··0x0000048c·1b010000·1c010000·1f010000·00000000·................ |
| 45 | ··0x0000049c·00000000·00000000·2 | 45 | ··0x0000049c·00000000·00000000·20010000·21010000·........·...!... |
| 46 | ··0x000004ac·2 | 46 | ··0x000004ac·22010000·23010000·24010000·00000000·"...#...$....... |
| 47 | ··0x000004bc· | 47 | ··0x000004bc·25010000·26010000·27010000·28010000·%...&...'...(... |
| 48 | ··0x000004cc·2 | 48 | ··0x000004cc·2b010000·2c010000·2d010000·00000000·+...,...-....... |
| 49 | ··0x000004dc· | 49 | ··0x000004dc·2e010000·00000000·00000000·00000000·................ |
| 50 | ··0x000004ec·3 | 50 | ··0x000004ec·30010000·00000000·31010000·33010000·0.......1...3... |
| 51 | ··0x000004fc·3 | 51 | ··0x000004fc·34010000·35010000·00000000·37010000·4...5.......7... |
| 52 | ··0x0000050c·3f010000·41010000·42010000·44010000·?...A...B...D... | ||
| 53 | ··0x000005 | 52 | ··0x0000050c·3c010000·3e010000·3f010000·41010000·<...>...?...A... |
| 53 | ··0x0000051c·42010000·43010000·44010000·46010000·B...C...D...F... | ||
| 54 | ··0x0000052c·00000000·00000000·00000000·4 | 54 | ··0x0000052c·00000000·00000000·00000000·48010000·............H... |
| 55 | ··0x0000053c·4 | 55 | ··0x0000053c·4a010000·4b010000·4c010000·00000000·J...K...L....... |
| 56 | ··0x0000054c·00000000·4d010000·00000000·4f010000·....M.......O... | ||
| 56 | ··0x000005 | 57 | ··0x0000055c·00000000·50010000·00000000·51010000·....P.......Q... |
| 57 | ··0x0000055c·00000000·53010000·00000000·54010000·....S.......T... | ||
| 58 | ··0x0000056c·00000000·00000000·5 | 58 | ··0x0000056c·00000000·00000000·52010000·53010000·........R...S... |
| 59 | ··0x0000057c·5 | 59 | ··0x0000057c·54010000·55010000·56010000·59010000·T...U...V...Y... |
| 60 | ··0x0000058c·00000000·00000000·5 | 60 | ··0x0000058c·00000000·00000000·5a010000·00000000·........Z....... |
| 61 | ··0x0000059c·5b010000·00000000·5d010000·60010000·[.......]...`... | ||
| 61 | ··0x000005 | 62 | ··0x000005ac·61010000·00000000·62010000·63010000·a.......b...c... |
| 62 | ··0x000005ac·64010000·00000000·65010000·66010000·d.......e...f... | ||
| 63 | ··0x000005bc·6 | 63 | ··0x000005bc·66010000·00000000·00000000·68010000·f...........h... |
| 64 | ··0x000005cc·69010000·6b010000·00000000·6e010000·i...k.......n... | ||
| 64 | ··0x000005 | 65 | ··0x000005dc·6f010000·70010000·00000000·71010000·o...p.......q... |
| 65 | ··0x000005dc·72010000·73010000·00000000·74010000·r...s.......t... | ||
| 66 | ··0x000005ec·00000000·7 | 66 | ··0x000005ec·00000000·73010000·00000000·74010000·....s.......t... |
| 67 | ··0x000005fc·00000000·7 | 67 | ··0x000005fc·00000000·76010000·78010000·7a010000·....v...x...z... |
| 68 | ··0x0000060c·00000000·6d7ff526·d365e330·551109d3·....m..&.e.0U... | 68 | ··0x0000060c·00000000·6d7ff526·d365e330·551109d3·....m..&.e.0U... |
| 69 | ··0x0000061c·1fbf6319·19cebb49·3eca91d6·bbebf180·..c....I>....... | 69 | ··0x0000061c·1fbf6319·19cebb49·3eca91d6·bbebf180·..c....I>....... |
| 70 | ··0x0000062c·7fe222d2·b18ca600·2046a98e·a11d1cce·..".....·F...... | 70 | ··0x0000062c·7fe222d2·b18ca600·2046a98e·a11d1cce·..".....·F...... |
| 71 | ··0x0000063c·742bd885·b1fab1ea·05365e0d· | 71 | ··0x0000063c·742bd885·b1fab1ea·05365e0d·6768731b·t+.......6^.ghs. |
| 72 | ··0x0000064c· | 72 | ··0x0000064c·061bb620·15d1ce1b·efc9a783·859a7391·...·..........s. |
| 73 | ··0x0000065c· | 73 | ··0x0000065c·7fe2e875·cd566e32·6c085c7b·25e7b451·...u.Vn2l.\{%..Q |
| 74 | ··0x0000066c· | 74 | ··0x0000066c·10fba39d·31a57eb8·f94330ac·72b7308c·....1.~..C0.r.0. |
| 75 | ··0x0000067c· | 75 | ··0x0000067c·f5a3a067·fedec839·39436dec·264c0b38·...g...99Cm.&L.8 |
| 76 | ··0x0000068c· | 76 | ··0x0000068c·96e4a0e1·d6e2640c·2963e9bc·6ebb19d0·......d.)c..n... |
| 77 | ··0x0000069c· | 77 | ··0x0000069c·0382b578·6b0943d6·6e7c84f4·ffc0d90f·...xk.C.n|...... |
| 78 | ··0x000006ac· | 78 | ··0x000006ac·e91d61c0·65fdfbae·08f01bcb·c1d68e0f·..a.e........... |
| 79 | ··0x000006bc· | 79 | ··0x000006bc·19d0108b·017e4621·157ddc91·396de8df·.....~F!.}..9m.. |
| 80 | ··0x000006cc· | 80 | ··0x000006cc·57b13b08·d522fc9c·e35176b0·ed34c1cb·W.;.."...Qv..4.. |
| 81 | ··0x000006dc·cd1beafe·3d6fcef9·104e4e12·af331adb·....=o...NN..3.. | 81 | ··0x000006dc·cd1beafe·3d6fcef9·104e4e12·af331adb·....=o...NN..3.. |
| 82 | ··0x000006ec·d142092c·3a9f9144·470d8f35·9d2ed684·.B.,:..DG..5.... | 82 | ··0x000006ec·d142092c·3a9f9144·470d8f35·9d2ed684·.B.,:..DG..5.... |
| 83 | ··0x000006fc·c39a2ed1·26f678e5·4b8d3901·d3c8c643·....&.x.K.9....C | 83 | ··0x000006fc·c39a2ed1·26f678e5·4b8d3901·d3c8c643·....&.x.K.9....C |
| 84 | ··0x0000070c·f5e198b2·370057dd·eaa467f4·ae727be1·....7.W...g..r{. | 84 | ··0x0000070c·f5e198b2·370057dd·eaa467f4·ae727be1·....7.W...g..r{. |
| 85 | ··0x0000071c·33003b3f·c3b6bc49·0df9a215·a5ed2c8b·3.;?...I......,. | 85 | ··0x0000071c·33003b3f·c3b6bc49·0df9a215·a5ed2c8b·3.;?...I......,. |
| 86 | ··0x0000072c·8dd7920e·391d57ba· | 86 | ··0x0000072c·8dd7920e·391d57ba·cf59623e·494cec8d·....9.W..Yb>IL.. |
| 87 | ··0x0000073c· | 87 | ··0x0000073c·24688869·7e279e62·aecd01b5·294d9a69·$h.i~'.b....)M.i |
| 88 | ··0x0000074c· | 88 | ··0x0000074c·ca0ecadf·9b564a55·098e4ec8·3f7ecb57·.....VJU..N.?~.W |
| 89 | ··0x0000075c· | 89 | ··0x0000075c·4b0fed45·581a45f2·34537e49·e1591d71·K..EX.E.4S~I.Y.q |
| 90 | ··0x0000076c· | 90 | ··0x0000076c·5564c8a9·177856dd·0c3a970b·2e78a9e5·Ud...xV..:...x.. |
| 91 | ··0x0000077c· | 91 | ··0x0000077c·8c78f8f7·61133e90·992cf77a·d5ec67f9·.x..a.>..,.z..g. |
| 92 | ··0x0000078c· | 92 | ··0x0000078c·2df237b4·0ab5bf17·2dd5cdf6·724b817a·-.7.....-...rK.z |
| 93 | ··0x0000079c· | 93 | ··0x0000079c·cddd1be9·d5b7d885·4245d5ec·8ebc3869·........BE....8i |
| 94 | ··0x000007ac· | 94 | ··0x000007ac·4ba8e334·59e8edec·75cb7c02·b1678ce3·K..4Y...u.|..g.. |
| 95 | ··0x000007bc· | 95 | ··0x000007bc·0dcaff13·915098a7·3327d885·15bb1625·.....P..3'.....% |
| 96 | ··0x000007cc·554b009d·23e8dc4c·2e6796e3·306e2afa·UK..#..L.g..0n*. | 96 | ··0x000007cc·554b009d·23e8dc4c·2e6796e3·306e2afa·UK..#..L.g..0n*. |
| 97 | ··0x000007dc·0b43c6dd·499dc70b·595edc3f·4b482d4c·.C..I...Y^.?KH-L | 97 | ··0x000007dc·0b43c6dd·499dc70b·595edc3f·4b482d4c·.C..I...Y^.?KH-L |
| 98 | ··0x000007ec·46413e53·3ddee875·71d07ba2·d8e79629·FA>S=..uq.{....) | 98 | ··0x000007ec·46413e53·3ddee875·71d07ba2·d8e79629·FA>S=..uq.{....) |
| 99 | ··0x000007fc·a76c731b·419ae36d·e75ee9bc·2ecea783·.ls.A..m.^...... | 99 | ··0x000007fc·a76c731b·419ae36d·e75ee9bc·2ecea783·.ls.A..m.^...... |
| 100 | ··0x0000080c·2d2be436·1c0dc687·186f103f·c6515fae·-+.6.....o.?.Q_. | 100 | ··0x0000080c·2d2be436·1c0dc687·186f103f·c6515fae·-+.6.....o.?.Q_. |
| 101 | ··0x0000081c·ae199731·3362dbed·6c18dce4·1f1477ec·...13b..l.....w. | 101 | ··0x0000081c·ae199731·3362dbed·6c18dce4·1f1477ec·...13b..l.....w. |
| 102 | ··0x0000082c·613bca60·34673202·a7533092·cdb7ef70·a;.`4g2..S0....p | 102 | ··0x0000082c·613bca60·34673202·a7533092·cdb7ef70·a;.`4g2..S0....p |
| Offset 111, 9 lines modified | Offset 111, 9 lines modified | ||
| 111 | ··0x000008ac·9c0f1451·63b92b9c·bb79cd19·555408e1·...Qc.+..y..UT.. | 111 | ··0x000008ac·9c0f1451·63b92b9c·bb79cd19·555408e1·...Qc.+..y..UT.. |
| 112 | ··0x000008bc·73424da5·36b1ab89·96ec2841·770457dd·sBM.6.....(Aw.W. | 112 | ··0x000008bc·73424da5·36b1ab89·96ec2841·770457dd·sBM.6.....(Aw.W. |
| 113 | ··0x000008cc·3a027f67·3d239e62·575e458b·1ab02282·:..g=#.bW^E...". | 113 | ··0x000008cc·3a027f67·3d239e62·575e458b·1ab02282·:..g=#.bW^E...". |
| 114 | ··0x000008dc·fd79cb57·9e467581·ccdb920e·a330391f·.y.W.Fu......09. | 114 | ··0x000008dc·fd79cb57·9e467581·ccdb920e·a330391f·.y.W.Fu......09. |
| 115 | ··0x000008ec·773a4843·1360c8a9·d57356dd·4eea39af·w:HC.`...sV.N.9. | 115 | ··0x000008ec·773a4843·1360c8a9·d57356dd·4eea39af·w:HC.`...sV.N.9. |
| 116 | ··0x000008fc·6315648d·b1aceb8b·b405420a·0df5da1d·c.d.......B..... | 116 | ··0x000008fc·6315648d·b1aceb8b·b405420a·0df5da1d·c.d.......B..... |
| 117 | ··0x0000090c·94b3d885·cbb02645·74577e49·13e0858e·......&EtW~I.... | 117 | ··0x0000090c·94b3d885·cbb02645·74577e49·13e0858e·......&EtW~I.... |
| 118 | ··0x0000091c·6a5c9511·7 | 118 | ··0x0000091c·6a5c9511·76028c2d·e738c52f··········j\..v..-.8./ |
| Offset 1, 1237 lines modified | Offset 1, 1222 lines modified | ||
| Diff chunk too large, falling back to line-by-line diff (1219 lines added, 1234 lines removed) | |||
| 1 | Hex·dump·of·section·'.dynstr': | 1 | Hex·dump·of·section·'.dynstr': |
| 2 | ··0x00002 | 2 | ··0x000020f8·005f4954·4d5f6465·72656769·73746572·._ITM_deregister |
| 3 | ··0x000021 | 3 | ··0x00002108·544d436c·6f6e6554·61626c65·005f5f67·TMCloneTable.__g |
| 4 | ··0x000021 | 4 | ··0x00002118·6d6f6e5f·73746172·745f5f00·5f49544d·mon_start__._ITM |
| 5 | ··0x000021 | 5 | ··0x00002128·5f726567·69737465·72544d43·6c6f6e65·_registerTMClone |
| 6 | ··0x000021 | 6 | ··0x00002138·5461626c·65005f5a·4e384261·6d546f6f·Table._ZN8BamToo |
| 7 | ··0x000021 | 7 | ··0x00002148·6c733134·42616d4d·756c7469·52656164·ls14BamMultiRead |
| 8 | ··0x000021 | 8 | ··0x00002158·65724331·4576005f·5a4e3842·616d546f·erC1Ev._ZN8BamTo |
| 9 | ··0x000021 | 9 | ··0x00002168·6f6c7331·3442616d·4d756c74·69526561·ols14BamMultiRea |
| 10 | ··0x000021 | 10 | ··0x00002178·64657235·436c6f73·65457600·5f5a4e53·der5CloseEv._ZNS |
| 11 | ··0x000021 | 11 | ··0x00002188·74375f5f·63787831·31313562·61736963·t7__cxx1115basic |
| 12 | ··0x000021 | 12 | ··0x00002198·5f737472·696e6762·75664963·53743131·_stringbufIcSt11 |
| 13 | ··0x000021 | 13 | ··0x000021a8·63686172·5f747261·69747349·63455361·char_traitsIcESa |
| 14 | ··0x000021 | 14 | ··0x000021b8·49634545·44304576·005f5a4e·4b384261·IcEED0Ev._ZNK8Ba |
| 15 | ··0x000021 | 15 | ··0x000021c8·6d546f6f·6c733132·42616d41·6c69676e·mTools12BamAlign |
| 16 | ··0x000021 | 16 | ··0x000021d8·6d656e74·3849734d·61707065·64457600·ment8IsMappedEv. |
| 17 | ··0x00002 | 17 | ··0x000021e8·5f5a4e4b·3842616d·546f6f6c·73313242·_ZNK8BamTools12B |
| 18 | ··0x00002 | 18 | ··0x000021f8·616d416c·69676e6d·656e7431·35497352·amAlignment15IsR |
| 19 | ··0x000022 | 19 | ··0x00002208·65766572·73655374·72616e64·4576005f·everseStrandEv._ |
| 20 | ··0x000022 | 20 | ··0x00002218·5a4e5374·36766563·746f7249·4e384261·ZNSt6vectorIN8Ba |
| 21 | ··0x000022 | 21 | ··0x00002228·6d546f6f·6c733743·69676172·4f704553·mTools7CigarOpES |
| 22 | ··0x000022 | 22 | ··0x00002238·61495331·5f454531·375f4d5f·7265616c·aIS1_EE17_M_real |
| 23 | ··0x000022 | 23 | ··0x00002248·6c6f635f·696e7365·7274494a·524b5331·loc_insertIJRKS1 |
| 24 | ··0x000022 | 24 | ··0x00002258·5f454545·764e395f·5f676e75·5f637878·_EEEvN9__gnu_cxx |
| 25 | ··0x000022 | 25 | ··0x00002268·31375f5f·6e6f726d·616c5f69·74657261·17__normal_itera |
| 26 | ··0x000022 | 26 | ··0x00002278·746f7249·5053315f·53335f45·4544704f·torIPS1_S3_EEDpO |
| 27 | ··0x000022 | 27 | ··0x00002288·545f005f·5a4e5374·375f5f63·78783131·T_._ZNSt7__cxx11 |
| 28 | ··0x000022 | 28 | ··0x00002298·31356261·7369635f·73747269·6e676275·15basic_stringbu |
| 29 | ··0x000022 | 29 | ··0x000022a8·66496353·74313163·6861725f·74726169·fIcSt11char_trai |
| 30 | ··0x000022 | 30 | ··0x000022b8·74734963·45536149·63454544·31457600·tsIcESaIcEED1Ev. |
| 31 | ··0x000022 | 31 | ··0x000022c8·5f5a4e4b·3842616d·546f6f6c·73313242·_ZNK8BamTools12B |
| 32 | ··0x000022 | 32 | ··0x000022d8·616d416c·69676e6d·656e7431·34476574·amAlignment14Get |
| 33 | ··0x00002 | 33 | ··0x000022e8·456e6450·6f736974·696f6e45·6262005f·EndPositionEbb._ |
| 34 | ··0x00002 | 34 | ··0x000022f8·5a4e4b38·42616d54·6f6f6c73·31324261·ZNK8BamTools12Ba |
| 35 | ··0x000023 | 35 | ··0x00002308·6d416c69·676e6d65·6e743746·696e6454·mAlignment7FindT |
| 36 | ··0x000023 | 36 | ··0x00002318·61674552·4b4e5374·375f5f63·78783131·agERKNSt7__cxx11 |
| 37 | ··0x000023 | 37 | ··0x00002328·31326261·7369635f·73747269·6e674963·12basic_stringIc |
| 38 | ··0x000023 | 38 | ··0x00002338·53743131·63686172·5f747261·69747349·St11char_traitsI |
| 39 | ··0x000023 | 39 | ··0x00002348·63455361·49634545·45525063·524b6a52·cESaIcEEERPcRKjR |
| 40 | ··0x000023 | 40 | ··0x00002358·6a005f5a·4e537437·5f5f6378·78313131·j._ZNSt7__cxx111 |
| 41 | ··0x000023 | 41 | ··0x00002368·35626173·69635f73·7472696e·67627566·5basic_stringbuf |
| 42 | ··0x000023 | 42 | ··0x00002378·49635374·31316368·61725f74·72616974·IcSt11char_trait |
| 43 | ··0x000023 | 43 | ··0x00002388·73496345·53614963·45454432·4576005f·sIcESaIcEED2Ev._ |
| 44 | ··0x000023 | 44 | ··0x00002398·5a4e4b38·42616d54·6f6f6c73·32325361·ZNK8BamTools22Sa |
| 45 | ··0x000023 | 45 | ··0x000023a8·6d526561·6447726f·75704469·6374696f·mReadGroupDictio |
| 46 | ··0x000023 | 46 | ··0x000023b8·6e617279·33456e64·4576005f·5a4e4b38·nary3EndEv._ZNK8 |
| 47 | ··0x000023 | 47 | ··0x000023c8·42616d54·6f6f6c73·31344261·6d4d756c·BamTools14BamMul |
| 48 | ··0x000023 | 48 | ··0x000023d8·74695265·61646572·39476574·48656164·tiReader9GetHead |
| 49 | ··0x00002 | 49 | ··0x000023e8·65724576·005f5a4e·3842616d·546f6f6c·erEv._ZN8BamTool |
| 50 | ··0x00002 | 50 | ··0x000023f8·73313242·616d416c·69676e6d·656e7444·s12BamAlignmentD |
| 51 | ··0x000024 | 51 | ··0x00002408·31457600·5f5a4e53·74367665·63746f72·1Ev._ZNSt6vector |
| 52 | ··0x000024 | 52 | ··0x00002418·494e5374·375f5f63·78783131·31326261·INSt7__cxx1112ba |
| 53 | ··0x000024 | 53 | ··0x00002428·7369635f·73747269·6e674963·53743131·sic_stringIcSt11 |
| 54 | ··0x000024 | 54 | ··0x00002438·63686172·5f747261·69747349·63455361·char_traitsIcESa |
| 55 | ··0x000024 | 55 | ··0x00002448·49634545·45536149·53355f45·4531375f·IcEEESaIS5_EE17_ |
| 56 | ··0x000024 | 56 | ··0x00002458·4d5f7265·616c6c6f·635f696e·73657274·M_realloc_insert |
| 57 | ··0x000024 | 57 | ··0x00002468·494a5335·5f454545·764e395f·5f676e75·IJS5_EEEvN9__gnu |
| 58 | ··0x000024 | 58 | ··0x00002478·5f637878·31375f5f·6e6f726d·616c5f69·_cxx17__normal_i |
| 59 | ··0x000024 | 59 | ··0x00002488·74657261·746f7249·5053355f·53375f45·teratorIPS5_S7_E |
| 60 | ··0x000024 | 60 | ··0x00002498·4544704f·545f005f·5a4e3842·616d546f·EDpOT_._ZN8BamTo |
| 61 | ··0x000024 | 61 | ··0x000024a8·6f6c7331·3442616d·4d756c74·69526561·ols14BamMultiRea |
| 62 | ··0x000024 | 62 | ··0x000024b8·64657234·4f70656e·45524b53·74367665·der4OpenERKSt6ve |
| 63 | ··0x000024 | 63 | ··0x000024c8·63746f72·494e5374·375f5f63·78783131·ctorINSt7__cxx11 |
| 64 | ··0x000024 | 64 | ··0x000024d8·31326261·7369635f·73747269·6e674963·12basic_stringIc |
| 65 | ··0x00002 | 65 | ··0x000024e8·53743131·63686172·5f747261·69747349·St11char_traitsI |
| 66 | ··0x00002 | 66 | ··0x000024f8·63455361·49634545·45536149·53375f45·cESaIcEEESaIS7_E |
| 67 | ··0x000025 | 67 | ··0x00002508·45005f5a·4e384261·6d546f6f·6c733134·E._ZN8BamTools14 |
| 68 | ··0x000025 | 68 | ··0x00002518·42616d4d·756c7469·52656164·65723136·BamMultiReader16 |
| 69 | ··0x000025 | 69 | ··0x00002528·4765744e·65787441·6c69676e·6d656e74·GetNextAlignment |
| 70 | ··0x000025 | 70 | ··0x00002538·45524e53·5f313242·616d416c·69676e6d·ERNS_12BamAlignm |
| 71 | ··0x000025 | 71 | ··0x00002548·656e7445·005f5a53·74706c49·63537431·entE._ZStplIcSt1 |
| 72 | ··0x000025 | 72 | ··0x00002558·31636861·725f7472·61697473·49634553·1char_traitsIcES |
| 73 | ··0x000025 | 73 | ··0x00002568·61496345·454e5374·375f5f63·78783131·aIcEENSt7__cxx11 |
| 74 | ··0x000025 | 74 | ··0x00002578·31326261·7369635f·73747269·6e674954·12basic_stringIT |
| 75 | ··0x000025 | 75 | ··0x00002588·5f54305f·54315f45·45504b53·355f524b·_T0_T1_EEPKS5_RK |
| 76 | ··0x000025 | 76 | ··0x00002598·53385f00·5f5a4e38·42616d54·6f6f6c73·S8_._ZN8BamTools |
| 77 | ··0x000025 | 77 | ··0x000025a8·31324261·6d416c69·676e6d65·6e744432·12BamAlignmentD2 |
| 78 | ··0x000025 | 78 | ··0x000025b8·4576005f·5a4e4b38·42616d54·6f6f6c73·Ev._ZNK8BamTools |
| 79 | ··0x000025 | 79 | ··0x000025c8·31324261·6d416c69·676e6d65·6e743131·12BamAlignment11 |
| 80 | ··0x000025 | 80 | ··0x000025d8·49735661·6c696453·697a6545·524b4e53·IsValidSizeERKNS |
| 81 | ··0x00002 | 81 | ··0x000025e8·74375f5f·63787831·31313262·61736963·t7__cxx1112basic |
| 82 | ··0x00002 | 82 | ··0x000025f8·5f737472·696e6749·63537431·31636861·_stringIcSt11cha |
| 83 | ··0x000026 | 83 | ··0x00002608·725f7472·61697473·49634553·61496345·r_traitsIcESaIcE |
| 84 | ··0x000026 | 84 | ··0x00002618·45455338·5f005f5a·4e4b3842·616d546f·EES8_._ZNK8BamTo |
| 85 | ··0x000026 | 85 | ··0x00002628·6f6c7331·3442616d·4d756c74·69526561·ols14BamMultiRea |
| 86 | ··0x000026 | 86 | ··0x00002638·64657231·34476574·4572726f·72537472·der14GetErrorStr |
| 87 | ··0x000026 | 87 | ··0x00002648·696e6742·35637878·31314576·005f5a4e·ingB5cxx11Ev._ZN |
| 88 | ··0x000026 | 88 | ··0x00002658·3842616d·546f6f6c·73313242·616d416c·8BamTools12BamAl |
| 89 | ··0x000026 | 89 | ··0x00002668·69676e6d·656e7431·33427569·6c644368·ignment13BuildCh |
| 90 | ··0x000026 | 90 | ··0x00002678·61724461·74614576·005f5a4e·3842616d·arDataEv._ZN8Bam |
| 91 | ··0x000026 | 91 | ··0x00002688·546f6f6c·73313442·616d4d75·6c746952·Tools14BamMultiR |
| 92 | ··0x000026 | 92 | ··0x00002698·65616465·72443145·76005f5a·4e384261·eaderD1Ev._ZN8Ba |
| 93 | ··0x000026 | 93 | ··0x000026a8·6d546f6f·6c733953·616d4865·61646572·mTools9SamHeader |
| 94 | ··0x000026 | 94 | ··0x000026b8·44314576·005f5a4e·53743676·6563746f·D1Ev._ZNSt6vecto |
| 95 | ··0x000026 | 95 | ··0x000026c8·72494e53·74375f5f·63787831·31313262·rINSt7__cxx1112b |
| 96 | ··0x000026 | 96 | ··0x000026d8·61736963·5f737472·696e6749·63537431·asic_stringIcSt1 |
| 97 | ··0x00002 | 97 | ··0x000026e8·31636861·725f7472·61697473·49634553·1char_traitsIcES |
| 98 | ··0x00002 | 98 | ··0x000026f8·61496345·45455361·4953355f·45454431·aIcEEESaIS5_EED1 |
| 99 | ··0x000027 | 99 | ··0x00002708·4576005f·5a4e4b38·42616d54·6f6f6c73·Ev._ZNK8BamTools |
| 100 | ··0x000027 | 100 | ··0x00002718·32325361·6d526561·6447726f·75704469·22SamReadGroupDi |
| 101 | ··0x000027 | 101 | ··0x00002728·6374696f·6e617279·35426567·696e4576·ctionary5BeginEv |
| 102 | ··0x000027 | 102 | ··0x00002738·005f5a4e·4b537435·63747970·65496345·._ZNKSt5ctypeIcE |
| 103 | ··0x000027 | 103 | ··0x00002748·38646f5f·77696465·6e456300·5f5a5374·8do_widenEc._ZSt |
| 104 | ··0x000027 | 104 | ··0x00002758·706c4963·53743131·63686172·5f747261·plIcSt11char_tra |
| 105 | ··0x000027 | 105 | ··0x00002768·69747349·63455361·49634545·4e537437·itsIcESaIcEENSt7 |
| 106 | ··0x000027 | 106 | ··0x00002778·5f5f6378·78313131·32626173·69635f73·__cxx1112basic_s |
| 107 | ··0x000027 | 107 | ··0x00002788·7472696e·6749545f·54305f54·315f4545·tringIT_T0_T1_EE |
| 108 | ··0x000027 | 108 | ··0x00002798·4f53385f·53395f00·5f5a4e38·42616d54·OS8_S9_._ZN8BamT |
| 109 | ··0x000027 | 109 | ··0x000027a8·6f6f6c73·31344261·6d4d756c·74695265·ools14BamMultiRe |
| 110 | ··0x000027 | 110 | ··0x000027b8·61646572·32315365·74457870·6c696369·ader21SetExplici |
| 111 | ··0x000027 | 111 | ··0x000027c8·744d6572·67654f72·64657245·4e53305f·tMergeOrderENS0_ |
| 112 | ··0x000027 | 112 | ··0x000027d8·31304d65·7267654f·72646572·45005f5a·10MergeOrderE._Z |
| 113 | ··0x00002 | 113 | ··0x000027e8·4e537436·76656374·6f72494e·5374375f·NSt6vectorINSt7_ |
| 114 | ··0x00002 | 114 | ··0x000027f8·5f637878·31313132·62617369·635f7374·_cxx1112basic_st |
| 115 | ··0x000028 | 115 | ··0x00002808·72696e67·49635374·31316368·61725f74·ringIcSt11char_t |
| 116 | ··0x000028 | 116 | ··0x00002818·72616974·73496345·53614963·45454553·raitsIcESaIcEEES |
| 117 | ··0x000028 | 117 | ··0x00002828·61495335·5f454531·375f4d5f·7265616c·aIS5_EE17_M_real |
| 118 | ··0x000028 | 118 | ··0x00002838·6c6f635f·696e7365·7274494a·524b5335·loc_insertIJRKS5 |
| 119 | ··0x000028 | 119 | ··0x00002848·5f454545·764e395f·5f676e75·5f637878·_EEEvN9__gnu_cxx |
| 120 | ··0x000028 | 120 | ··0x00002858·31375f5f·6e6f726d·616c5f69·74657261·17__normal_itera |
| 121 | ··0x000028 | 121 | ··0x00002868·746f7249·5053355f·53375f45·4544704f·torIPS5_S7_EEDpO |
| 122 | ··0x000028 | 122 | ··0x00002878·545f005f·5a4e3842·616d546f·6f6c7339·T_._ZN8BamTools9 |
| 123 | ··0x000028 | 123 | ··0x00002888·53616d48·65616465·72443245·76005f5a·SamHeaderD2Ev._Z |
| 124 | ··0x000028 | 124 | ··0x00002898·4e537436·76656374·6f724969·53614969·NSt6vectorIiSaIi |
| 125 | ··0x000028 | 125 | ··0x000028a8·45453137·5f4d5f72·65616c6c·6f635f69·EE17_M_realloc_i |
| Max diff block lines reached; 0/164392 bytes (0.00%) of diff not shown. | |||
| Offset 3, 16 lines modified | Offset 3, 16 lines modified | ||
| 3 | Disassembly·of·section·.init: | 3 | Disassembly·of·section·.init: |
| 4 | 00008000·<.init>: | 4 | 00008000·<.init>: |
| 5 | _init(): | 5 | _init(): |
| 6 | » push···%ebx | 6 | » push···%ebx |
| 7 | » sub····$0x8,%esp | 7 | » sub····$0x8,%esp |
| 8 | » call···a | 8 | » call···a3c0·<_start@@Base+0x30> |
| 9 | » add····$0x2 | 9 | » add····$0x2efeb,%ebx |
| 10 | » mov····-0x18(%ebx),%eax | 10 | » mov····-0x18(%ebx),%eax |
| 11 | » test···%eax,%eax | 11 | » test···%eax,%eax |
| 12 | » je·····801b·<__printf_chk@plt-0x15> | 12 | » je·····801b·<__printf_chk@plt-0x15> |
| 13 | » call···*%eax | 13 | » call···*%eax |
| 14 | » add····$0x8,%esp | 14 | » add····$0x8,%esp |
| 15 | » pop····%ebx | 15 | » pop····%ebx |
| 16 | » ret | 16 | » ret |
| Offset 130, 691 lines modified | Offset 130, 676 lines modified | ||
| 130 | » jmp····8020·<__printf_chk@plt-0x10> | 130 | » jmp····8020·<__printf_chk@plt-0x10> |
| 131 | 000081b0·<std::__throw_bad_alloc()@plt>: | 131 | 000081b0·<std::__throw_bad_alloc()@plt>: |
| 132 | » jmp····*0x6c(%ebx) | 132 | » jmp····*0x6c(%ebx) |
| 133 | » push···$0xc0 | 133 | » push···$0xc0 |
| 134 | » jmp····8020·<__printf_chk@plt-0x10> | 134 | » jmp····8020·<__printf_chk@plt-0x10> |
| 135 | 000081c0·< | 135 | 000081c0·<Json::Value::operator[](char·const*)@plt>: |
| 136 | » jmp····*0x70(%ebx) | 136 | » jmp····*0x70(%ebx) |
| 137 | » push···$0xc8 | 137 | » push···$0xc8 |
| 138 | » jmp····8020·<__printf_chk@plt-0x10> | 138 | » jmp····8020·<__printf_chk@plt-0x10> |
| 139 | 000081d0·< | 139 | 000081d0·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_replace(unsigned·int,·unsigned·int,·char·const*,·unsigned·int)@plt>: |
| 140 | » jmp····*0x74(%ebx) | 140 | » jmp····*0x74(%ebx) |
| 141 | » push···$0xd0 | 141 | » push···$0xd0 |
| 142 | » jmp····8020·<__printf_chk@plt-0x10> | 142 | » jmp····8020·<__printf_chk@plt-0x10> |
| 143 | 000081e0·< | 143 | 000081e0·<__cxa_begin_catch@plt>: |
| 144 | » jmp····*0x78(%ebx) | 144 | » jmp····*0x78(%ebx) |
| 145 | » push···$0xd8 | 145 | » push···$0xd8 |
| 146 | » jmp····8020·<__printf_chk@plt-0x10> | 146 | » jmp····8020·<__printf_chk@plt-0x10> |
| 147 | 000081f0·<__cxa_ | 147 | 000081f0·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::reserve(unsigned·int)@plt>: |
| 148 | » jmp····*0x7c(%ebx) | 148 | » jmp····*0x7c(%ebx) |
| 149 | » push···$0xe0 | 149 | » push···$0xe0 |
| 150 | » jmp····8020·<__printf_chk@plt-0x10> | 150 | » jmp····8020·<__printf_chk@plt-0x10> |
| 151 | 00008200·< | 151 | 00008200·<calloc@plt>: |
| 152 | » jmp····*0x80(%ebx) | 152 | » jmp····*0x80(%ebx) |
| 153 | » push···$0xe8 | 153 | » push···$0xe8 |
| 154 | » jmp····8020·<__printf_chk@plt-0x10> | 154 | » jmp····8020·<__printf_chk@plt-0x10> |
| 155 | 00008210·< | 155 | 00008210·<Json::Value::Value(Json::ValueType)@plt>: |
| 156 | » jmp····*0x84(%ebx) | 156 | » jmp····*0x84(%ebx) |
| 157 | » push···$0xf0 | 157 | » push···$0xf0 |
| 158 | » jmp····8020·<__printf_chk@plt-0x10> | 158 | » jmp····8020·<__printf_chk@plt-0x10> |
| 159 | 00008220·< | 159 | 00008220·<BamTools::BamMultiReader::GetNextAlignment(BamTools::BamAlignment&)@plt>: |
| 160 | » jmp····*0x88(%ebx) | 160 | » jmp····*0x88(%ebx) |
| 161 | » push···$0xf8 | 161 | » push···$0xf8 |
| 162 | » jmp····8020·<__printf_chk@plt-0x10> | 162 | » jmp····8020·<__printf_chk@plt-0x10> |
| 163 | 00008230·< | 163 | 00008230·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::basic_string(std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&)@plt>: |
| 164 | » jmp····*0x8c(%ebx) | 164 | » jmp····*0x8c(%ebx) |
| 165 | » push···$0x100 | 165 | » push···$0x100 |
| 166 | » jmp····8020·<__printf_chk@plt-0x10> | 166 | » jmp····8020·<__printf_chk@plt-0x10> |
| 167 | 00008240·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::basic | 167 | 00008240·<std::__cxx11::basic_istringstream<char,·std::char_traits<char>,·std::allocator<char>·>::~basic_istringstream()@plt>: |
| 168 | » jmp····*0x90(%ebx) | 168 | » jmp····*0x90(%ebx) |
| 169 | » push···$0x108 | 169 | » push···$0x108 |
| 170 | » jmp····8020·<__printf_chk@plt-0x10> | 170 | » jmp····8020·<__printf_chk@plt-0x10> |
| 171 | 00008250·< | 171 | 00008250·<getpid@plt>: |
| 172 | » jmp····*0x94(%ebx) | 172 | » jmp····*0x94(%ebx) |
| 173 | » push···$0x110 | 173 | » push···$0x110 |
| 174 | » jmp····8020·<__printf_chk@plt-0x10> | 174 | » jmp····8020·<__printf_chk@plt-0x10> |
| 175 | 00008260·< | 175 | 00008260·<isspace@plt>: |
| 176 | » jmp····*0x98(%ebx) | 176 | » jmp····*0x98(%ebx) |
| 177 | » push···$0x118 | 177 | » push···$0x118 |
| 178 | » jmp····8020·<__printf_chk@plt-0x10> | 178 | » jmp····8020·<__printf_chk@plt-0x10> |
| 179 | 00008270·< | 179 | 00008270·<fgets@plt>: |
| 180 | » jmp····*0x9c(%ebx) | 180 | » jmp····*0x9c(%ebx) |
| 181 | » push···$0x120 | 181 | » push···$0x120 |
| 182 | » jmp····8020·<__printf_chk@plt-0x10> | 182 | » jmp····8020·<__printf_chk@plt-0x10> |
| 183 | 00008280·< | 183 | 00008280·<Json::Value::~Value()@plt>: |
| 184 | » jmp····*0xa0(%ebx) | 184 | » jmp····*0xa0(%ebx) |
| 185 | » push···$0x128 | 185 | » push···$0x128 |
| 186 | » jmp····8020·<__printf_chk@plt-0x10> | 186 | » jmp····8020·<__printf_chk@plt-0x10> |
| 187 | 00008290·< | 187 | 00008290·<fwrite@plt>: |
| 188 | » jmp····*0xa4(%ebx) | 188 | » jmp····*0xa4(%ebx) |
| 189 | » push···$0x130 | 189 | » push···$0x130 |
| 190 | » jmp····8020·<__printf_chk@plt-0x10> | 190 | » jmp····8020·<__printf_chk@plt-0x10> |
| 191 | 000082a0·< | 191 | 000082a0·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_replace_aux(unsigned·int,·unsigned·int,·unsigned·int,·char)@plt>: |
| 192 | » jmp····*0xa8(%ebx) | 192 | » jmp····*0xa8(%ebx) |
| 193 | » push···$0x138 | 193 | » push···$0x138 |
| 194 | » jmp····8020·<__printf_chk@plt-0x10> | 194 | » jmp····8020·<__printf_chk@plt-0x10> |
| 195 | 000082b0·< | 195 | 000082b0·<memcpy@plt>: |
| 196 | » jmp····*0xac(%ebx) | 196 | » jmp····*0xac(%ebx) |
| 197 | » push···$0x140 | 197 | » push···$0x140 |
| 198 | » jmp····8020·<__printf_chk@plt-0x10> | 198 | » jmp····8020·<__printf_chk@plt-0x10> |
| 199 | 000082c0·< | 199 | 000082c0·<std::__throw_length_error(char·const*)@plt>: |
| 200 | » jmp····*0xb0(%ebx) | 200 | » jmp····*0xb0(%ebx) |
| 201 | » push···$0x148 | 201 | » push···$0x148 |
| 202 | » jmp····8020·<__printf_chk@plt-0x10> | 202 | » jmp····8020·<__printf_chk@plt-0x10> |
| 203 | 000082d0·<std::__thro | 203 | 000082d0·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_assign(std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&)@plt>: |
| 204 | » jmp····*0xb4(%ebx) | 204 | » jmp····*0xb4(%ebx) |
| 205 | » push···$0x150 | 205 | » push···$0x150 |
| 206 | » jmp····8020·<__printf_chk@plt-0x10> | 206 | » jmp····8020·<__printf_chk@plt-0x10> |
| 207 | 000082e0·< | 207 | 000082e0·<malloc@plt>: |
| 208 | » jmp····*0xb8(%ebx) | 208 | » jmp····*0xb8(%ebx) |
| 209 | » push···$0x158 | 209 | » push···$0x158 |
| 210 | » jmp····8020·<__printf_chk@plt-0x10> | 210 | » jmp····8020·<__printf_chk@plt-0x10> |
| 211 | 000082f0·< | 211 | 000082f0·<strlen@plt>: |
| 212 | » jmp····*0xbc(%ebx) | 212 | » jmp····*0xbc(%ebx) |
| 213 | » push···$0x160 | 213 | » push···$0x160 |
| 214 | » jmp····8020·<__printf_chk@plt-0x10> | 214 | » jmp····8020·<__printf_chk@plt-0x10> |
| 215 | 00008300·<strlen@plt>: | 215 | 00008300·<Json::Value::get(char·const*,·Json::Value·const&)·const@plt>: |
| 216 | » jmp····*0xc0(%ebx) | 216 | » jmp····*0xc0(%ebx) |
| 217 | » push···$0x168 | 217 | » push···$0x168 |
| 218 | » jmp····8020·<__printf_chk@plt-0x10> | 218 | » jmp····8020·<__printf_chk@plt-0x10> |
| 219 | 00008310·< | 219 | 00008310·<munmap@plt>: |
| 220 | » jmp····*0xc4(%ebx) | 220 | » jmp····*0xc4(%ebx) |
| 221 | » push···$0x170 | 221 | » push···$0x170 |
| 222 | » jmp····8020·<__printf_chk@plt-0x10> | 222 | » jmp····8020·<__printf_chk@plt-0x10> |
| 223 | 00008320·< | 223 | 00008320·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::basic_string(std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>&&)@plt>: |
| 224 | » jmp····*0xc8(%ebx) | 224 | » jmp····*0xc8(%ebx) |
| 225 | » push···$0x178 | 225 | » push···$0x178 |
| 226 | » jmp····8020·<__printf_chk@plt-0x10> | 226 | » jmp····8020·<__printf_chk@plt-0x10> |
| 227 | 00008330·< | 227 | 00008330·<getcwd@plt>: |
| 228 | » jmp····*0xcc(%ebx) | 228 | » jmp····*0xcc(%ebx) |
| 229 | » push···$0x180 | 229 | » push···$0x180 |
| 230 | » jmp····8020·<__printf_chk@plt-0x10> | 230 | » jmp····8020·<__printf_chk@plt-0x10> |
| Max diff block lines reached; 23426/29322 bytes (79.89%) of diff not shown. | |||
| Offset 1, 8 lines modified | Offset 1, 8 lines modified | ||
| 1 | Disassembly·of·section·.plt.got: | 1 | Disassembly·of·section·.plt.got: |
| 2 | 00008a | 2 | 00008a20·<__cxa_finalize@plt>: |
| 3 | » jmp····*-0x5c(%ebx) | 3 | » jmp····*-0x5c(%ebx) |
| 4 | » xchg···%ax,%ax | 4 | » xchg···%ax,%ax |
| Offset 1, 1581 lines modified | Offset 1, 1573 lines modified | ||
| 1 | Disassembly·of·section·.text: | 1 | Disassembly·of·section·.text: |
| 2 | 00008a | 2 | 00008a30·<main@@Base-0x1330>: |
| 3 | RetrieveParameterInt(OptArgs&,·Json::Value&,·char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·int)·[clone·.cold]: | 3 | RetrieveParameterInt(OptArgs&,·Json::Value&,·char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·int)·[clone·.cold]: |
| 4 | /usr/include/c++/12/bits/basic_string.h:795 | 4 | /usr/include/c++/12/bits/basic_string.h:795 |
| 5 | » sub····$0xc,%esp | 5 | » sub····$0xc,%esp |
| 6 | » mov····-0x5c(%ebp),%ebx | 6 | » mov····-0x5c(%ebp),%ebx |
| 7 | » push···%esi | 7 | » push···%esi |
| 8 | » call···86 | 8 | » call···8660·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> |
| 9 | » pop····%eax | 9 | » pop····%eax |
| 10 | » push···-0x64(%ebp) | 10 | » push···-0x64(%ebp) |
| 11 | » call···86 | 11 | » call···8660·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> |
| 12 | /usr/include/c++/12/bits/new_allocator.h:90 | 12 | /usr/include/c++/12/bits/new_allocator.h:90 |
| 13 | » mov····%edi,(%esp) | 13 | » mov····%edi,(%esp) |
| 14 | » call···88 | 14 | » call···88d0·<_Unwind_Resume@plt> |
| 15 | RetrieveParameterDouble(OptArgs&,·Json::Value&,·char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·double)·[clone·.cold]: | 15 | RetrieveParameterDouble(OptArgs&,·Json::Value&,·char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·double)·[clone·.cold]: |
| 16 | /usr/include/c++/12/bits/basic_string.h:795 | 16 | /usr/include/c++/12/bits/basic_string.h:795 |
| 17 | » sub····$0xc,%esp | 17 | » sub····$0xc,%esp |
| 18 | » mov····-0x5c(%ebp),%ebx | 18 | » mov····-0x5c(%ebp),%ebx |
| 19 | » push···%esi | 19 | » push···%esi |
| 20 | » call···86 | 20 | » call···8660·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> |
| 21 | » pop····%eax | 21 | » pop····%eax |
| 22 | » push···-0x6c(%ebp) | 22 | » push···-0x6c(%ebp) |
| 23 | » call···86 | 23 | » call···8660·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> |
| 24 | /usr/include/c++/12/bits/new_allocator.h:90 | 24 | /usr/include/c++/12/bits/new_allocator.h:90 |
| 25 | » mov····%edi,(%esp) | 25 | » mov····%edi,(%esp) |
| 26 | » call···88 | 26 | » call···88d0·<_Unwind_Resume@plt> |
| 27 | std::_Rb_tree_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·Spectrum::TKmer>·>·std::_Rb_tree<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·Spectrum::TKmer>,·std::_Select1st<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·Spectrum::TKmer>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·Spectrum::TKmer>·>·>::_M_emplace_hint_unique<std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>,·std::tuple<>·>(std::_Rb_tree_const_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·Spectrum::TKmer>·>,·std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>&&,·std::tuple<>&&)·[clone·.isra.0]·[clone·.cold]: | 27 | std::_Rb_tree_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·Spectrum::TKmer>·>·std::_Rb_tree<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·Spectrum::TKmer>,·std::_Select1st<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·Spectrum::TKmer>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·Spectrum::TKmer>·>·>::_M_emplace_hint_unique<std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>,·std::tuple<>·>(std::_Rb_tree_const_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·Spectrum::TKmer>·>,·std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>&&,·std::tuple<>&&)·[clone·.isra.0]·[clone·.cold]: |
| 28 | /usr/include/c++/12/bits/new_allocator.h:90 | 28 | /usr/include/c++/12/bits/new_allocator.h:90 |
| 29 | » sub····$0xc,%esp | 29 | » sub····$0xc,%esp |
| 30 | » push···%eax | ||
| 31 | » mov···· | 30 | » mov····%edi,%ebx |
| 32 | /usr/include/c++/12/bits/stl_tree.h:599 | 31 | /usr/include/c++/12/bits/stl_tree.h:599 |
| 32 | » push···%eax | ||
| 33 | » call···81 | 33 | » call···81e0·<__cxa_begin_catch@plt> |
| 34 | /usr/include/c++/12/bits/new_allocator.h:158 | 34 | /usr/include/c++/12/bits/new_allocator.h:158 |
| 35 | » pop····%eax | 35 | » pop····%eax |
| 36 | » pop····%edx | 36 | » pop····%edx |
| 37 | » push···$0x48 | 37 | » push···$0x48 |
| 38 | » push···%esi | 38 | » push···%esi |
| 39 | » call···83 | 39 | » call···83d0·<operator·delete(void*,·unsigned·int)@plt> |
| 40 | /usr/include/c++/12/bits/stl_tree.h:603 | 40 | /usr/include/c++/12/bits/stl_tree.h:603 |
| 41 | » add····$0x10,%esp | 41 | » add····$0x10,%esp |
| 42 | » call···87 | 42 | » call···8730·<__cxa_rethrow@plt> |
| 43 | /usr/include/c++/12/bits/stl_tree.h:599 | 43 | /usr/include/c++/12/bits/stl_tree.h:599 |
| 44 | » mov···· | 44 | » mov····%edi,%ebx |
| 45 | » mov····%eax,%esi | 45 | » mov····%eax,%esi |
| 46 | » call···88 | 46 | » call···8800·<__cxa_end_catch@plt> |
| 47 | » sub····$0xc,%esp | 47 | » sub····$0xc,%esp |
| 48 | » push···%esi | 48 | » push···%esi |
| 49 | » call···88 | 49 | » call···88d0·<_Unwind_Resume@plt> |
| 50 | main.cold(): | 50 | main.cold(): |
| 51 | /usr/include/c++/12/bits/basic_string.h:795 | 51 | /usr/include/c++/12/bits/basic_string.h:795 |
| 52 | » sub····$0xc,%esp | 52 | » sub····$0xc,%esp |
| 53 | » push···-0x4ec(%ebp) | 53 | » push···-0x4ec(%ebp) |
| 54 | » mov····-0x4dc(%ebp),%ebx | 54 | » mov····-0x4dc(%ebp),%ebx |
| 55 | » call···86 | 55 | » call···8660·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> |
| 56 | /usr/include/c++/12/bits/new_allocator.h:90 | 56 | /usr/include/c++/12/bits/new_allocator.h:90 |
| 57 | » add····$0x10,%esp | 57 | » add····$0x10,%esp |
| 58 | /usr/include/c++/12/bits/basic_string.h:795·(discriminator·5) | 58 | /usr/include/c++/12/bits/basic_string.h:795·(discriminator·5) |
| 59 | » sub····$0xc,%esp | 59 | » sub····$0xc,%esp |
| 60 | » push···-0x4e0(%ebp) | 60 | » push···-0x4e0(%ebp) |
| 61 | » mov····-0x4dc(%ebp),%ebx | 61 | » mov····-0x4dc(%ebp),%ebx |
| 62 | » call···86 | 62 | » call···8660·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> |
| 63 | /usr/include/c++/12/bits/new_allocator.h:90·(discriminator·5) | 63 | /usr/include/c++/12/bits/new_allocator.h:90·(discriminator·5) |
| 64 | » add····$0x10,%esp | 64 | » add····$0x10,%esp |
| 65 | /usr/include/c++/12/bits/basic_string.h:795·(discriminator·3) | 65 | /usr/include/c++/12/bits/basic_string.h:795·(discriminator·3) |
| 66 | » sub····$0xc,%esp | 66 | » sub····$0xc,%esp |
| 67 | » push···-0x4e8(%ebp) | 67 | » push···-0x4e8(%ebp) |
| 68 | » mov····-0x4dc(%ebp),%ebx | 68 | » mov····-0x4dc(%ebp),%ebx |
| 69 | » call···86 | 69 | » call···8660·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> |
| 70 | /usr/include/c++/12/bits/new_allocator.h:90·(discriminator·3) | 70 | /usr/include/c++/12/bits/new_allocator.h:90·(discriminator·3) |
| 71 | » mov····%esi,(%esp) | 71 | » mov····%esi,(%esp) |
| 72 | » call···88 | 72 | » call···88d0·<_Unwind_Resume@plt> |
| 73 | /usr/include/c++/12/bits/basic_string.h:795·(discriminator·6) | 73 | /usr/include/c++/12/bits/basic_string.h:795·(discriminator·6) |
| 74 | » sub····$0xc,%esp | 74 | » sub····$0xc,%esp |
| 75 | » push···-0x4e8(%ebp) | 75 | » push···-0x4e8(%ebp) |
| 76 | » mov····-0x4dc(%ebp),%ebx | 76 | » mov····-0x4dc(%ebp),%ebx |
| 77 | » call···86 | 77 | » call···8660·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> |
| 78 | /usr/include/c++/12/bits/new_allocator.h:90·(discriminator·6) | 78 | /usr/include/c++/12/bits/new_allocator.h:90·(discriminator·6) |
| 79 | » add····$0x10,%esp | 79 | » add····$0x10,%esp |
| 80 | ./obj-i686-linux-gnu/./VariantCaller/IndelAssembly/IndelAssembly.cpp:1476 | 80 | ./obj-i686-linux-gnu/./VariantCaller/IndelAssembly/IndelAssembly.cpp:1476 |
| 81 | » sub····$0xc,%esp | 81 | » sub····$0xc,%esp |
| 82 | » push···-0x4e4(%ebp) | 82 | » push···-0x4e4(%ebp) |
| 83 | » mov····-0x4dc(%ebp),%ebx | 83 | » mov····-0x4dc(%ebp),%ebx |
| 84 | » call···80f0·<BamTools::BamMultiReader::~BamMultiReader()@plt> | 84 | » call···80f0·<BamTools::BamMultiReader::~BamMultiReader()@plt> |
| 85 | » add····$0x10,%esp | 85 | » add····$0x10,%esp |
| 86 | » sub····$0xc,%esp | 86 | » sub····$0xc,%esp |
| 87 | » push···-0x4f8(%ebp) | 87 | » push···-0x4f8(%ebp) |
| 88 | » mov····-0x4dc(%ebp),%ebx | 88 | » mov····-0x4dc(%ebp),%ebx |
| 89 | » call···1 | 89 | » call···1c3a0·<TargetsManager::~TargetsManager()@@Base> |
| 90 | » add····$0x10,%esp | 90 | » add····$0x10,%esp |
| 91 | » sub····$0xc,%esp | 91 | » sub····$0xc,%esp |
| 92 | » push···-0x4f | 92 | » push···-0x4f4(%ebp) |
| 93 | » call···c2 | 93 | » call···c270·<ReferenceReader::~ReferenceReader()@@Base> |
| 94 | » pop····%eax | 94 | » pop····%eax |
| 95 | » push···-0x4ec(%ebp) | 95 | » push···-0x4ec(%ebp) |
| 96 | » call···c | 96 | » call···c9c0·<IndelAssemblyArgs::~IndelAssemblyArgs()@@Base> |
| 97 | » mov····%esi,(%esp) | 97 | » mov····%esi,(%esp) |
| 98 | » mov····-0x4dc(%ebp),%ebx | 98 | » mov····-0x4dc(%ebp),%ebx |
| 99 | » call···88 | 99 | » call···88d0·<_Unwind_Resume@plt> |
| 100 | » sub····$0xc,%esp | 100 | » sub····$0xc,%esp |
| 101 | » push···-0x4e0(%ebp) | 101 | » push···-0x4e0(%ebp) |
| 102 | » call···d | 102 | » call···d1d0·<BamTools::BamAlignment::~BamAlignment()@@Base> |
| 103 | » add····$0x10,%esp | 103 | » add····$0x10,%esp |
| 104 | » sub····$0xc,%esp | 104 | » sub····$0xc,%esp |
| 105 | » push···-0x4e8(%ebp) | 105 | » push···-0x4e8(%ebp) |
| 106 | » call···d | 106 | » call···d960·<IndelAssembly::~IndelAssembly()@@Base> |
| 107 | » add····$0x10,%esp | 107 | » add····$0x10,%esp |
| 108 | » sub····$0xc,%esp | 108 | » sub····$0xc,%esp |
| 109 | » push···-0x4f | 109 | » push···-0x4f0(%ebp) |
| 110 | » call···c | 110 | » call···c3e0·<SampleManager::~SampleManager()@@Base> |
| 111 | » add····$0x10,%esp | 111 | » add····$0x10,%esp |
| 112 | » jmp····8 | 112 | » jmp····8afa·<__cxa_finalize@plt+0xda> |
| 113 | ./obj-i686-linux-gnu/./VariantCaller/IndelAssembly/IndelAssembly.cpp:1445·(discriminator·3) | 113 | ./obj-i686-linux-gnu/./VariantCaller/IndelAssembly/IndelAssembly.cpp:1445·(discriminator·3) |
| 114 | » sub····$0xc,%esp | 114 | » sub····$0xc,%esp |
| 115 | » push···-0x4e8(%ebp) | 115 | » push···-0x4e8(%ebp) |
| 116 | » call···c | 116 | » call···cac0·<BamTools::SamHeader::~SamHeader()@@Base> |
| 117 | » add····$0x10,%esp | 117 | » add····$0x10,%esp |
| 118 | » jmp····8b | 118 | » jmp····8b72·<__cxa_finalize@plt+0x152> |
| 119 | » nop | 119 | » nop |
| 120 | TargetsManager::AddExtraTrim(TargetsManager::UnmergedTarget&,·char*,·int)·[clone·.cold]: | 120 | TargetsManager::AddExtraTrim(TargetsManager::UnmergedTarget&,·char*,·int)·[clone·.cold]: |
| 121 | /usr/include/c++/12/bits/basic_string.h:795 | 121 | /usr/include/c++/12/bits/basic_string.h:795 |
| 122 | » sub····$0xc,%esp | 122 | » sub····$0xc,%esp |
| Max diff block lines reached; 4003093/4010954 bytes (99.80%) of diff not shown. | |||
| Offset 1, 14 lines modified | Offset 1, 14 lines modified | ||
| 1 | Disassembly·of·section·.fini: | 1 | Disassembly·of·section·.fini: |
| 2 | 0002 | 2 | 0002ba44·<.fini>: |
| 3 | _fini(): | 3 | _fini(): |
| 4 | » push···%ebx | 4 | » push···%ebx |
| 5 | » sub····$0x8,%esp | 5 | » sub····$0x8,%esp |
| 6 | » call···a | 6 | » call···a3c0·<_start@@Base+0x30> |
| 7 | » add····$0xb | 7 | » add····$0xb5a7,%ebx |
| 8 | » add····$0x8,%esp | 8 | » add····$0x8,%esp |
| 9 | » pop····%ebx | 9 | » pop····%ebx |
| 10 | » ret | 10 | » ret |
| Offset 1, 571 lines modified | Offset 1, 573 lines modified | ||
| Diff chunk too large, falling back to line-by-line diff (570 lines added, 568 lines removed) | |||
| 1 | Hex·dump·of·section·'.rodata': | 1 | Hex·dump·of·section·'.rodata': |
| 2 | ··0x0002 | 2 | ··0x0002c000·03000000·01000200·62617369·635f7374·........basic_st |
| 3 | ··0x0002 | 3 | ··0x0002c010·72696e67·3a20636f·6e737472·75637469·ring:·constructi |
| 4 | ··0x0002 | 4 | ··0x0002c020·6f6e2066·726f6d20·6e756c6c·20697320·on·from·null·is· |
| 5 | ··0x0002 | 5 | ··0x0002c030·6e6f7420·76616c69·64000000·20202d68·not·valid...··-h |
| 6 | ··0x0002 | 6 | ··0x0002c040·2c2d2d68·656c7020·20202020·20202020·,--help········· |
| 7 | ··0x0002 | 7 | ··0x0002c050·20202020·20202020·20202020·20202020················· |
| 8 | ··0x0002 | 8 | ··0x0002c060·20202020·20202020·20202020·20202020················· |
| 9 | ··0x0002 | 9 | ··0x0002c070·7072696e·74207468·69732068·656c7020·print·this·help· |
| 10 | ··0x0002 | 10 | ··0x0002c080·6d657373·61676520·616e6420·65786974·message·and·exit |
| 11 | ··0x0002 | 11 | ··0x0002c090·00000000·20202d76·2c2d2d76·65727369·....··-v,--versi |
| 12 | ··0x0002 | 12 | ··0x0002c0a0·6f6e2020·20202020·20202020·20202020·on·············· |
| 13 | ··0x0002 | 13 | ··0x0002c0b0·20202020·20202020·20202020·20202020················· |
| 14 | ··0x0002 | 14 | ··0x0002c0c0·20202020·20202020·7072696e·74207665·········print·ve |
| 15 | ··0x0002 | 15 | ··0x0002c0d0·7273696f·6e20616e·64206578·69740000·rsion·and·exit.. |
| 16 | ··0x0002 | 16 | ··0x0002c0e0·20202d6e·2c2d2d6e·756d2d74·68726561···-n,--num-threa |
| 17 | ··0x0002 | 17 | ··0x0002c0f0·64732020·20202020·20202020·20202020·ds·············· |
| 18 | ··0x0002 | 18 | ··0x0002c100·20202020·20202020·494e5420·20202020·········INT····· |
| 19 | ··0x0002 | 19 | ··0x0002c110·20202020·6e756d62·6572206f·6620776f·····number·of·wo |
| 20 | ··0x0002 | 20 | ··0x0002c120·726b6572·20746872·65616473·205b325d·rker·threads·[2] |
| 21 | ··0x0002 | 21 | ··0x0002c130·00000000·20202020·202d2d70·6172616d·....·····--param |
| 22 | ··0x0002 | 22 | ··0x0002c140·65746572·732d6669·6c652020·20202020·eters-file······ |
| 23 | ··0x0002 | 23 | ··0x0002c150·20202020·20202020·20202020·46494c45·············FILE |
| 24 | ··0x0002 | 24 | ··0x0002c160·20202020·20202020·6a736f6e·2066696c·········json·fil |
| 25 | ··0x0002 | 25 | ··0x0002c170·65207769·74682061·6c676f72·6974686d·e·with·algorithm |
| 26 | ··0x0002 | 26 | ··0x0002c180·20636f6e·74726f6c·20706172·616d6574··control·paramet |
| 27 | ··0x0002 | 27 | ··0x0002c190·65727320·5b6f7074·696f6e61·6c5d0000·ers·[optional].. |
| 28 | ··0x0002 | 28 | ··0x0002c1a0·20202d72·2c2d2d72·65666572·656e6365···-r,--reference |
| 29 | ··0x0002 | 29 | ··0x0002c1b0·20202020·20202020·20202020·20202020················· |
| 30 | ··0x0002 | 30 | ··0x0002c1c0·20202020·20202020·46494c45·20202020·········FILE···· |
| 31 | ··0x0002 | 31 | ··0x0002c1d0·20202020·72656665·72656e63·65206661·····reference·fa |
| 32 | ··0x0002 | 32 | ··0x0002c1e0·73746120·66696c65·205b7265·71756972·sta·file·[requir |
| 33 | ··0x0002 | 33 | ··0x0002c1f0·65645d00·20202d62·2c2d2d69·6e707574·ed].··-b,--input |
| 34 | ··0x0002 | 34 | ··0x0002c200·2d62616d·20202020·20202020·20202020·-bam············ |
| 35 | ··0x0002 | 35 | ··0x0002c210·20202020·20202020·20202020·46494c45·············FILE |
| 36 | ··0x0002 | 36 | ··0x0002c220·20202020·20202020·62616d20·66696c65·········bam·file |
| 37 | ··0x0002 | 37 | ··0x0002c230·20776974·68206d61·70706564·20726561··with·mapped·rea |
| 38 | ··0x0002 | 38 | ··0x0002c240·6473205b·72657175·69726564·5d000000·ds·[required]... |
| 39 | ··0x0002 | 39 | ··0x0002c250·20202d74·2c2d2d74·61726765·742d6669···-t,--target-fi |
| 40 | ··0x0002 | 40 | ··0x0002c260·6c652020·20202020·20202020·20202020·le·············· |
| 41 | ··0x0002 | 41 | ··0x0002c270·20202020·20202020·46494c45·20202020·········FILE···· |
| 42 | ··0x0002 | 42 | ··0x0002c280·20202020·6f6e6c79·2070726f·63657373·····only·process |
| 43 | ··0x0002 | 43 | ··0x0002c290·20746172·67657473·20696e20·74686973··targets·in·this |
| 44 | ··0x0002 | 44 | ··0x0002c2a0·20626564·2066696c·65205b6f·7074696f··bed·file·[optio |
| 45 | ··0x0002 | 45 | ··0x0002c2b0·6e616c5d·00000000·20202d6f·2c2d2d6f·nal]....··-o,--o |
| 46 | ··0x0002 | 46 | ··0x0002c2c0·75747075·742d7663·66202020·20202020·utput-vcf······· |
| 47 | ··0x0002 | 47 | ··0x0002c2d0·20202020·20202020·20202020·20202020················· |
| 48 | ··0x0002 | 48 | ··0x0002c2e0·46494c45·20202020·20202020·76636620·FILE········vcf· |
| 49 | ··0x0002 | 49 | ··0x0002c2f0·66696c65·20776974·68207661·7269616e·file·with·varian |
| 50 | ··0x0002 | 50 | ··0x0002c300·74206361·6c6c696e·67207265·73756c74·t·calling·result |
| 51 | ··0x0002 | 51 | ··0x0002c310·73205b72·65717569·7265645d·00000000·s·[required].... |
| 52 | ··0x0002 | 52 | ··0x0002c320·20202d67·2c2d2d73·616d706c·652d6e61···-g,--sample-na |
| 53 | ··0x0002 | 53 | ··0x0002c330·6d652020·20202020·20202020·20202020·me·············· |
| 54 | ··0x0002 | 54 | ··0x0002c340·20202020·20202020·53545249·4e472020·········STRING·· |
| 55 | ··0x0002 | 55 | ··0x0002c350·20202020·73616d70·6c652066·6f722077·····sample·for·w |
| 56 | ··0x0002 | 56 | ··0x0002c360·68696368·20766172·69616e74·73206172·hich·variants·ar |
| 57 | ··0x0002 | 57 | ··0x0002c370·65206361·6c6c6564·2028496e·20636173·e·called·(In·cas |
| 58 | ··0x0002 | 58 | ··0x0002c380·65206f66·20696e70·75742042·414d2066·e·of·input·BAM·f |
| 59 | ··0x0002 | 59 | ··0x0002c390·696c6573·20776974·68206d75·6c746970·iles·with·multip |
| 60 | ··0x0002 | 60 | ··0x0002c3a0·6c652073·616d706c·65732920·5b6f7074·le·samples)·[opt |
| 61 | ··0x0002 | 61 | ··0x0002c3b0·696f6e61·6c206966·20746865·72652069·ional·if·there·i |
| 62 | ··0x0002 | 62 | ··0x0002c3c0·73206f6e·6c79206f·6e652073·616d706c·s·only·one·sampl |
| 63 | ··0x0002 | 63 | ··0x0002c3d0·655d0000·20202020·202d2d66·6f726365·e]..·····--force |
| 64 | ··0x0002 | 64 | ··0x0002c3e0·2d73616d·706c652d·6e616d65·20202020·-sample-name···· |
| 65 | ··0x0002 | 65 | ··0x0002c3f0·20202020·20202020·20202020·53545249·············STRI |
| 66 | ··0x0002 | 66 | ··0x0002c400·4e472020·20202020·666f7263·6520616c·NG······force·al |
| 67 | ··0x0002 | 67 | ··0x0002c410·6c207265·61642067·726f7570·7320746f·l·read·groups·to |
| 68 | ··0x0002 | 68 | ··0x0002c420·20686176·65207468·69732073·616d706c··have·this·sampl |
| 69 | ··0x0002 | 69 | ··0x0002c430·65206e61·6d65205b·6f66665d·00000000·e·name·[off].... |
| 70 | ··0x0002 | 70 | ··0x0002c440·20202020·202d2d6b·6d65725f·6c656e20······--kmer_len· |
| 71 | ··0x0002 | 71 | ··0x0002c450·20202020·20202020·20202020·20202020················· |
| 72 | ··0x0002 | 72 | ··0x0002c460·20202020·20202020·494e5420·20202020·········INT····· |
| 73 | ··0x0002 | 73 | ··0x0002c470·20202020·286b6c65·6e292053·697a6520·····(klen)·Size· |
| 74 | ··0x0002 | 74 | ··0x0002c480·6f662074·68652073·6d616c6c·65737420·of·the·smallest· |
| 75 | ··0x0002 | 75 | ··0x0002c490·6b2d6d65·72207573·65642069·6e206173·k-mer·used·in·as |
| 76 | ··0x0002 | 76 | ··0x0002c4a0·73656d62·6c79205b·31395d2e·00000000·sembly·[19]..... |
| 77 | ··0x0002 | 77 | ··0x0002c4b0·20202020·202d2d6d·696e5f76·61725f63······--min_var_c |
| 78 | ··0x0002 | 78 | ··0x0002c4c0·6f756e74·20202020·20202020·20202020·ount············ |
| 79 | ··0x0002 | 79 | ··0x0002c4d0·20202020·20202020·494e5420·20202020·········INT····· |
| 80 | ··0x0002 | 80 | ··0x0002c4e0·20202020·286d696e·636f756e·7429204d·····(mincount)·M |
| 81 | ··0x0002 | 81 | ··0x0002c4f0·696e696d·756d2073·7570706f·72742066·inimum·support·f |
| 82 | ··0x0002 | 82 | ··0x0002c500·6f722061·20766172·69616e74·20746f20·or·a·variant·to· |
| 83 | ··0x0002 | 83 | ··0x0002c510·62652065·76616c75·61746564·205b355d·be·evaluated·[5] |
| 84 | ··0x0002 | 84 | ··0x0002c520·2e000000·20202020·202d2d73·686f7274·....·····--short |
| 85 | ··0x0002 | 85 | ··0x0002c530·5f737566·6669785f·6d617463·68202020·_suffix_match··· |
| 86 | ··0x0002 | 86 | ··0x0002c540·20202020·20202020·20202020·494e5420·············INT· |
| 87 | ··0x0002 | 87 | ··0x0002c550·20202020·20202020·2873736d·29204d69·········(ssm)·Mi |
| 88 | ··0x0002 | 88 | ··0x0002c560·6e696d75·6d207365·7175656e·6365206d·nimum·sequence·m |
| 89 | ··0x0002 | 89 | ··0x0002c570·61746368·206f6e20·626f7468·20736964·atch·on·both·sid |
| 90 | ··0x0002 | 90 | ··0x0002c580·6573206f·66207468·65207661·7269616e·es·of·the·varian |
| 91 | ··0x0002 | 91 | ··0x0002c590·74205b35·5d2e0000·20202020·202d2d6d·t·[5]...·····--m |
| 92 | ··0x0002 | 92 | ··0x0002c5a0·696e5f69·6e64656c·5f73697a·65202020·in_indel_size··· |
| 93 | ··0x0002 | 93 | ··0x0002c5b0·20202020·20202020·20202020·20202020················· |
| 94 | ··0x0002 | 94 | ··0x0002c5c0·494e5420·20202020·20202020·286d6973·INT·········(mis |
| 95 | ··0x0002 | 95 | ··0x0002c5d0·29204d69·6e696d75·6d207369·7a652069·)·Minimum·size·i |
| 96 | ··0x0002 | 96 | ··0x0002c5e0·6e64656c·20726570·6f727465·64206279·ndel·reported·by |
| 97 | ··0x0002 | 97 | ··0x0002c5f0·20617373·656d626c·79205b34·5d2e0000··assembly·[4]... |
| 98 | ··0x0002 | 98 | ··0x0002c600·20202020·202d2d6d·61785f68·705f6c65······--max_hp_le |
| 99 | ··0x0002 | 99 | ··0x0002c610·6e677468·20202020·20202020·20202020·ngth············ |
| 100 | ··0x0002 | 100 | ··0x0002c620·20202020·20202020·494e5420·20202020·········INT····· |
| 101 | ··0x0002 | 101 | ··0x0002c630·20202020·286d6178·68702920·56617269·····(maxhp)·Vari |
| 102 | ··0x0002 | 102 | ··0x0002c640·616e7473·20636f6e·7461696e·696e6720·ants·containing· |
| 103 | ··0x0002 | 103 | ··0x0002c650·4850206c·61726765·72207468·616e2074·HP·larger·than·t |
| 104 | ··0x0002 | 104 | ··0x0002c660·68697320·61726520·6e6f7420·7265706f·his·are·not·repo |
| 105 | ··0x0002 | 105 | ··0x0002c670·72746564·205b385d·2e000000·20202020·rted·[8]....···· |
| 106 | ··0x0002 | 106 | ··0x0002c680·202d2d6d·696e5f76·61725f66·72657120··--min_var_freq· |
| 107 | ··0x0002 | 107 | ··0x0002c690·20202020·20202020·20202020·20202020················· |
| 108 | ··0x0002 | 108 | ··0x0002c6a0·20202020·464c4f41·54202020·20202020·····FLOAT······· |
| 109 | ··0x0002 | 109 | ··0x0002c6b0·286d696e·66726571·29204d69·6e696d75·(minfreq)·Minimu |
| 110 | ··0x0002 | 110 | ··0x0002c6c0·6d206672·65717565·6e637920·6f662074·m·frequency·of·t |
| 111 | ··0x0002 | 111 | ··0x0002c6d0·68652076·61726961·6e742074·6f206265·he·variant·to·be |
| 112 | ··0x0002 | 112 | ··0x0002c6e0·20726570·6f727465·64205b30·2e31355d··reported·[0.15] |
| 113 | ··0x0002 | 113 | ··0x0002c6f0·2e000000·20202020·202d2d6d·696e5f76·....·····--min_v |
| 114 | ··0x0002 | 114 | ··0x0002c700·61725f73·636f7265·20202020·20202020·ar_score········ |
| 115 | ··0x0002 | 115 | ··0x0002c710·20202020·20202020·20202020·464c4f41·············FLOA |
| 116 | ··0x0002 | 116 | ··0x0002c720·54202020·20202020·286d696e·73636f72·T·······(minscor |
| 117 | ··0x0002 | 117 | ··0x0002c730·6529204d·696e696d·756d2073·636f7265·e)·Minimum·score |
| 118 | ··0x0002 | 118 | ··0x0002c740·206f6620·74686520·76617269·616e7420··of·the·variant· |
| 119 | ··0x0002 | 119 | ··0x0002c750·746f2062·65207265·706f7274·6564205b·to·be·reported·[ |
| 120 | ··0x0002 | 120 | ··0x0002c760·31305d2e·00000000·20202020·202d2d72·10].....·····--r |
| 121 | ··0x0002 | 121 | ··0x0002c770·656c6174·6976655f·73747261·6e645f62·elative_strand_b |
| 122 | ··0x0002 | 122 | ··0x0002c780·69617320·20202020·20202020·20202020·ias············· |
| 123 | ··0x0002 | 123 | ··0x0002c790·464c4f41·54202020·20202020·28737462·FLOAT·······(stb |
| 124 | ··0x0002 | 124 | ··0x0002c7a0·69617329·20566172·69616e74·73207769·ias)·Variants·wi |
| 125 | ··0x0002 | 125 | ··0x0002c7b0·74682073·7472616e·64206269·61732061·th·strand·bias·a |
| Max diff block lines reached; 0/76290 bytes (0.00%) of diff not shown. | |||
| Offset 1, 132 lines modified | Offset 1, 133 lines modified | ||
| 1 | Hex·dump·of·section·'.eh_frame_hdr': | 1 | Hex·dump·of·section·'.eh_frame_hdr': |
| 2 | ··0x0002 | 2 | ··0x0002e398·011b033b·10080000·01010000·889cfdff·...;............ |
| 3 | ··0x0002 | 3 | ··0x0002e3a8·58080000·88a6fdff·7c080000·98a6fdff·X.......|....... |
| 4 | ··0x0002 | 4 | ··0x0002e3b8·40130000·b5a6fdff·ac130000·d2a6fdff·@............... |
| 5 | ··0x0002 | 5 | ··0x0002e3c8·cc240000·01a7fdff·b82f0000·04a8fdff·.$......./...... |
| 6 | ··0x0002 | 6 | ··0x0002e3d8·e8310000·6ca8fdff·34330000·b2a8fdff·.1..l...43...... |
| 7 | ··0x0002 | 7 | ··0x0002e3e8·3c360000·72aafdff·4c380000·2aabfdff·<6..r...L8..*... |
| 8 | ··0x0002 | 8 | ··0x0002e3f8·94390000·50abfdff·583b0000·84abfdff·.9..P...X;...... |
| 9 | ··0x0002 | 9 | ··0x0002e408·e83b0000·9aabfdff·d03d0000·4cacfdff·.;.......=..L... |
| 10 | ··0x0002 | 10 | ··0x0002e418·48400000·9aacfdff·30430000·5aadfdff·H@......0C..Z... |
| 11 | ··0x0002 | 11 | ··0x0002e428·a0440000·a8adfdff·88450000·04aefdff·.D.......E...... |
| 12 | ··0x0002e438·74460000·4aaefdff·ec460000·f8aefdff·tF..J....F...... | ||
| 12 | ··0x0002f420·e4450000·7a9efdff·54460000·289ffdff·.E..z...TF..(... | ||
| 13 | ··0x0002f430·b0460000·669ffdff·14470000·ba9ffdff·.F..f....G...... | ||
| 14 | ··0x0002 | 13 | ··0x0002e448·48470000·36affdff·ac470000·8aaffdff·HG..6....G...... |
| 15 | ··0x0002f450·3c480000·e2a0fdff·a4480000·1ea1fdff·<H.......H...... | ||
| 16 | ··0x0002 | 14 | ··0x0002e458·0c480000·faaffdff·6c480000·6eb0fdff·.H......lH..n... |
| 15 | ··0x0002e468·d4480000·aab0fdff·3c490000·e6b0fdff·.H......<I...... | ||
| 17 | ··0x0002 | 16 | ··0x0002e478·a8490000·6cb1fdff·044a0000·aab1fdff·.I..l....J...... |
| 18 | ··0x0002 | 17 | ··0x0002e488·644a0000·1eb2fdff·c44a0000·92b2fdff·dJ.......J...... |
| 19 | ··0x0002 | 18 | ··0x0002e498·244b0000·ccb2fdff·844b0000·06b3fdff·$K.......K...... |
| 20 | ··0x0002 | 19 | ··0x0002e4a8·084c0000·1ab3fdff·6c4c0000·42b3fdff·.L......lL..B... |
| 21 | ··0x0002 | 20 | ··0x0002e4b8·cc4c0000·beb3fdff·284d0000·f8b3fdff·.L......(M...... |
| 22 | ··0x0002 | 21 | ··0x0002e4c8·884d0000·74b4fdff·e84d0000·aeb4fdff·.M..t....M...... |
| 23 | ··0x0002f4d0·c04e0000·c0a6fdff·fc560000·d6a6fdff·.N.......V...... | ||
| 24 | ··0x0002 | 22 | ··0x0002e4d8·6c4e0000·9ab5fdff·f44e0000·40b6fdff·lN.......N..@... |
| 23 | ··0x0002e4e8·584f0000·7cb6fdff·94570000·92b6fdff·XO..|....W...... | ||
| 24 | ··0x0002e4f8·2c590000·4ab7fdff·88590000·ffb7fdff·,Y..J....Y...... | ||
| 25 | ··0x0002 | 25 | ··0x0002e508·f4590000·8ab9fdff·e45a0000·a0b9fdff·.Y.......Z...... |
| 26 | ··0x0002 | 26 | ··0x0002e518·2c5c0000·b4b9fdff·845c0000·c8b9fdff·,\.......\...... |
| 27 | ··0x0002 | 27 | ··0x0002e528·582f0000·b8befdff·e82f0000·f8befdff·X/......./...... |
| 28 | ··0x0002f520·40380000·90affdff·dc3b0000·d0affdff·@8.......;...... | ||
| 29 | ··0x0002 | 28 | ··0x0002e538·6c380000·38bffdff·083c0000·78bffdff·l8..8....<..x... |
| 29 | ··0x0002e548·784f0000·b8bffdff·045b0000·f8bffdff·xO.......[...... | ||
| 30 | ··0x0002 | 30 | ··0x0002e558·2c080000·28c1fdff·a4080000·68c1fdff·,...(.......h... |
| 31 | ··0x0002f550·d0080000·50b2fdff·04090000·00b3fdff·....P........... | ||
| 32 | ··0x0002f560·60090000·80b3fdff·b0090000·40b4fdff·`...........@... | ||
| 33 | ··0x0002f570·000a0000·f0b4fdff·5c0a0000·30b6fdff·........\...0... | ||
| 34 | ··0x0002f580·440b0000·d0b6fdff·980b0000·b0b7fdff·D............... | ||
| 35 | ··0x0002f590·740d0000·10b9fdff·1c0e0000·e0bbfdff·t............... | ||
| 36 | ··0x0002f5a0·300f0000·50c1fdff·68120000·b0c2fdff·0...P...h....... | ||
| 37 | ··0x0002f5b0·90120000·20c3fdff·ec120000·50c6fdff·....·.......P... | ||
| 38 | ··0x0002f5c0·54130000·80c9fdff·e8230000·e0cafdff·T........#...... | ||
| 39 | ··0x0002 | 31 | ··0x0002e568·e0080000·f8c1fdff·14090000·a8c2fdff·................ |
| 32 | ··0x0002e578·70090000·28c3fdff·c0090000·e8c3fdff·p...(........... | ||
| 40 | ··0x0002 | 33 | ··0x0002e588·100a0000·98c4fdff·6c0a0000·d8c5fdff·........l....... |
| 41 | ··0x0002f5f0·54110000·e0d0fdff·fc110000·90d1fdff·T............... | ||
| 42 | ··0x0002 | 34 | ··0x0002e598·500b0000·78c6fdff·a40b0000·58c7fdff·P...x.......X... |
| 35 | ··0x0002e5a8·800d0000·b8c8fdff·280e0000·88cbfdff·........(....... | ||
| 36 | ··0x0002e5b8·3c0f0000·f8d0fdff·74120000·58d2fdff·<.......t...X... | ||
| 43 | ··0x0002 | 37 | ··0x0002e5c8·9c120000·c8d2fdff·f8120000·f8d5fdff·................ |
| 38 | ··0x0002e5d8·60130000·28d9fdff·40240000·78dafdff·`...(...@$..x... | ||
| 39 | ··0x0002e5e8·90080000·88dafdff·140b0000·78dbfdff·............x... | ||
| 44 | ··0x0002f620·48150000·d0defdff·d0170000·10e0fdff·H............... | ||
| 45 | ··0x0002f630·68180000·60e1fdff·e0180000·90e1fdff·h...`........... | ||
| 46 | ··0x0002f640·0c190000·90e3fdff·c4190000·60e4fdff·............`... | ||
| 47 | ··0x0002f650·1c1a0000·80e6fdff·d41a0000·90e9fdff·................ | ||
| 48 | ··0x0002 | 40 | ··0x0002e5f8·100c0000·08dcfdff·6c0c0000·d8defdff·........l....... |
| 41 | ··0x0002e608·60110000·48e0fdff·08120000·f8e0fdff·`...H........... | ||
| 42 | ··0x0002e618·cc130000·d8e1fdff·44140000·28e2fdff·........D...(... | ||
| 43 | ··0x0002e628·88140000·28e6fdff·c4140000·28e7fdff·....(.......(... | ||
| 44 | ··0x0002e638·54150000·38eefdff·dc170000·78effdff·T...8.......x... | ||
| 45 | ··0x0002e648·74180000·c8f0fdff·ec180000·f8f0fdff·t............... | ||
| 46 | ··0x0002e658·18190000·f8f2fdff·d0190000·a8f3fdff·................ | ||
| 47 | ··0x0002e668·281a0000·c8f5fdff·e01a0000·98f8fdff·(............... | ||
| 48 | ··0x0002e678·1c1b0000·7808feff·d81b0000·f80bfeff·....x........... | ||
| 49 | ··0x0002 | 49 | ··0x0002e688·8c1c0000·080ffeff·6c1d0000·0810feff·........l....... |
| 50 | ··0x0002 | 50 | ··0x0002e698·cc1d0000·3811feff·541e0000·9811feff·....8...T....... |
| 51 | ··0x0002 | 51 | ··0x0002e6a8·a41e0000·9812feff·141f0000·1814feff·................ |
| 52 | ··0x0002 | 52 | ··0x0002e6b8·501f0000·0816feff·fc1f0000·8816feff·P............... |
| 53 | ··0x0002 | 53 | ··0x0002e6c8·30200000·681cfeff·c4200000·781ffeff·0·..h....·..x... |
| 54 | ··0x0002 | 54 | ··0x0002e6d8·00210000·e821feff·3c210000·4825feff·.!...!..<!..H%.. |
| 55 | ··0x0002 | 55 | ··0x0002e6e8·ec210000·183cfeff·34220000·883dfeff·.!...<..4"...=.. |
| 56 | ··0x0002f6e0·c8220000·803bfeff·58230000·403dfeff·."...;..X#..@=.. | ||
| 57 | ··0x0002f6f0·b0240000·703efeff·18250000·6043feff·.$..p>...%..`C.. | ||
| 58 | ··0x0002 | 56 | ··0x0002e6f8·c4220000·5848feff·20230000·c849feff·."..XH..·#...I.. |
| 57 | ··0x0002e708·b0230000·b84bfeff·08250000·e84cfeff·.#...K...%...L.. | ||
| 58 | ··0x0002e718·70250000·d851feff·c0250000·a854feff·p%...Q...%...T.. | ||
| 59 | ··0x0002 | 59 | ··0x0002e728·08260000·a860feff·6c260000·9867feff·.&...`..l&...g.. |
| 60 | ··0x0002 | 60 | ··0x0002e738·b4260000·8873feff·24270000·c879feff·.&...s..$'...y.. |
| 61 | ··0x0002 | 61 | ··0x0002e748·70270000·788afeff·e0270000·5893feff·p'..x....'..X... |
| 62 | ··0x0002 | 62 | ··0x0002e758·1c280000·6895feff·58280000·a897feff·.(..h...X(...... |
| 63 | ··0x0002 | 63 | ··0x0002e768·94280000·c89cfeff·dc280000·c8a1feff·.(.......(...... |
| 64 | ··0x0002 | 64 | ··0x0002e778·2c290000·48aafeff·b8290000·f8abfeff·,)..H....)...... |
| 65 | ··0x0002 | 65 | ··0x0002e788·0c2a0000·d8adfeff·902a0000·28affeff·.*.......*..(... |
| 66 | ··0x0002 | 66 | ··0x0002e798·cc2a0000·78b0feff·082b0000·08b1feff·.*..x....+...... |
| 67 | ··0x0002 | 67 | ··0x0002e7a8·5c2b0000·48b3feff·982b0000·88b5feff·\+..H....+...... |
| 68 | ··0x0002f7a0·302c0000·b0aefeff·7c2c0000·30b0feff·0,......|,..0... | ||
| 69 | ··0x0002 | 68 | ··0x0002e7b8·e42b0000·78b6feff·682c0000·88b8feff·.+..x...h,...... |
| 69 | ··0x0002e7c8·b42c0000·78b9feff·342d0000·68c2feff·.,..x...4-..h... | ||
| 70 | ··0x0002 | 70 | ··0x0002e7d8·742d0000·f8c4feff·b42d0000·88ccfeff·t-.......-...... |
| 71 | ··0x0002 | 71 | ··0x0002e7e8·f42d0000·b8d1feff·1c2f0000·5adefeff·.-......./..Z... |
| 72 | ··0x0002f7e0·00300000·cfdcfeff·14300000·d3dcfeff·.0.......0...... | ||
| 73 | ··0x0002 | 72 | ··0x0002e7f8·20300000·5edefeff·34300000·62defeff··0..^...40..b... |
| 74 | ··0x0002 | 73 | ··0x0002e808·48300000·66defeff·5c300000·78defeff·H0..f...\0..x... |
| 74 | ··0x0002e818·70300000·b8defeff·8c300000·38dffeff·p0.......0..8... | ||
| 75 | ··0x0002e828·dc300000·e8dffeff·38310000·08e0feff·.0......81...... | ||
| 75 | ··0x0002 | 76 | ··0x0002e838·4c310000·98e0feff·ac310000·28e6feff·L1.......1..(... |
| 76 | ··0x0002f820·78310000·b0e4feff·c4320000·80f0feff·x1.......2...... | ||
| 77 | ··0x0002 | 77 | ··0x0002e848·f8320000·f8f1feff·e4350000·5803ffff·.2.......5..X... |
| 78 | ··0x0002e858·f8370000·6811ffff·08320000·c812ffff·.7..h....2...... | ||
| 78 | ··0x0002 | 79 | ··0x0002e868·88320000·c813ffff·54330000·0817ffff·.2......T3...... |
| 79 | ··0x0002f850·20330000·3015ffff·c8330000·d016ffff··3..0....3...... | ||
| 80 | ··0x0002 | 80 | ··0x0002e878·fc330000·7818ffff·68340000·f819ffff·.3..x...h4...... |
| 81 | ··0x0002 | 81 | ··0x0002e888·f0340000·681bffff·78350000·d81cffff·.4..h...x5...... |
| 82 | ··0x0002 | 82 | ··0x0002e898·5c360000·b81dffff·c0360000·f81effff·\6.......6...... |
| 83 | ··0x0002f890·78380000·3020ffff·c8380000·e020ffff·x8..0·...8...·.. | ||
| 84 | ··0x0002f8a0·24390000·7023ffff·303a0000·3027ffff·$9..p#..0:..0'.. | ||
| 85 | ··0x0002f8b0·6c3b0000·2033ffff·88390000·f035ffff·l;..·3...9...5.. | ||
| 86 | ··0x0002 | 83 | ··0x0002e8a8·2c370000·2821ffff·a4380000·a821ffff·,7..(!...8...!.. |
| 84 | ··0x0002e8b8·f4380000·5822ffff·50390000·e824ffff·.8..X"..P9...$.. | ||
| 85 | ··0x0002e8c8·5c3a0000·a828ffff·983b0000·9834ffff·\:...(...;...4.. | ||
| 86 | ··0x0002e8d8·b4390000·6837ffff·403c0000·e837ffff·.9..h7..@<...7.. | ||
| 87 | ··0x0002 | 87 | ··0x0002e8e8·943c0000·3838ffff·d03c0000·e838ffff·.<..88...<...8.. |
| 88 | ··0x0002f8e0·603d0000·c03cffff·243e0000·403dffff·`=...<..$>..@=.. | ||
| 89 | ··0x0002f8f0·f03e0000·903dffff·803f0000·703effff·.>...=...?..p>.. | ||
| 90 | ··0x0002f900·10400000·403fffff·e4400000·3040ffff·.@..@?...@..0@.. | ||
| 91 | ··0x0002f910·e8410000·5041ffff·4c420000·c044ffff·.A..PA..LB...D.. | ||
| 92 | ··0x0002 | 88 | ··0x0002e8f8·2c3d0000·8839ffff·903d0000·983cffff·,=...9...=...<.. |
| 89 | ··0x0002e908·f03d0000·d83effff·b43e0000·583fffff·.=...>...>..X?.. | ||
| 90 | ··0x0002e918·803f0000·a83fffff·10400000·8840ffff·.?...?...@...@.. | ||
| 91 | ··0x0002e928·a0400000·5841ffff·74410000·4842ffff·.@..XA..tA..HB.. | ||
| 92 | ··0x0002e938·78420000·6843ffff·dc420000·d846ffff·xB..hC...B...F.. | ||
| 93 | ··0x0002e948·60440000·184affff·48450000·884dffff·`D...J..HE...M.. | ||
| 93 | ··0x0002 | 94 | ··0x0002e958·38460000·1852ffff·94460000·185affff·8F...R...F...Z.. |
| 94 | ··0x0002f940·74460000·e058ffff·d0460000·e05affff·tF...X...F...Z.. | ||
| Max diff block lines reached; 0/17391 bytes (0.00%) of diff not shown. | |||
| Offset 1, 1350 lines modified | Offset 1, 1358 lines modified | ||
| Diff chunk too large, falling back to line-by-line diff (1355 lines added, 1347 lines removed) | |||
| 1 | Hex·dump·of·section·'.eh_frame': | 1 | Hex·dump·of·section·'.eh_frame': |
| 2 | ··0x0002 | 2 | ··0x0002ebac·14000000·00000000·017a5200·017c0801·.........zR..|.. |
| 3 | ··0x0002 | 3 | ··0x0002ebbc·1b0c0404·88010708·10000000·1c000000·................ |
| 4 | ··0x0002 | 4 | ··0x0002ebcc·c4b7fdff·2c000000·00000000·14000000·....,........... |
| 5 | ··0x0002 | 5 | ··0x0002ebdc·00000000·017a5200·017c0801·1b0c0404·.....zR..|...... |
| 6 | ··0x0002 | 6 | ··0x0002ebec·88010000·20000000·1c000000·2894fdff·....·.......(... |
| 7 | ··0x0002 | 7 | ··0x0002ebfc·000a0000·000e0846·0e0c4a0f·0b740478·.......F..J..t.x |
| 8 | ··0x0002 | 8 | ··0x0002ec0c·003f1a3b·2a322422·10000000·40000000·.?.;*2$"....@... |
| 9 | ··0x0002 | 9 | ··0x0002ec1c·049efdff·08000000·00000000·10000000·................ |
| 10 | ··0x0002 | 10 | ··0x0002ec2c·54000000·e0d1fdff·06000000·00000000·T............... |
| 11 | ··0x0002 | 11 | ··0x0002ec3c·38000000·68000000·7cb8fdff·39000000·8...h...|...9... |
| 12 | ··0x0002 | 12 | ··0x0002ec4c·00410e08·8702410e·0c860343·0e108304·.A....A....C.... |
| 13 | ··0x0002 | 13 | ··0x0002ec5c·5d0e1441·0e18410e·1c410e20·480e1049·]..A..A..A.·H..I |
| 14 | ··0x0002 | 14 | ··0x0002ec6c·c30e0c41·c60e0841·c70e0400·30000000·...A...A....0... |
| 15 | ··0x0002 | 15 | ··0x0002ec7c·a4000000·80b8fdff·8a000000·00410e08·.............A.. |
| 16 | ··0x0002 | 16 | ··0x0002ec8c·8602410e·0c830302·5e0ac30e·0841c60e·..A.....^....A.. |
| 17 | ··0x0002 | 17 | ··0x0002ec9c·04470b49·0ac30e08·41c60e04·460b0000·.G.I....A...F... |
| 18 | ··0x0002 | 18 | ··0x0002ecac·58000000·d8000000·dcb8fdff·a7000000·X............... |
| 19 | ··0x0002 | 19 | ··0x0002ecbc·00410e08·8502450e·0c870343·0e108604·.A....E....C.... |
| 20 | ··0x0002 | 20 | ··0x0002eccc·430e1483·054e0e30·7e0a0e14·41c30e10·C....N.0~...A... |
| 21 | ··0x0002 | 21 | ··0x0002ecdc·41c60e0c·41c70e08·41c50e04·440b530e·A...A...A...D.S. |
| 22 | ··0x0002 | 22 | ··0x0002ecec·34420e38·450e3c41·0e404c0e·30480e34·4B.8E.<A.@L.0H.4 |
| 23 | ··0x0002 | 23 | ··0x0002ecfc·410e3841·0e3c410e·404e0e30·4c000000·A.8A.<A.@N.0L... |
| 24 | ··0x0002 | 24 | ··0x0002ed0c·34010000·30b9fdff·75000000·00410e08·4...0...u....A.. |
| 25 | ··0x0002 | 25 | ··0x0002ed1c·8702410e·0c860343·0e108304·650e1841·..A....C....e..A |
| 26 | ··0x0002 | 26 | ··0x0002ed2c·0e1c410e·20500e10·410ac30e·0c41c60e·..A.·P..A....A.. |
| 27 | ··0x0002 | 27 | ··0x0002ed3c·0841c70e·04410b43·0e1c410e·20500e10·.A...A.C..A.·P.. |
| 28 | ··0x0002 | 28 | ··0x0002ed4c·4f0e1842·0e1c410e·20480e10·4c000000·O..B..A.·H..L... |
| 29 | ··0x0002 | 29 | ··0x0002ed5c·84010000·60b9fdff·b5000000·00410e08·....`........A.. |
| 30 | ··0x0002 | 30 | ··0x0002ed6c·8702430e·0c860343·0e108304·02420ac3·..C....C.....B.. |
| 31 | ··0x0002 | 31 | ··0x0002ed7c·0e0c41c6·0e0841c7·0e04450b·6b0e1441·..A...A...E.k..A |
| 32 | ··0x0002 | 32 | ··0x0002ed8c·0e18410e·1c410e20·4d0e1054·0ac30e0c·..A..A.·M..T.... |
| 33 | ··0x0002 | 33 | ··0x0002ed9c·41c60e08·41c70e04·470b0000·58000000·A...A...G...X... |
| 34 | ··0x0002 | 34 | ··0x0002edac·d4010000·d0b9fdff·a7000000·00410e08·.............A.. |
| 35 | ··0x0002 | 35 | ··0x0002edbc·8502450e·0c870343·0e108604·430e1483·..E....C....C... |
| 36 | ··0x0002 | 36 | ··0x0002edcc·054e0e30·7e0a0e14·41c30e10·41c60e0c·.N.0~...A...A... |
| 37 | ··0x0002 | 37 | ··0x0002eddc·41c70e08·41c50e04·440b530e·34420e38·A...A...D.S.4B.8 |
| 38 | ··0x0002 | 38 | ··0x0002edec·450e3c41·0e404c0e·30480e34·410e3841·E.<A.@L.0H.4A.8A |
| 39 | ··0x0002 | 39 | ··0x0002edfc·0e3c410e·404e0e30·a4000000·30020000·.<A.@N.0....0... |
| 40 | ··0x0002 | 40 | ··0x0002ee0c·24bafdff·39010000·004c0e08·8502410e·$...9....L....A. |
| 41 | ··0x0002 | 41 | ··0x0002ee1c·0c870341·0e108604·410e1483·05430e30·...A....A....C.0 |
| 42 | ··0x0002 | 42 | ··0x0002ee2c·740e3441·0e38410e·3c410e40·4e0e3046·t.4A.8A.<A.@N.0F |
| 43 | ··0x0002 | 43 | ··0x0002ee3c·0a0e1441·c30e1041·c60e0c41·c70e0841·...A...A...A...A |
| 44 | ··0x0002 | 44 | ··0x0002ee4c·c50e0447·0b470e34·410e3841·0e3c410e·...G.G.4A.8A.<A. |
| 45 | ··0x0002 | 45 | ··0x0002ee5c·405c0e30·4e0a0e14·41c30e10·41c60e0c·@\.0N...A...A... |
| 46 | ··0x0002 | 46 | ··0x0002ee6c·41c70e08·41c50e04·480b530e·3c450e40·A...A...H.S.<E.@ |
| 47 | ··0x0002 | 47 | ··0x0002ee7c·540e3049·0e34410e·38410e3c·410e4048·T.0I.4A.8A.<A.@H |
| 48 | ··0x0002 | 48 | ··0x0002ee8c·0e304c0e·38430e3c·410e404c·0e304f0e·.0L.8C.<A.@L.0O. |
| 49 | ··0x0002 | 49 | ··0x0002ee9c·34430e38·410e3c44·0e404e0e·30000000·4C.8A.<D.@N.0... |
| 50 | ··0x0002 | 50 | ··0x0002eeac·38000000·d8020000·6ccffdff·e6000000·8.......l....... |
| 51 | ··0x0002 | 51 | ··0x0002eebc·00410e08·8502410e·0c870341·0e108604·.A....A....A.... |
| 52 | ··0x0002 | 52 | ··0x0002eecc·410e1483·0502cc0a·c30e1041·c60e0c41·A..........A...A |
| 53 | ··0x0002 | 53 | ··0x0002eedc·c70e0841·c50e0445·0b000000·50000000·...A...E....P... |
| 54 | ··0x0002 | 54 | ··0x0002eeec·14030000·80bafdff·91000000·00410e08·.............A.. |
| 55 | ··0x0002 | 55 | ··0x0002eefc·8502410e·0c870341·0e108604·410e1483·..A....A....A... |
| 56 | ··0x0002 | 56 | ··0x0002ef0c·054e0e30·02420e38·440e3c41·0e40480e·.N.0.B.8D.<A.@H. |
| 57 | ··0x0002 | 57 | ··0x0002ef1c·30430e38·420e3c41·0e40480e·305d0e14·0C.8B.<A.@H.0].. |
| 58 | ··0x0002 | 58 | ··0x0002ef2c·41c30e10·41c60e0c·41c70e08·41c50e04·A...A...A...A... |
| 59 | ··0x0002 | 59 | ··0x0002ef3c·68000000·68030000·ccbafdff·d8000000·h...h........... |
| 60 | ··0x0002 | 60 | ··0x0002ef4c·00410e08·8502430e·0c870341·0e108604·.A....C....A.... |
| 61 | ··0x0002 | 61 | ··0x0002ef5c·430e1483·05510e40·5d0e4c41·0e50480e·C....Q.@].LA.PH. |
| 62 | ··0x0002 | 62 | ··0x0002ef6c·40720a0e·1441c30e·1041c60e·0c41c70e·@r...A...A...A.. |
| 63 | ··0x0002 | 63 | ··0x0002ef7c·0841c50e·044b0b53·0e44420e·48450e4c·.A...K.S.DB.HE.L |
| 64 | ··0x0002 | 64 | ··0x0002ef8c·410e5050·0e40460e·44410e48·410e4c41·A.PP.@F.DA.HA.LA |
| 65 | ··0x0002 | 65 | ··0x0002ef9c·0e504e0e·404a0e4c·470e5000·58000000·.PN.@J.LG.P.X... |
| 66 | ··0x0002 | 66 | ··0x0002efac·d4030000·60cffdff·86000000·00410e08·....`........A.. |
| 67 | ··0x0002 | 67 | ··0x0002efbc·8702410e·0c860341·0e108304·6b0e1843·..A....A....k..C |
| 68 | ··0x0002 | 68 | ··0x0002efcc·0e1c410e·20480e10·4d0e1843·0e1c410e·..A.·H..M..C..A. |
| 69 | ··0x0002 | 69 | ··0x0002efdc·20480e10·500e1844·0e1c410e·20480e10··H..P..D..A.·H.. |
| 70 | ··0x0002 | 70 | ··0x0002efec·430e1842·0e1c410e·20480e10·45c30e0c·C..B..A.·H..E... |
| 71 | ··0x0002 | 71 | ··0x0002effc·41c60e08·41c70e04·10010000·30040000·A...A.......0... |
| 72 | ··0x0002f | 72 | ··0x0002f00c·94cffdff·cc020000·00410e08·8502410e·.........A....A. |
| 73 | ··0x0002f | 73 | ··0x0002f01c·0c870341·0e108604·430e1483·054e0e40·...A....C....N.@ |
| 74 | ··0x000 | 74 | ··0x0002f02c·02950e48·480e4c41·0e504c0e·40430e48·...HH.LA.PL.@C.H |
| 75 | ··0x000 | 75 | ··0x0002f03c·420e4c41·0e50480e·40570e48·440e4c41·B.LA.PH.@W.HD.LA |
| 76 | ··0x000 | 76 | ··0x0002f04c·0e50480e·40430e48·420e4c41·0e50480e·.PH.@C.HB.LA.PH. |
| 77 | ··0x000 | 77 | ··0x0002f05c·405e0e48·440e4c41·0e50480e·40430e48·@^.HD.LA.PH.@C.H |
| 78 | ··0x000 | 78 | ··0x0002f06c·420e4c41·0e50480e·40700e48·440e4c41·B.LA.PH.@p.HD.LA |
| 79 | ··0x000 | 79 | ··0x0002f07c·0e50480e·40430e48·420e4c41·0e50480e·.PH.@C.HB.LA.PH. |
| 80 | ··0x000 | 80 | ··0x0002f08c·40650e48·440e4c41·0e50480e·40430e48·@e.HD.LA.PH.@C.H |
| 81 | ··0x000 | 81 | ··0x0002f09c·420e4c41·0e50480e·406a0e48·440e4c41·B.LA.PH.@j.HD.LA |
| 82 | ··0x000 | 82 | ··0x0002f0ac·0e50480e·40430e48·420e4c41·0e50480e·.PH.@C.HB.LA.PH. |
| 83 | ··0x000 | 83 | ··0x0002f0bc·405f0e48·440e4c41·0e50480e·40430e48·@_.HD.LA.PH.@C.H |
| 84 | ··0x000 | 84 | ··0x0002f0cc·420e4c41·0e50480e·40640e48·440e4c41·B.LA.PH.@d.HD.LA |
| 85 | ··0x000 | 85 | ··0x0002f0dc·0e50480e·40430e48·420e4c41·0e50480e·.PH.@C.HB.LA.PH. |
| 86 | ··0x000 | 86 | ··0x0002f0ec·405e0e48·440e4c41·0e50480e·40430e48·@^.HD.LA.PH.@C.H |
| 87 | ··0x000 | 87 | ··0x0002f0fc·420e4c41·0e50480e·404e0e14·41c30e10·B.LA.PH.@N..A... |
| 88 | ··0x000 | 88 | ··0x0002f10c·41c60e0c·41c70e08·41c50e04·a4000000·A...A...A....... |
| 89 | ··0x000 | 89 | ··0x0002f11c·44050000·d0b9fdff·60010000·00410e08·D.......`....A.. |
| 90 | ··0x000 | 90 | ··0x0002f12c·8502410e·0c870341·0e108604·410e1483·..A....A....A... |
| 91 | ··0x000 | 91 | ··0x0002f13c·054e0e30·7a0e3844·0e3c410e·40480e30·.N.0z.8D.<A.@H.0 |
| 92 | ··0x000 | 92 | ··0x0002f14c·560e3844·0e3c410e·40480e30·500e3844·V.8D.<A.@H.0P.8D |
| 93 | ··0x000 | 93 | ··0x0002f15c·0e3c410e·40480e30·5e0e3844·0e3c410e·.<A.@H.0^.8D.<A. |
| 94 | ··0x000 | 94 | ··0x0002f16c·40480e30·540e3843·0e3c410e·40480e30·@H.0T.8C.<A.@H.0 |
| 95 | ··0x000 | 95 | ··0x0002f17c·500e3844·0e3c410e·40480e30·500e3844·P.8D.<A.@H.0P.8D |
| 96 | ··0x000 | 96 | ··0x0002f18c·0e3c410e·40480e30·500e3844·0e3c410e·.<A.@H.0P.8D.<A. |
| 97 | ··0x000 | 97 | ··0x0002f19c·40480e30·430e3845·0e3c410e·404c0e30·@H.0C.8E.<A.@L.0 |
| 98 | ··0x000 | 98 | ··0x0002f1ac·4b0e1441·c30e1041·c60e0c41·c70e0841·K..A...A...A...A |
| 99 | ··0x000 | 99 | ··0x0002f1bc·c50e0400·10010000·ec050000·88bafdff·................ |
| 100 | ··0x000 | 100 | ··0x0002f1cc·cc020000·00410e08·8502410e·0c870341·.....A....A....A |
| 101 | ··0x000 | 101 | ··0x0002f1dc·0e108604·430e1483·054e0e40·02950e48·....C....N.@...H |
| 102 | ··0x000 | 102 | ··0x0002f1ec·480e4c41·0e504c0e·40430e48·420e4c41·H.LA.PL.@C.HB.LA |
| 103 | ··0x000 | 103 | ··0x0002f1fc·0e50480e·40570e48·440e4c41·0e50480e·.PH.@W.HD.LA.PH. |
| 104 | ··0x000 | 104 | ··0x0002f20c·40430e48·420e4c41·0e50480e·405e0e48·@C.HB.LA.PH.@^.H |
| 105 | ··0x000 | 105 | ··0x0002f21c·440e4c41·0e50480e·40430e48·420e4c41·D.LA.PH.@C.HB.LA |
| 106 | ··0x000 | 106 | ··0x0002f22c·0e50480e·40700e48·440e4c41·0e50480e·.PH.@p.HD.LA.PH. |
| 107 | ··0x000 | 107 | ··0x0002f23c·40430e48·420e4c41·0e50480e·40650e48·@C.HB.LA.PH.@e.H |
| 108 | ··0x000 | 108 | ··0x0002f24c·440e4c41·0e50480e·40430e48·420e4c41·D.LA.PH.@C.HB.LA |
| 109 | ··0x000 | 109 | ··0x0002f25c·0e50480e·406a0e48·440e4c41·0e50480e·.PH.@j.HD.LA.PH. |
| 110 | ··0x000 | 110 | ··0x0002f26c·40430e48·420e4c41·0e50480e·405f0e48·@C.HB.LA.PH.@_.H |
| 111 | ··0x000 | 111 | ··0x0002f27c·440e4c41·0e50480e·40430e48·420e4c41·D.LA.PH.@C.HB.LA |
| 112 | ··0x000 | 112 | ··0x0002f28c·0e50480e·40640e48·440e4c41·0e50480e·.PH.@d.HD.LA.PH. |
| 113 | ··0x000 | 113 | ··0x0002f29c·40430e48·420e4c41·0e50480e·405e0e48·@C.HB.LA.PH.@^.H |
| 114 | ··0x000 | 114 | ··0x0002f2ac·440e4c41·0e50480e·40430e48·420e4c41·D.LA.PH.@C.HB.LA |
| 115 | ··0x000 | 115 | ··0x0002f2bc·0e50480e·404e0e14·41c30e10·41c60e0c·.PH.@N..A...A... |
| 116 | ··0x000 | 116 | ··0x0002f2cc·41c70e08·41c50e04·00020000·00070000·A...A........... |
| 117 | ··0x000 | 117 | ··0x0002f2dc·44bcfdff·67050000·00410e08·8502410e·D...g....A....A. |
| 118 | ··0x000 | 118 | ··0x0002f2ec·0c870341·0e108604·430e1483·054e0e30·...A....C....N.0 |
| 119 | ··0x000 | 119 | ··0x0002f2fc·02450e38·440e3c41·0e40480e·30590e38·.E.8D.<A.@H.0Y.8 |
| 120 | ··0x000 | 120 | ··0x0002f30c·440e3c41·0e40480e·30590e38·440e3c41·D.<A.@H.0Y.8D.<A |
| 121 | ··0x000 | 121 | ··0x0002f31c·0e40480e·30530e38·430e3c41·0e40480e·.@H.0S.8C.<A.@H. |
| 122 | ··0x000 | 122 | ··0x0002f32c·30500e38·440e3c41·0e40480e·30500e38·0P.8D.<A.@H.0P.8 |
| 123 | ··0x000 | 123 | ··0x0002f33c·440e3c41·0e40480e·30500e38·440e3c41·D.<A.@H.0P.8D.<A |
| 124 | ··0x000 | 124 | ··0x0002f34c·0e40480e·30500e38·440e3c41·0e40480e·.@H.0P.8D.<A.@H. |
| 125 | ··0x000 | 125 | ··0x0002f35c·304f0e38·440e3c41·0e40480e·3002600e·0O.8D.<A.@H.0.`. |
| Max diff block lines reached; 0/181086 bytes (0.00%) of diff not shown. | |||
| Offset 1, 297 lines modified | Offset 1, 294 lines modified | ||
| 1 | Hex·dump·of·section·'.gcc_except_table': | 1 | Hex·dump·of·section·'.gcc_except_table': |
| 2 | ··0x00034 | 2 | ··0x0003405c·ffff0100·ffff010b·4c050000·b401ed04·........L....... |
| 3 | ··0x00034 | 3 | ··0x0003406c·a10600ff·ff010418·050000ff·ff010b52·...............R |
| 4 | ··0x00034 | 4 | ··0x0003407c·050000b4·01f504a9·0600ffff·01041805·................ |
| 5 | ··0x00034 | 5 | ··0x0003408c·0000ffff·011b3425·0000622a·bd070097·......4%..b*.... |
| 6 | ··0x00034 | 6 | ··0x0003409c·012ab907·00cc0117·b50700d0·02a60500·.*.............. |
| 7 | ··0x00034 | 7 | ··0x000340ac·00000000·ff9b1101·06fd0305·a9050101·................ |
| 8 | ··0x0003 | 8 | ··0x000340bc·00000000·00000000·ffff01d5·02b30225·...............% |
| 9 | ··0x0003 | 9 | ··0x000340cc·ad1e00eb·0205a31e·00a00305·ad1e00b8·................ |
| 10 | ··0x0003 | 10 | ··0x000340dc·0305f919·00f30305·ad1e0086·0405a81e·................ |
| 11 | ··0x0003 | 11 | ··0x000340ec·00b20405·a71a00fb·0405ad1e·008e0505·................ |
| 12 | ··0x0003 | 12 | ··0x000340fc·b71a00b3·0505b51a·00f20531·ad1e00b1·...........1.... |
| 13 | ··0x0003 | 13 | ··0x0003410c·0605b91a·00d60605·b11a00a9·0705ad1e·................ |
| 14 | ··0x0003 | 14 | ··0x0003411c·00bc0705·af1a00e1·0705ab1a·00b40805·................ |
| 15 | ··0x0003 | 15 | ··0x0003412c·ad1e00c7·0805a91a·00ec0805·9e1e00bf·................ |
| 16 | ··0x0003 | 16 | ··0x0003413c·0905ad1e·00d20905·841a00f7·0905861a·................ |
| 17 | ··0x0003 | 17 | ··0x0003414c·00dc0a05·ad1e00ed·0a05c31a·00920b05·................ |
| 18 | ··0x0003 | 18 | ··0x0003415c·e01c00c2·0b05d51c·00ea0b05·f11c00f9·................ |
| 19 | ··0x0003 | 19 | ··0x0003416c·0c05e51c·00ab0d05·ed1c00be·0d449c1a·.............D.. |
| 20 | ··0x0003 | 20 | ··0x0003417c·00a40e5d·c11a00a4·0f05b31f·00d51005·...]............ |
| 21 | ··0x0003 | 21 | ··0x0003418c·f11c00ee·1005eb1e·009b1105·f11c00b4·................ |
| 22 | ··0x0003 | 22 | ··0x0003419c·11058f1e·00e11105·f11c00fa·11058a1e·................ |
| 23 | ··0x0003 | 23 | ··0x000341ac·00a71205·f11c00c0·1205e11e·00ed1205·................ |
| 24 | ··0x0003 | 24 | ··0x000341bc·f11c0086·1305dc1e·00b31305·f11c00d4·................ |
| 25 | ··0x0003 | 25 | ··0x000341cc·1305e61e·00811405·f11c009f·1405911a·................ |
| 26 | ··0x0003 | 26 | ··0x000341dc·00cc1405·f11c00ed·1405991e·009a1505·................ |
| 27 | ··0x0003 | 27 | ··0x000341ec·f11c00b3·1505941e·00d01505·f11c00f0·................ |
| 28 | ··0x0003 | 28 | ··0x000341fc·1705ad1e·00971813·c11a00c5·18059c1a·................ |
| 29 | ··0x0003 | 29 | ··0x0003420c·00e9182b·c11a00b4·193ead1e·00ae1f05·...+.....>...... |
| 30 | ··0x0003 | 30 | ··0x0003421c·00000000·ff9b2101·16900105·9b0601dd·......!......... |
| 31 | ··0x0003 | 31 | ··0x0003422c·053e0000·c60605e5·0600f406·05000001·.>.............. |
| 32 | ··0x0003 | 32 | ··0x0003423c·00000000·00000000·ff9b2901·1f400500·..........)..@.. |
| 33 | ··0x0003 | 33 | ··0x0003424c·007305fd·0101ef01·0e0000b1·0205b602·.s.............. |
| 34 | ··0x0003 | 34 | ··0x0003425c·03e30205·e80200f6·02050000·0100007d·...............} |
| 35 | ··0x0003 | 35 | ··0x0003426c·00000000·ffff013d·2d050000·4b05e605·.......=-...K... |
| 36 | ··0x0003 | 36 | ··0x0003427c·006605e2·05008101·05c30400·9c0105bf·.f.............. |
| 37 | ··0x0003 | 37 | ··0x0003428c·04008a02·05f80500·a20305ea·0500cc03·................ |
| 38 | ··0x0003 | 38 | ··0x0003429c·05f10500·8d0405fc·0500ba04·05f80500·................ |
| 39 | ··0x0003 | 39 | ··0x000342ac·dd050500·00000000·ff9b2501·1b780500·..........%..x.. |
| 40 | ··0x0003 | 40 | ··0x000342bc·00880105·b7040180·02b70200·00d80405·................ |
| 41 | ··0x0003 | 41 | ··0x000342cc·dd0400eb·04050000·01000000·00000000·................ |
| 42 | ··0x0003 | 42 | ··0x000342dc·ffff015d·9c030500·00ae0305·eb2b00e4·...].........+.. |
| 43 | ··0x0003 | 43 | ··0x000342ec·05050000·f60505d8·2b00f606·05e02b00·........+.....+. |
| 44 | ··0x0003 | 44 | ··0x000342fc·f4070500·00b50805·e42b00ec·0805a32d·.........+.....- |
| 45 | ··0x0003 | 45 | ··0x0003430c·009a0905·d72c00c5·0a05dc2b·00ab0f05·.....,.....+.... |
| 46 | ··0x0003 | 46 | ··0x0003431c·e02b00bc·0f05ef2b·00dc10c5·15e02b00·.+.....+......+. |
| 47 | ··0x0003 | 47 | ··0x0003432c·f02905d1·2b00cc2b·05a32d00·b62c6d00·.)..+..+..-..,m. |
| 48 | ··0x0003 | 48 | ··0x0003433c·00000000·ff9b5101·46557d00·00fe0105·......Q.FU}..... |
| 49 | ··0x0003 | 49 | ··0x0003434c·d7140092·0255d314·00990593·05dd1400·.....U.......... |
| 50 | ··0x000352ac·8c0b059d·15018c0d·05891600·af0d0599·................ | ||
| 51 | ··0x000352bc·15009212·050000c5·134e9915·00ad1405·.........N...... | ||
| 52 | ··0x0003 | 50 | ··0x0003435c·d40a05db·1401d40c·05dd1400·f70c05d3·................ |
| 51 | ··0x0003436c·1400ea10·d8020000·e6134ed3·1400ce14·..........N..... | ||
| 52 | ··0x0003437c·05d71400·9a150500·00bb1505·c0150001·................ | ||
| 53 | ··0x0003438c·00000000·00000000·ff9b1101·09320500·.............2.. | ||
| 54 | ··0x0003439c·005105c8·02010100·00000000·ff9b1101·.Q.............. | ||
| 55 | ··0x000343ac·0818051d·002a0500·00010000·00000000·.....*.......... | ||
| 56 | ··0x000343bc·ffff0147·46050000·5805b809·008a0105·...GF...X....... | ||
| 57 | ··0x000343cc·c40900c6·01050000·db0105c0·09008502·................ | ||
| 58 | ··0x000343dc·05e60900·c1020500·00d60205·e2090080·................ | ||
| 59 | ··0x000343ec·0305de09·00bc0305·0000d103·05da0900·................ | ||
| 60 | ··0x000343fc·fb0305bc·0900d509·050000ff·ff010b48·...............H | ||
| 61 | ··0x0003440c·e204af05·00c20505·0000ffff·01535205·.............SR. | ||
| 62 | ··0x0003441c·00006a05·9a1700a1·0205ea15·00be0205·..j............. | ||
| 63 | ··0x0003442c·9e1700b4·03a801f3·1700ee04·05d91600·................ | ||
| 64 | ··0x0003443c·fd0605f3·17009407·05ef1700·a70fa301·................ | ||
| 65 | ··0x0003444c·f31700d3·1005dd16·008d122f·f31700ca·.........../.... | ||
| 66 | ··0x0003445c·1205e615·009514cc·01f31700·d4166a00·..............j. | ||
| 67 | ··0x0003446c·00ffff01·489d0105·0000b501·05c10c00·....H........... | ||
| 68 | ··0x0003447c·b40205cc·0c00c702·05ad0c00·ad0305b1·................ | ||
| 69 | ··0x0003448c·0c00c003·05ec0c00·900572c8·0c009806·..........r..... | ||
| 70 | ··0x0003449c·05a90c00·b80605a7·0b00d306·05a30b00·................ | ||
| 71 | ··0x000344ac·b109a401·9e0c0099·0cd40100·00ffff01·................ | ||
| 72 | ··0x000344bc·3d3e0500·008e0105·d81600de·01d204e9·=>.............. | ||
| 73 | ··0x000344cc·1600c706·05e51600·d2078604·e91600ea·................ | ||
| 74 | ··0x000344dc·0b05f116·00930c8e·01e91600·b30d05ed·................ | ||
| 75 | ··0x000344ec·1600b40e·9f08e916·00cf1705·0000ffff·................ | ||
| 76 | ··0x000344fc·0136c601·8c04c20b·00c80605·c90b00e1·.6.............. | ||
| 77 | ··0x0003450c·065fb00c·00a40805·c90b00e1·0805b00c·._.............. | ||
| 78 | ··0x0003451c·00ff0805·ac0c0093·0a49b00c·00b80b05·.........I...... | ||
| 79 | ··0x0003452c·c20b00a7·0c050000·ffff01cc·01e20105·................ | ||
| 80 | ··0x0003453c·0000e102·87029f21·008c0505·bc1f00a4·.......!........ | ||
| 81 | ··0x0003454c·0505b81f·00d90505·e31e00a1·0605df1e·................ | ||
| 82 | ··0x0003455c·00d90805·9f2100b0·0a058621·00de0a05·.....!.....!.... | ||
| 83 | ··0x0003456c·942100f9·0a05fd20·00b60b05·f92000ce·.!.....·.....·.. | ||
| 84 | ··0x0003457c·0b05f220·008c0c05·c41f00d4·0c05c01f·...·............ | ||
| 85 | ··0x0003458c·00d40e05·9f2100f4·0e05951e·00a50f05·.....!.......... | ||
| 86 | ··0x0003459c·8e1e00cd·0f05921c·00991105·9f2100ce·.............!.. | ||
| 87 | ··0x000345ac·11059d1e·008d1205·991e00bf·12058621·...............! | ||
| 88 | ··0x000345bc·00d91305·d81e0087·1405d41e·00c61405·................ | ||
| 89 | ··0x000345cc·d01e0095·16f802d8·1e00b719·05cc1e00·................ | ||
| 90 | ··0x000345dc·f7190596·1c00a71a·05d81e00·d01a05a6·................ | ||
| 91 | ··0x000345ec·2100e81a·058d2100·911b0598·2100d51b·!.....!.....!... | ||
| 92 | ··0x000345fc·05ff2000·de1d0500·00ffff01·1ef401aa·..·............. | ||
| 93 | ··0x0003460c·0500008f·0805a411·009c0c05·a0110091·................ | ||
| 94 | ··0x0003461c·0ff701a4·11009b11·3a000000·ff9b2d01·........:.....-. | ||
| 95 | ··0x0003462c·20470500·00cf0105·9a0301de·01059603··G.............. | ||
| 96 | ··0x0003463c·0387030a·0000e903·05ee0300·fc030500·................ | ||
| 97 | ··0x0003464c·00010000·7d000000·00000000·ff9b3101·....}.........1. | ||
| 98 | ··0x0003465c·27f30105·00008e02·05c10301·b20305bf·'............... | ||
| 99 | ··0x0003466c·0301e403·05870400·8204058b·04009b04·................ | ||
| 100 | ··0x0003467c·050000ac·04050000·01000000·00000000·................ | ||
| 101 | ··0x0003468c·ffff0139·ba010500·00f80205·990a0096·...9............ | ||
| 102 | ··0x0003469c·0305bb09·00af0305·950a0092·0505bb09·................ | ||
| 103 | ··0x000346ac·00a70505·b70900d1·0805bb09·008d090a·................ | ||
| 104 | ··0x000346bc·0000ad09·05990a00·900a0500·00ffff01·................ | ||
| 105 | ··0x000346cc·25d101f3·01f20900·8f0405ab·0900fe05·%............... | ||
| 106 | ··0x000346dc·20af0900·a90605ee·0900a707·ff01af09··............... | ||
| 107 | ··0x000346ec·00e90905·00000000·ff9b2101·16aa0105·..........!..... | ||
| 108 | ··0x000346fc·f10101cf·01220000·ae0205b3·0200c102·.....".......... | ||
| 53 | ··0x0003 | 109 | ··0x0003470c·05000001·00000000·00000000·ff9b2101·..............!. |
| 54 | ··0x000352ec·09320500·005105d8·02010100·00000000·.2...Q.......... | ||
| 55 | ··0x000352fc·ff9b1101·081a051f·002e0500·00010000·................ | ||
| 56 | ··0x0003530c·00000000·ffff0147·46050000·5805b809·.......GF...X... | ||
| 57 | ··0x0003531c·008a0105·c40900c6·01050000·db0105c0·................ | ||
| 58 | ··0x0003532c·09008502·05e60900·c1020500·00d60205·................ | ||
| 59 | ··0x0003533c·e2090080·0305de09·00bc0305·0000d103·................ | ||
| 60 | ··0x0003534c·05da0900·fb0305bc·0900d509·050000ff·................ | ||
| 61 | ··0x0003535c·ff010b48·e204af05·00c20505·0000ffff·...H............ | ||
| 62 | ··0x0003536c·015e7505·00009101·05941600·be020598·.^u............. | ||
| 63 | ··0x0003537c·1600d002·05e91700·e403a201·f0170098·................ | ||
| 64 | ··0x0003538c·05059d17·00aa0705·f01700c1·0705f417·................ | ||
| 65 | ··0x0003539c·009a0d05·f01700ad·0d059917·00ae0e3b·...............; | ||
| 66 | ··0x000353ac·f01700f8·0e05f817·00fd12d8·02f01700·................ | ||
| 67 | ··0x000353bc·ed150500·008f1605·f01700c3·16560000·.............V.. | ||
| 68 | ··0x000353cc·ffff0159·bd010500·00d40105·b40e00ea·...Y............ | ||
| Max diff block lines reached; 0/39235 bytes (0.00%) of diff not shown. | |||
| Offset 1, 5 lines modified | Offset 1, 5 lines modified | ||
| 1 | Hex·dump·of·section·'.init_array': | 1 | Hex·dump·of·section·'.init_array': |
| 2 | ··0x0003 | 2 | ··0x00036e6c·b0a40000·50a20000·90a20000·d0a20000·....P........... |
| 3 | ··0x0003 | 3 | ··0x00036e7c·10a30000·50a30000···················....P... |
| Offset 1, 4 lines modified | Offset 1, 4 lines modified | ||
| 1 | Hex·dump·of·section·'.fini_array': | 1 | Hex·dump·of·section·'.fini_array': |
| 2 | ··0x0003 | 2 | ··0x00036e84·60a40000····························`... |
| Offset 1, 9 lines modified | Offset 1, 9 lines modified | ||
| 1 | Hex·dump·of·section·'.got': | 1 | Hex·dump·of·section·'.got': |
| 2 | ··0x0003 | 2 | ··0x00036f98·00000000·00000000·00000000·00000000·................ |
| 3 | ··0x0003 | 3 | ··0x00036fa8·609d0000·00000000·00000000·00000000·`............... |
| 4 | ··0x0003 | 4 | ··0x00036fb8·00000000·00000000·00000000·00000000·................ |
| 5 | ··0x0003 | 5 | ··0x00036fc8·00000000·00000000·00000000·00000000·................ |
| 6 | ··0x0003 | 6 | ··0x00036fd8·00000000·00000000·00000000·00000000·................ |
| 7 | ··0x0003 | 7 | ··0x00036fe8·00000000·00000000·00000000··········............ |
| Offset 1, 46 lines modified | Offset 1, 45 lines modified | ||
| 1 | Hex·dump·of·section·'.got.plt': | 1 | Hex·dump·of·section·'.got.plt': |
| 2 | ·NOTE:·This·section·has·relocations·against·it,·but·these·have·NOT·been·applied·to·this·dump. | 2 | ·NOTE:·This·section·has·relocations·against·it,·but·these·have·NOT·been·applied·to·this·dump. |
| 3 | ··0x0003 | 3 | ··0x00036ff4·886e0300·00000000·00000000·36800000·.n..........6... |
| 4 | ··0x0003 | 4 | ··0x00037004·46800000·56800000·66800000·76800000·F...V...f...v... |
| 5 | ··0x0003 | 5 | ··0x00037014·86800000·96800000·a6800000·b6800000·................ |
| 6 | ··0x0003 | 6 | ··0x00037024·c6800000·d6800000·e6800000·f6800000·................ |
| 7 | ··0x0003 | 7 | ··0x00037034·06810000·16810000·26810000·36810000·........&...6... |
| 8 | ··0x0003 | 8 | ··0x00037044·46810000·56810000·66810000·76810000·F...V...f...v... |
| 9 | ··0x0003 | 9 | ··0x00037054·86810000·96810000·a6810000·b6810000·................ |
| 10 | ··0x0003 | 10 | ··0x00037064·c6810000·d6810000·e6810000·f6810000·................ |
| 11 | ··0x0003 | 11 | ··0x00037074·06820000·16820000·26820000·36820000·........&...6... |
| 12 | ··0x0003 | 12 | ··0x00037084·46820000·56820000·66820000·76820000·F...V...f...v... |
| 13 | ··0x0003 | 13 | ··0x00037094·86820000·96820000·a6820000·b6820000·................ |
| 14 | ··0x0003 | 14 | ··0x000370a4·c6820000·d6820000·e6820000·f6820000·................ |
| 15 | ··0x0003 | 15 | ··0x000370b4·06830000·16830000·26830000·36830000·........&...6... |
| 16 | ··0x0003 | 16 | ··0x000370c4·46830000·56830000·66830000·76830000·F...V...f...v... |
| 17 | ··0x0003 | 17 | ··0x000370d4·86830000·96830000·a6830000·b6830000·................ |
| 18 | ··0x0003 | 18 | ··0x000370e4·c6830000·d6830000·e6830000·f6830000·................ |
| 19 | ··0x0003 | 19 | ··0x000370f4·06840000·16840000·26840000·36840000·........&...6... |
| 20 | ··0x0003 | 20 | ··0x00037104·46840000·56840000·66840000·76840000·F...V...f...v... |
| 21 | ··0x0003 | 21 | ··0x00037114·86840000·96840000·a6840000·b6840000·................ |
| 22 | ··0x0003 | 22 | ··0x00037124·c6840000·d6840000·e6840000·f6840000·................ |
| 23 | ··0x0003 | 23 | ··0x00037134·06850000·16850000·26850000·36850000·........&...6... |
| 24 | ··0x0003 | 24 | ··0x00037144·46850000·56850000·66850000·76850000·F...V...f...v... |
| 25 | ··0x0003 | 25 | ··0x00037154·86850000·96850000·a6850000·b6850000·................ |
| 26 | ··0x0003 | 26 | ··0x00037164·c6850000·d6850000·e6850000·f6850000·................ |
| 27 | ··0x0003 | 27 | ··0x00037174·06860000·16860000·26860000·36860000·........&...6... |
| 28 | ··0x0003 | 28 | ··0x00037184·46860000·56860000·66860000·76860000·F...V...f...v... |
| 29 | ··0x0003 | 29 | ··0x00037194·86860000·96860000·a6860000·b6860000·................ |
| 30 | ··0x0003 | 30 | ··0x000371a4·c6860000·d6860000·e6860000·f6860000·................ |
| 31 | ··0x0003 | 31 | ··0x000371b4·06870000·16870000·26870000·36870000·........&...6... |
| 32 | ··0x0003 | 32 | ··0x000371c4·46870000·56870000·66870000·76870000·F...V...f...v... |
| 33 | ··0x0003 | 33 | ··0x000371d4·86870000·96870000·a6870000·b6870000·................ |
| 34 | ··0x0003 | 34 | ··0x000371e4·c6870000·d6870000·e6870000·f6870000·................ |
| 35 | ··0x0003 | 35 | ··0x000371f4·06880000·16880000·26880000·36880000·........&...6... |
| 36 | ··0x0003 | 36 | ··0x00037204·46880000·56880000·66880000·76880000·F...V...f...v... |
| 37 | ··0x0003 | 37 | ··0x00037214·86880000·96880000·a6880000·b6880000·................ |
| 38 | ··0x0003 | 38 | ··0x00037224·c6880000·d6880000·e6880000·f6880000·................ |
| 39 | ··0x0003 | 39 | ··0x00037234·06890000·16890000·26890000·36890000·........&...6... |
| 40 | ··0x0003 | 40 | ··0x00037244·46890000·56890000·66890000·76890000·F...V...f...v... |
| 41 | ··0x0003 | 41 | ··0x00037254·86890000·96890000·a6890000·b6890000·................ |
| 42 | ··0x0003 | 42 | ··0x00037264·c6890000·d6890000·e6890000·f6890000·................ |
| 43 | ··0x00037274·068a0000·168a0000···················........ | ||
| 43 | ··0x00038274·068a0000·168a0000·268a0000·368a0000·........&...6... | ||
| 44 | ··0x00038284·468a0000····························F... | ||
| Offset 1, 4 lines modified | Offset 1, 4 lines modified | ||
| 1 | Hex·dump·of·section·'.data': | 1 | Hex·dump·of·section·'.data': |
| 2 | ··0x0003 | 2 | ··0x0003727c·00000000·80720300·00000000··········.....r...... |
| Offset 1, 8 lines modified | Offset 1, 8 lines modified | ||
| 1 | Hex·dump·of·section·'.gnu_debugaltlink': | 1 | Hex·dump·of·section·'.gnu_debugaltlink': |
| 2 | ··0x00000000·2f757372·2f6c6962·2f646562·75672f2e·/usr/lib/debug/. | 2 | ··0x00000000·2f757372·2f6c6962·2f646562·75672f2e·/usr/lib/debug/. |
| 3 | ··0x00000010·64777a2f·69333836·2d6c696e·75782d67·dwz/i386-linux-g | 3 | ··0x00000010·64777a2f·69333836·2d6c696e·75782d67·dwz/i386-linux-g |
| 4 | ··0x00000020·6e752f74·76632e64·65627567·00 | 4 | ··0x00000020·6e752f74·76632e64·65627567·00baab79·nu/tvc.debug...y |
| 5 | ··0x00000030· | 5 | ··0x00000030·896f6c2f·e012d0a5·f1bd009f·e4175a15·.ol/..........Z. |
| 6 | ··0x00000040· | 6 | ··0x00000040·a6··································. |
| Offset 1, 7 lines modified | Offset 1, 7 lines modified | ||
| 1 | Hex·dump·of·section·'.gnu_debuglink': | 1 | Hex·dump·of·section·'.gnu_debuglink': |
| 2 | ··0x00000000·65656266·61343735·63663961·66386335·eebfa475cf9af8c5 | ||
| 3 | ··0x000000 | 2 | ··0x00000000·38383164·33643064·64643139·64376439·881d3d0ddd19d7d9 |
| 3 | ··0x00000010·62653237·35623530·32353763·63316231·be275b50257cc1b1 | ||
| 4 | ··0x00000020·3 | 4 | ··0x00000020·32623635·63632e64·65627567·00000000·2b65cc.debug.... |
| 5 | ··0x00000030· | 5 | ··0x00000030·19a62904····························..). |
| Offset 4, 17 lines modified | Offset 4, 17 lines modified | ||
| 4 | ··Data:······························2's·complement,·little·endian | 4 | ··Data:······························2's·complement,·little·endian |
| 5 | ··Version:···························1·(current) | 5 | ··Version:···························1·(current) |
| 6 | ··OS/ABI:····························UNIX·-·GNU | 6 | ··OS/ABI:····························UNIX·-·GNU |
| 7 | ··ABI·Version:·······················0 | 7 | ··ABI·Version:·······················0 |
| 8 | ··Type:······························DYN·(Position-Independent·Executable·file) | 8 | ··Type:······························DYN·(Position-Independent·Executable·file) |
| 9 | ··Machine:···························Intel·80386 | 9 | ··Machine:···························Intel·80386 |
| 10 | ··Version:···························0x1 | 10 | ··Version:···························0x1 |
| 11 | ··Entry·point·address:···············0x194 | 11 | ··Entry·point·address:···············0x19430 |
| 12 | ··Start·of·program·headers:··········52·(bytes·into·file) | 12 | ··Start·of·program·headers:··········52·(bytes·into·file) |
| 13 | ··Start·of·section·headers:··········64 | 13 | ··Start·of·section·headers:··········640332·(bytes·into·file) |
| 14 | ··Flags:·····························0x0 | 14 | ··Flags:·····························0x0 |
| 15 | ··Size·of·this·header:···············52·(bytes) | 15 | ··Size·of·this·header:···············52·(bytes) |
| 16 | ··Size·of·program·headers:···········32·(bytes) | 16 | ··Size·of·program·headers:···········32·(bytes) |
| 17 | ··Number·of·program·headers:·········11 | 17 | ··Number·of·program·headers:·········11 |
| 18 | ··Size·of·section·headers:···········40·(bytes) | 18 | ··Size·of·section·headers:···········40·(bytes) |
| 19 | ··Number·of·section·headers:·········31 | 19 | ··Number·of·section·headers:·········31 |
| 20 | ··Section·header·string·table·index:·30 | 20 | ··Section·header·string·table·index:·30 |
| Offset 1, 26 lines modified | Offset 1, 26 lines modified | ||
| 1 | Elf·file·type·is·DYN·(Position-Independent·Executable·file) | 1 | Elf·file·type·is·DYN·(Position-Independent·Executable·file) |
| 2 | Entry·point·0x194 | 2 | Entry·point·0x19430 |
| 3 | There·are·11·program·headers,·starting·at·offset·52 | 3 | There·are·11·program·headers,·starting·at·offset·52 |
| 4 | Program·Headers: | 4 | Program·Headers: |
| 5 | ··Type···········Offset···VirtAddr···PhysAddr···FileSiz·MemSiz··Flg·Align | 5 | ··Type···········Offset···VirtAddr···PhysAddr···FileSiz·MemSiz··Flg·Align |
| 6 | ··PHDR···········0x000034·0x00000034·0x00000034·0x00160·0x00160·R···0x4 | 6 | ··PHDR···········0x000034·0x00000034·0x00000034·0x00160·0x00160·R···0x4 |
| 7 | ··INTERP·········0x000194·0x00000194·0x00000194·0x00013·0x00013·R···0x1 | 7 | ··INTERP·········0x000194·0x00000194·0x00000194·0x00013·0x00013·R···0x1 |
| 8 | ······[Requesting·program·interpreter:·/lib/ld-linux.so.2] | 8 | ······[Requesting·program·interpreter:·/lib/ld-linux.so.2] |
| 9 | ··LOAD···········0x000000·0x00000000·0x00000000·0x12 | 9 | ··LOAD···········0x000000·0x00000000·0x00000000·0x129a4·0x129a4·R···0x1000 |
| 10 | ··LOAD···········0x013000·0x00013000·0x00013000·0x6 | 10 | ··LOAD···········0x013000·0x00013000·0x00013000·0x6b5d8·0x6b5d8·R·E·0x1000 |
| 11 | ··LOAD···········0x0 | 11 | ··LOAD···········0x07f000·0x0007f000·0x0007f000·0x1bcfc·0x1bcfc·R···0x1000 |
| 12 | ··LOAD···········0x09 | 12 | ··LOAD···········0x09bc20·0x0009bc20·0x0009bc20·0x00788·0x007a4·RW··0x1000 |
| 13 | ··DYNAMIC········0x09 | 13 | ··DYNAMIC········0x09be50·0x0009be50·0x0009be50·0x00130·0x00130·RW··0x4 |
| 14 | ··NOTE···········0x0001a8·0x000001a8·0x000001a8·0x00044·0x00044·R···0x4 | 14 | ··NOTE···········0x0001a8·0x000001a8·0x000001a8·0x00044·0x00044·R···0x4 |
| 15 | ··GNU_EH_FRAME···0x08 | 15 | ··GNU_EH_FRAME···0x08406c·0x0008406c·0x0008406c·0x0194c·0x0194c·R···0x4 |
| 16 | ··GNU_STACK······0x000000·0x00000000·0x00000000·0x00000·0x00000·RW··0x10 | 16 | ··GNU_STACK······0x000000·0x00000000·0x00000000·0x00000·0x00000·RW··0x10 |
| 17 | ··GNU_RELRO······0x09 | 17 | ··GNU_RELRO······0x09bc20·0x0009bc20·0x0009bc20·0x003e0·0x003e0·R···0x1 |
| 18 | ·Section·to·Segment·mapping: | 18 | ·Section·to·Segment·mapping: |
| 19 | ··Segment·Sections... | 19 | ··Segment·Sections... |
| 20 | ···00····· | 20 | ···00····· |
| 21 | ···01·····.interp· | 21 | ···01·····.interp· |
| 22 | ···02·····.interp·.note.gnu.build-id·.note.ABI-tag·.gnu.hash·.dynsym·.dynstr·.gnu.version·.gnu.version_r·.rel.dyn·.rel.plt· | 22 | ···02·····.interp·.note.gnu.build-id·.note.ABI-tag·.gnu.hash·.dynsym·.dynstr·.gnu.version·.gnu.version_r·.rel.dyn·.rel.plt· |
| 23 | ···03·····.init·.plt·.plt.got·.text·.fini· | 23 | ···03·····.init·.plt·.plt.got·.text·.fini· |
| Offset 1, 40 lines modified | Offset 1, 40 lines modified | ||
| 1 | There·are·31·section·headers,·starting·at·offset·0x9 | 1 | There·are·31·section·headers,·starting·at·offset·0x9c54c: |
| 2 | Section·Headers: | 2 | Section·Headers: |
| 3 | ··[Nr]·Name··············Type············Addr·····Off····Size···ES·Flg·Lk·Inf·Al | 3 | ··[Nr]·Name··············Type············Addr·····Off····Size···ES·Flg·Lk·Inf·Al |
| 4 | ··[·0]···················NULL············00000000·000000·000000·00······0···0··0 | 4 | ··[·0]···················NULL············00000000·000000·000000·00······0···0··0 |
| 5 | ··[·1]·.interp···········PROGBITS········00000194·000194·000013·00···A··0···0··1 | 5 | ··[·1]·.interp···········PROGBITS········00000194·000194·000013·00···A··0···0··1 |
| 6 | ··[·2]·.note.gnu.build-id·NOTE············000001a8·0001a8·000024·00···A··0···0··4 | 6 | ··[·2]·.note.gnu.build-id·NOTE············000001a8·0001a8·000024·00···A··0···0··4 |
| 7 | ··[·3]·.note.ABI-tag·····NOTE············000001cc·0001cc·000020·00···A··0···0··4 | 7 | ··[·3]·.note.ABI-tag·····NOTE············000001cc·0001cc·000020·00···A··0···0··4 |
| 8 | ··[·4]·.gnu.hash·········GNU_HASH········000001ec·0001ec·001410·04···A··5···0··4 | 8 | ··[·4]·.gnu.hash·········GNU_HASH········000001ec·0001ec·001410·04···A··5···0··4 |
| 9 | ··[·5]·.dynsym···········DYNSYM··········000015fc·0015fc·0035c0·10···A··6···1··4 | 9 | ··[·5]·.dynsym···········DYNSYM··········000015fc·0015fc·0035c0·10···A··6···1··4 |
| 10 | ··[·6]·.dynstr···········STRTAB··········00004bbc·004bbc·00c | 10 | ··[·6]·.dynstr···········STRTAB··········00004bbc·004bbc·00cb48·00···A··0···0··1 |
| 11 | ··[·7]·.gnu.version······VERSYM··········00011 | 11 | ··[·7]·.gnu.version······VERSYM··········00011704·011704·0006b8·02···A··5···0··2 |
| 12 | ··[·8]·.gnu.version_r····VERNEED·········00011 | 12 | ··[·8]·.gnu.version_r····VERNEED·········00011dbc·011dbc·0001b0·00···A··6···4··4 |
| 13 | ··[·9]·.rel.dyn··········REL·············0001 | 13 | ··[·9]·.rel.dyn··········REL·············00011f6c·011f6c·000440·08···A··5···0··4 |
| 14 | ··[10]·.rel.plt··········REL·············00012 | 14 | ··[10]·.rel.plt··········REL·············000123ac·0123ac·0005f8·08··AI··5··25··4 |
| 15 | ··[11]·.init·············PROGBITS········00013000·013000·000020·00··AX··0···0··4 | 15 | ··[11]·.init·············PROGBITS········00013000·013000·000020·00··AX··0···0··4 |
| 16 | ··[12]·.plt··············PROGBITS········00013020·013020·000c00·04··AX··0···0·16 | 16 | ··[12]·.plt··············PROGBITS········00013020·013020·000c00·04··AX··0···0·16 |
| 17 | ··[13]·.plt.got··········PROGBITS········00013c20·013c20·000008·08··AX··0···0··8 | 17 | ··[13]·.plt.got··········PROGBITS········00013c20·013c20·000008·08··AX··0···0··8 |
| 18 | ··[14]·.text·············PROGBITS········00013c30·013c30·06 | 18 | ··[14]·.text·············PROGBITS········00013c30·013c30·06a994·00··AX··0···0·16 |
| 19 | ··[15]·.fini·············PROGBITS········000 | 19 | ··[15]·.fini·············PROGBITS········0007e5c4·07e5c4·000014·00··AX··0···0··4 |
| 20 | ··[16]·.rodata···········PROGBITS········000 | 20 | ··[16]·.rodata···········PROGBITS········0007f000·07f000·00506c·00···A··0···0·32 |
| 21 | ··[17]·.eh_frame_hdr·····PROGBITS········0008 | 21 | ··[17]·.eh_frame_hdr·····PROGBITS········0008406c·08406c·00194c·00···A··0···0··4 |
| 22 | ··[18]·.eh_frame·········PROGBITS········0008 | 22 | ··[18]·.eh_frame·········PROGBITS········000859b8·0859b8·012020·00···A··0···0··4 |
| 23 | ··[19]·.gcc_except_table·PROGBITS········0009 | 23 | ··[19]·.gcc_except_table·PROGBITS········000979d8·0979d8·003324·00···A··0···0··4 |
| 24 | ··[20]·.init_array·······INIT_ARRAY······0009 | 24 | ··[20]·.init_array·······INIT_ARRAY······0009bc20·09bc20·000024·04··WA··0···0··4 |
| 25 | ··[21]·.fini_array·······FINI_ARRAY······0009 | 25 | ··[21]·.fini_array·······FINI_ARRAY······0009bc44·09bc44·000004·04··WA··0···0··4 |
| 26 | ··[22]·.data.rel.ro······PROGBITS········0009 | 26 | ··[22]·.data.rel.ro······PROGBITS········0009bc48·09bc48·000208·00··WA··0···0··4 |
| 27 | ··[23]·.dynamic··········DYNAMIC·········0009 | 27 | ··[23]·.dynamic··········DYNAMIC·········0009be50·09be50·000130·08··WA··6···0··4 |
| 28 | ··[24]·.got··············PROGBITS········0009 | 28 | ··[24]·.got··············PROGBITS········0009bf80·09bf80·000074·04··WA··0···0··4 |
| 29 | ··[25]·.got.plt··········PROGBITS········0009 | 29 | ··[25]·.got.plt··········PROGBITS········0009bff4·09bff4·000308·04··WA··0···0··4 |
| 30 | ··[26]·.data·············PROGBITS········0009 | 30 | ··[26]·.data·············PROGBITS········0009c2fc·09c2fc·0000ac·00··WA··0···0··4 |
| 31 | ··[27]·.bss··············NOBITS··········0009 | 31 | ··[27]·.bss··············NOBITS··········0009c3a8·09c3a8·00001c·00··WA··0···0··8 |
| 32 | ··[28]·.gnu_debugaltlink·PROGBITS········00000000·09 | 32 | ··[28]·.gnu_debugaltlink·PROGBITS········00000000·09c3a8·000041·00······0···0··1 |
| 33 | ··[29]·.gnu_debuglink····PROGBITS········00000000·09 | 33 | ··[29]·.gnu_debuglink····PROGBITS········00000000·09c3ec·000034·00······0···0··4 |
| 34 | ··[30]·.shstrtab·········STRTAB··········00000000·09 | 34 | ··[30]·.shstrtab·········STRTAB··········00000000·09c420·00012c·00······0···0··1 |
| 35 | Key·to·Flags: | 35 | Key·to·Flags: |
| 36 | ··W·(write),·A·(alloc),·X·(execute),·M·(merge),·S·(strings),·I·(info), | 36 | ··W·(write),·A·(alloc),·X·(execute),·M·(merge),·S·(strings),·I·(info), |
| 37 | ··L·(link·order),·O·(extra·OS·processing·required),·G·(group),·T·(TLS), | 37 | ··L·(link·order),·O·(extra·OS·processing·required),·G·(group),·T·(TLS), |
| 38 | ··C·(compressed),·x·(unknown),·o·(OS·specific),·E·(exclude), | 38 | ··C·(compressed),·x·(unknown),·o·(OS·specific),·E·(exclude), |
| 39 | ··R·(retain),·D·(mbind),·p·(processor·specific) | 39 | ··R·(retain),·D·(mbind),·p·(processor·specific) |
| Offset 27, 77 lines modified | Offset 27, 77 lines modified | ||
| 27 | ····23:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZSt7nothrow@GLIBCXX_3.4·(4) | 27 | ····23:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZSt7nothrow@GLIBCXX_3.4·(4) |
| 28 | ····24:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·strstr@GLIBC_2.0·(3) | 28 | ····24:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·strstr@GLIBC_2.0·(3) |
| 29 | ····25:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE7compareEPKc@GLIBCXX_3.4.21·(9) | 29 | ····25:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE7compareEPKc@GLIBCXX_3.4.21·(9) |
| 30 | ····26:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt8ios_baseC2Ev@GLIBCXX_3.4·(4) | 30 | ····26:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt8ios_baseC2Ev@GLIBCXX_3.4·(4) |
| 31 | ····27:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTVNSt7__cxx1119basic_istringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21·(9) | 31 | ····27:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTVNSt7__cxx1119basic_istringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21·(9) |
| 32 | ····28:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt8ios_baseD2Ev@GLIBCXX_3.4·(4) | 32 | ····28:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt8ios_baseD2Ev@GLIBCXX_3.4·(4) |
| 33 | ····29:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·strdup@GLIBC_2.0·(3) | 33 | ····29:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·strdup@GLIBC_2.0·(3) |
| 34 | ····30:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE6substrEjj@GLIBCXX_3.4.21·(9) | ||
| 34 | ····3 | 35 | ····31:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTTNSt7__cxx1118basic_stringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21·(9) |
| 35 | ····3 | 36 | ····32:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt17__throw_bad_allocv@GLIBCXX_3.4·(4) |
| 36 | ····3 | 37 | ····33:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN4Json5ValueixEPKc |
| 37 | ····3 | 38 | ····34:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE10_M_replaceEjjPKcj@GLIBCXX_3.4.21·(9) |
| 38 | ····3 | 39 | ····35:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·fseeko@GLIBC_2.1·(10) |
| 39 | ····3 | 40 | ····36:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__cxa_begin_catch@CXXABI_1.3·(11) |
| 40 | ····3 | 41 | ····37:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE7reserveEj@GLIBCXX_3.4.21·(9) |
| 41 | ····3 | 42 | ····38:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·calloc@GLIBC_2.0·(3) |
| 42 | ····3 | 43 | ····39:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN4Json5ValueC1ENS_9ValueTypeE |
| 43 | ···· | 44 | ····40:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEC1ERKS4_@GLIBCXX_3.4.21·(9) |
| 44 | ····4 | 45 | ····41:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1119basic_istringstreamIcSt11char_traitsIcESaIcEED1Ev@GLIBCXX_3.4.21·(9) |
| 45 | ····4 | 46 | ····42:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·deflate |
| 46 | ····4 | 47 | ····43:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN19CSmithWatermanGotohD1Ev |
| 47 | ····4 | 48 | ····44:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt4endlIcSt11char_traitsIcEERSt13basic_ostreamIT_T0_ES6_@GLIBCXX_3.4·(4) |
| 48 | ····4 | 49 | ····45:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__cxa_allocate_exception@CXXABI_1.3·(11) |
| 49 | ····4 | 50 | ····46:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt14overflow_errorD1Ev@GLIBCXX_3.4·(4) |
| 50 | ····4 | 51 | ····47:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·isspace@GLIBC_2.0·(3) |
| 51 | ····4 | 52 | ····48:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·fputc@GLIBC_2.0·(3) |
| 52 | ····4 | 53 | ····49:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·fgets@GLIBC_2.0·(3) |
| 53 | ···· | 54 | ····50:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN4Json5ValueD1Ev |
| 54 | ····5 | 55 | ····51:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSo9_M_insertIeEERSoT_@GLIBCXX_3.4.9·(12) |
| 55 | ····5 | 56 | ····52:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTISt12domain_error@GLIBCXX_3.4·(4) |
| 56 | ····5 | 57 | ····53:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·fwrite@GLIBC_2.0·(3) |
| 57 | ····5 | 58 | ····54:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE14_M_replace_auxEjjjc@GLIBCXX_3.4.21·(9) |
| 58 | ····5 | 59 | ····55:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·memcpy@GLIBC_2.0·(3) |
| 59 | ····5 | 60 | ····56:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN4Json5ValueC1Ex |
| 60 | ····5 | 61 | ····57:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt20__throw_length_errorPKc@GLIBCXX_3.4·(4) |
| 61 | ····5 | 62 | ····58:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE9_M_assignERKS4_@GLIBCXX_3.4.21·(9) |
| 62 | ····5 | 63 | ····59:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·malloc@GLIBC_2.0·(3) |
| 63 | ···· | 64 | ····60:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·strlen@GLIBC_2.0·(3) |
| 64 | ····6 | 65 | ····61:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTISt14overflow_error@GLIBCXX_3.4·(4) |
| 65 | ····6 | 66 | ····62:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK4Json5Value3getEPKcRKS0_ |
| 66 | ····6 | 67 | ····63:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·munmap@GLIBC_2.0·(3) |
| 67 | ····6 | 68 | ····64:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEC1EOS4_@GLIBCXX_3.4.21·(9) |
| 68 | ····6 | 69 | ····65:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt14overflow_errorC1ERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21·(9) |
| 69 | ····6 | 70 | ····66:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__sprintf_chk@GLIBC_2.3.4·(2) |
| 70 | ····6 | 71 | ····67:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·deflateEnd |
| 71 | ····6 | 72 | ····68:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt28_Rb_tree_rebalance_for_erasePSt18_Rb_tree_node_baseRS_@GLIBCXX_3.4·(4) |
| 72 | ····6 | 73 | ····69:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN4Json5ValueC1Ei |
| 73 | ···· | 74 | ····70:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__snprintf_chk@GLIBC_2.3.4·(2) |
| 74 | ····7 | 75 | ····71:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSirsERi@GLIBCXX_3.4·(4) |
| 75 | ····7 | 76 | ····72:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTVSt15basic_streambufIcSt11char_traitsIcEE@GLIBCXX_3.4·(4) |
| 76 | ····7 | 77 | ····73:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·stdout@GLIBC_2.0·(3) |
| 77 | ····7 | 78 | ····74:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSi10_M_extractIdEERSiRT_@GLIBCXX_3.4.9·(12) |
| 78 | ····7 | 79 | ····75:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSo9_M_insertImEERSoT_@GLIBCXX_3.4.9·(12) |
| 79 | ····7 | 80 | ····76:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSo5flushEv@GLIBCXX_3.4·(4) |
| 80 | ····7 | 81 | ····77:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__cxa_atexit@GLIBC_2.1.3·(6) |
| 81 | ····7 | 82 | ····78:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZdlPvj@CXXABI_1.3.9·(13) |
| 82 | ····7 | 83 | ····79:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt18_Rb_tree_incrementPSt18_Rb_tree_node_base@GLIBCXX_3.4·(4) |
| 83 | ···· | 84 | ····80:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTVN10__cxxabiv117__class_type_infoE@CXXABI_1.3·(11) |
| 84 | ····8 | 85 | ····81:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK4Json5Value8asDoubleEv |
| 85 | ····8 | 86 | ····82:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1118basic_stringstreamIcSt11char_traitsIcESaIcEEC1Ev@GLIBCXX_3.4.26·(14) |
| 86 | ····8 | 87 | ····83:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt19__throw_logic_errorPKc@GLIBCXX_3.4·(4) |
| 87 | ····8 | 88 | ····84:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·crc32 |
| 88 | ····8 | 89 | ····85:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__cxa_free_exception@CXXABI_1.3·(11) |
| 89 | ····8 | 90 | ····86:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12find_last_ofEPKcjj@GLIBCXX_3.4.21·(9) |
| 90 | ····8 | 91 | ····87:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·strcmp@GLIBC_2.0·(3) |
| 91 | ····8 | 92 | ····88:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__libc_start_main@GLIBC_2.34·(15) |
| 92 | ····8 | 93 | ····89:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZN19CSmithWatermanGotoh23EnableEntropyGapPenaltyEf |
| 93 | ···· | 94 | ····90:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTTSt14basic_ofstreamIcSt11char_traitsIcEE@GLIBCXX_3.4·(4) |
| 94 | ····9 | 95 | ····91:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNK4Json5Value14toStyledStringB5cxx11Ev |
| 95 | ····9 | 96 | ····92:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1118basic_stringstreamIcSt11char_traitsIcESaIcEED1Ev@GLIBCXX_3.4.21·(9) |
| 96 | ····92:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE6insertEjPKc@GLIBCXX_3.4.21·(9) | ||
| 97 | ····93:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·toupper@GLIBC_2.0·(3) | 97 | ····93:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·toupper@GLIBC_2.0·(3) |
| 98 | ····94:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·powl@GLIBC_2.0·(7) | 98 | ····94:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·powl@GLIBC_2.0·(7) |
| 99 | ····95:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt28__throw_bad_array_new_lengthv@GLIBCXX_3.4.29·(16) | 99 | ····95:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZSt28__throw_bad_array_new_lengthv@GLIBCXX_3.4.29·(16) |
| 100 | ····96:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_Znaj@GLIBCXX_3.4·(4) | 100 | ····96:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_Znaj@GLIBCXX_3.4·(4) |
| 101 | ····97:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__errno_location@GLIBC_2.0·(3) | 101 | ····97:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·__errno_location@GLIBC_2.0·(3) |
| 102 | ····98:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·inflate | 102 | ····98:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·inflate |
| 103 | ····99:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·fflush@GLIBC_2.0·(3) | 103 | ····99:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·fflush@GLIBC_2.0·(3) |
| Offset 226, 638 lines modified | Offset 226, 638 lines modified | ||
| 226 | ···222:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTISt13runtime_error@GLIBCXX_3.4·(4) | 226 | ···222:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTISt13runtime_error@GLIBCXX_3.4·(4) |
| 227 | ···223:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTVNSt7__cxx1115basic_stringbufIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21·(9) | 227 | ···223:·00000000·····0·OBJECT··GLOBAL·DEFAULT··UND·_ZTVNSt7__cxx1115basic_stringbufIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21·(9) |
| 228 | ···224:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE9_M_mutateEjjPKcj@GLIBCXX_3.4.21·(9) | 228 | ···224:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE9_M_mutateEjjPKcj@GLIBCXX_3.4.21·(9) |
| 229 | ···225:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·realloc@GLIBC_2.0·(3) | 229 | ···225:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·realloc@GLIBC_2.0·(3) |
| 230 | ···226:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·fopen@GLIBC_2.1·(10) | 230 | ···226:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·fopen@GLIBC_2.1·(10) |
| 231 | ···227:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt6localeC1Ev@GLIBCXX_3.4·(4) | 231 | ···227:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt6localeC1Ev@GLIBCXX_3.4·(4) | Diff chunk too large, falling back to line-by-line diff (631 lines added, 631 lines removed) |
| 232 | ···228:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt8ios_base4InitD1Ev@GLIBCXX_3.4·(4) | 232 | ···228:·00000000·····0·FUNC····GLOBAL·DEFAULT··UND·_ZNSt8ios_base4InitD1Ev@GLIBCXX_3.4·(4) |
| 233 | ···229:·0003 | 233 | ···229:·00038e90···469·FUNC····WEAK···DEFAULT···14·_ZNSt5dequeIbSaIbEE17_M_reallocate_mapEjb |
| 234 | ···230:·0009 | 234 | ···230:·0009bd20····24·OBJECT··WEAK···DEFAULT···22·_ZTVN5boost16exception_detail10clone_baseE |
| 235 | ···231:·0007 | 235 | ···231:·00073540···238·FUNC····WEAK···DEFAULT···14·_ZNSt5dequeIN3vcf9RuleTokenESaIS1_EE8pop_backEv |
| 236 | ···232:·0002 | 236 | ···232:·000234d0····36·FUNC····WEAK···DEFAULT···14·_ZNSt5dequeI10LineStatusSaIS0_EE4backEv |
| 237 | ···233:·000 | 237 | ···233:·00044860····79·FUNC····GLOBAL·DEFAULT···14·_Z11build_indexRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE |
| 238 | ···234:·000 | 238 | ···234:·00053c50···361·FUNC····WEAK···DEFAULT···14·_ZNSt6vectorI12markov_stateSaIS0_EE17_M_realloc_insertIJS0_EEEvN9__gnu_cxx17__normal_iteratorIPS0_S2_EEDpOT_ |
| 239 | ···235:·000 | 239 | ···235:·0004fcb0···103·FUNC····WEAK···DEFAULT···14·_ZThn4_N5boost10wrapexceptISt12domain_errorED0Ev |
| 240 | ···236:·0005 | 240 | ···236:·00050e00···250·FUNC····WEAK···DEFAULT···14·_ZN5boost16exception_detail20copy_boost_exceptionEPNS_9exceptionEPKS1_ |
| 241 | ···237:·000 | 241 | ···237:·0004e260··4799·FUNC····GLOBAL·DEFAULT···14·_Z8UnifyVcfiPPKc |
| 242 | ···238:·000 | 242 | ···238:·0007ca20····15·FUNC····GLOBAL·DEFAULT···14·ti_read |
| 243 | ···239:·000 | 243 | ···239:·00016a65···133·FUNC····WEAK···DEFAULT···14·_ZN5boost15throw_exceptionISt12domain_errorEEvRKT_ |
| 244 | ···240:·000 | 244 | ···240:·00039d10···333·FUNC····WEAK···DEFAULT···14·_ZSt25__unguarded_linear_insertISt15_Deque_iteratorI7BedLineRS1_PS1_EN9__gnu_cxx5__ops14_Val_comp_iterIPFbRKS1_S9_EEEEvT_T0_ |
| 245 | ···241:·000 | 245 | ···241:·00052590····48·FUNC····WEAK···DEFAULT···14·_ZNSt12_Vector_baseIlSaIlEED1Ev |
| 246 | ···242:·000 | 246 | ···242:·0005a830···213·FUNC····GLOBAL·DEFAULT···14·_ZN11OptArgumentC1Ev |
| 247 | ···243:·000 | 247 | ···243:·00070700··6233·FUNC····GLOBAL·DEFAULT···14·_ZN3vcf7Variant9removeAltERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE |
| 248 | ···244:·000 | 248 | ···244:·00027060····68·FUNC····WEAK···DEFAULT···14·_ZNSt15_Deque_iteratorI6AlleleRS0_PS0_EmmEv |
| 249 | ···245:·000 | 249 | ···245:·00028590··2054·FUNC····WEAK···DEFAULT···14·_ZSt14__copy_move_a1ILb1EP6AlleleS0_EN9__gnu_cxx11__enable_ifIXsrSt23__is_random_access_iterIT0_NSt15iterator_traitsIS5_E17iterator_categoryEE7__valueESt15_Deque_iteratorIT1_RSB_PSB_EE6__typeES5_S5_SE_ |
| 250 | ···246:·0002 | 250 | ···246:·00025ce0···355·FUNC····WEAK···DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_St3mapIS5_S5_St4lessIS5_ESaIS6_IS7_S5_EEEESt10_Select1stISE_ESA_SaISE_EE24_M_get_insert_unique_posERS7_ |
| 251 | ···247:·000 | 251 | ···247:·00041550··3332·FUNC····WEAK···DEFAULT···14·_ZN7BedFileC1ERKS_ |
| 252 | ···248:·000 | 252 | ···248:·0006cbe0··2216·FUNC····GLOBAL·DEFAULT···14·_ZN3vcf9glReorderEiiRSt3mapIiiSt4lessIiESaISt4pairIKiiEEERSt6vectorIiSaIiEE |
| 253 | ···249:·000 | 253 | ···249:·00039750···296·FUNC····WEAK···DEFAULT···14·_ZNSt5dequeI7BedLineSaIS0_EE16_M_push_back_auxIJS0_EEEvDpOT_ |
| 254 | ···250:·000 | 254 | ···250:·00055a60···982·FUNC····WEAK···DEFAULT···14·_ZN12markov_chainIjE18process_next_valueEj |
| 255 | ···251:·0003 | 255 | ···251:·000380a0···301·FUNC····WEAK···DEFAULT···14·_ZNSt5dequeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS5_EE16_M_push_back_auxIJRKS5_EEEvDpOT_ |
| 256 | ···252:·000 | 256 | ···252:·000621c0···107·FUNC····GLOBAL·DEFAULT···14·_ZN3vcf8isHomRefERSt3mapIiiSt4lessIiESaISt4pairIKiiEEE |
| 257 | ···253:·000 | 257 | ···253:·0005a910···195·FUNC····GLOBAL·DEFAULT···14·_ZN7OptArgs19GetUncheckedOptionsERSt6vectorINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS6_EE |
| 258 | ···254:·000 | 258 | ···254:·00076c50···296·FUNC····WEAK···DEFAULT···14·_ZSt16__do_uninit_copyIN9__gnu_cxx17__normal_iteratorIPNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt6vectorIS7_SaIS7_EEEES8_ET0_T_SE_SD_ |
| 259 | ···255:·000 | 259 | ···255:·0003a550···339·FUNC····WEAK···DEFAULT···14·_ZSt14__copy_move_a1ILb0EPbbEN9__gnu_cxx11__enable_ifIXsrSt23__is_random_access_iterIT0_NSt15iterator_traitsIS4_E17iterator_categoryEE7__valueESt15_Deque_iteratorIT1_RSA_PSA_EE6__typeES4_S4_SD_ |
| 260 | ···256:·000 | 260 | ···256:·00050040···188·FUNC····WEAK···DEFAULT···14·_ZN5boost4math8policies6detail21replace_all_in_stringERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEPKcSB_ |
| 261 | ···257:·000 | 261 | ···257:·00050500···614·FUNC····WEAK···DEFAULT···14·_ZN3vcf7VariantD2Ev |
| 262 | ···258:·000 | 262 | ···258:·0009c310·····4·OBJECT··UNIQUE·DEFAULT···26·_ZZN5boost4math6detail10lgamma_impIeNS0_8policies6policyINS3_13promote_floatILb0EEENS3_14promote_doubleILb0EEENS3_14default_policyES9_S9_S9_S9_S9_S9_S9_S9_S9_S9_EENS0_7lanczos12lanczos17m64EEET_SD_RKT0_RKT1_PiE8funct[·...·truncated·by·diffoscope;·len:·3,·SHA:·d6806158f75334002321a9333b6b02b9b84b51433400afb68bb197bddc2db6a5·...·] |
| 263 | ···259:·000 | 263 | ···259:·00027420··1221·FUNC····WEAK···DEFAULT···14·_ZSt22__merge_without_bufferISt15_Deque_iteratorI6AlleleRS1_PS1_EiN9__gnu_cxx5__ops15_Iter_comp_iterIPFbRKS1_S9_EEEEvT_SD_SD_T0_SE_T1_ |
| 264 | ···260:·000 | 264 | ···260:·00076fb0···338·FUNC····GLOBAL·DEFAULT···14·_Z5splitRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES6_ |
| 265 | ···261:·000 | 265 | ···261:·00024710···355·FUNC····WEAK···DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_iESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE24_M_get_insert_unique_posERS7_ |
| 266 | ···262:·000 | 266 | ···262:·00051360···356·FUNC····WEAK···DEFAULT···14·_ZNK15ReferenceReader7chr_idxEPKc |
| 267 | ···263:·000 | 267 | ···263:·000683e0··3974·FUNC····GLOBAL·DEFAULT···14·_ZN3vcf15VariantCallFile11parseHeaderERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE |
| 268 | ···264:·0002 | 268 | ···264:·00022f10···274·FUNC····WEAK···DEFAULT···14·_ZN6AlleleD1Ev |
| 269 | ···265:·000 | 269 | ···265:·00079590···416·FUNC····GLOBAL·DEFAULT···14·ks_combsort_offt |
| 270 | ···266:·0006 | 270 | ···266:·000763b0···230·FUNC····WEAK···DEFAULT···14·_ZNSt8_Rb_treeISt4pairIiiES0_IKS1_iESt10_Select1stIS3_ESt4lessIS1_ESaIS3_EE24_M_get_insert_unique_posERS2_ |
| 271 | ···267:·0002 | 271 | ···267:·000269b0··1114·FUNC····WEAK···DEFAULT···14·_ZNSt5dequeI6AlleleSaIS0_EED1Ev |
| 272 | ···268:·000 | 272 | ···268:·00062160····12·FUNC····GLOBAL·DEFAULT···14·_ZN3vcf5isHomERSt3mapIiiSt4lessIiESaISt4pairIKiiEEE |
| Max diff block lines reached; -1/168893 bytes (-0.00%) of diff not shown. | |||
| Offset 1, 333 lines modified | Offset 1, 333 lines modified | ||
| 1 | Relocation·section·'.rel.dyn'·at·offset·0x1 | 1 | Relocation·section·'.rel.dyn'·at·offset·0x11f6c·contains·136·entries: |
| 2 | ·Offset·····Info····Type················Sym.·Value··Symbol's·Name | 2 | ·Offset·····Info····Type················Sym.·Value··Symbol's·Name |
| 3 | 0009 | 3 | 0009bc20··00000008·R_386_RELATIVE········ |
| 4 | 0009 | 4 | 0009bc24··00000008·R_386_RELATIVE········ |
| 5 | 0009 | 5 | 0009bc28··00000008·R_386_RELATIVE········ |
| 6 | 0009 | 6 | 0009bc2c··00000008·R_386_RELATIVE········ |
| 7 | 0009 | 7 | 0009bc30··00000008·R_386_RELATIVE········ |
| 8 | 0009 | 8 | 0009bc34··00000008·R_386_RELATIVE········ |
| 9 | 0009 | 9 | 0009bc38··00000008·R_386_RELATIVE········ |
| 10 | 0009 | 10 | 0009bc3c··00000008·R_386_RELATIVE········ |
| 11 | 0009 | 11 | 0009bc40··00000008·R_386_RELATIVE········ |
| 12 | 0009 | 12 | 0009bc44··00000008·R_386_RELATIVE········ |
| 13 | 0009 | 13 | 0009bc4c··00000008·R_386_RELATIVE········ |
| 14 | 0009 | 14 | 0009bc54··00000008·R_386_RELATIVE········ |
| 15 | 0009 | 15 | 0009bc5c··00000008·R_386_RELATIVE········ |
| 16 | 0009 | 16 | 0009bc68··00000008·R_386_RELATIVE········ |
| 17 | 0009 | 17 | 0009bc74··00000008·R_386_RELATIVE········ |
| 18 | 0009 | 18 | 0009bc80··00000008·R_386_RELATIVE········ |
| 19 | 0009 | 19 | 0009bc90··00000008·R_386_RELATIVE········ |
| 20 | 0009 | 20 | 0009bc9c··00000008·R_386_RELATIVE········ |
| 21 | 0009 | 21 | 0009bca8··00000008·R_386_RELATIVE········ |
| 22 | 0009 | 22 | 0009bcb8··00000008·R_386_RELATIVE········ |
| 23 | 0009 | 23 | 0009bcc4··00000008·R_386_RELATIVE········ |
| 24 | 0009 | 24 | 0009bcd0··00000008·R_386_RELATIVE········ |
| 25 | 0009 | 25 | 0009bcd8··00000008·R_386_RELATIVE········ |
| 26 | 0009 | 26 | 0009bce0··00000008·R_386_RELATIVE········ |
| 27 | 0009 | 27 | 0009bcec··00000008·R_386_RELATIVE········ |
| 28 | 0009 | 28 | 0009bcf8··00000008·R_386_RELATIVE········ |
| 29 | 0009 | 29 | 0009bd00··00000008·R_386_RELATIVE········ |
| 30 | 0009 | 30 | 0009bd08··00000008·R_386_RELATIVE········ |
| 31 | 0009 | 31 | 0009bd14··00000008·R_386_RELATIVE········ |
| 32 | 0009 | 32 | 0009bd24··00000008·R_386_RELATIVE········ |
| 33 | 0009 | 33 | 0009bd3c··00000008·R_386_RELATIVE········ |
| 34 | 0009 | 34 | 0009bd40··00000008·R_386_RELATIVE········ |
| 35 | 0009 | 35 | 0009bd44··00000008·R_386_RELATIVE········ |
| 36 | 0009 | 36 | 0009bd50··00000008·R_386_RELATIVE········ |
| 37 | 0009 | 37 | 0009bd54··00000008·R_386_RELATIVE········ |
| 38 | 0009 | 38 | 0009bd58··00000008·R_386_RELATIVE········ |
| 39 | 0009 | 39 | 0009bd64··00000008·R_386_RELATIVE········ |
| 40 | 0009 | 40 | 0009bd68··00000008·R_386_RELATIVE········ |
| 41 | 0009 | 41 | 0009bd6c··00000008·R_386_RELATIVE········ |
| 42 | 0009 | 42 | 0009bd70··00000008·R_386_RELATIVE········ |
| 43 | 0009 | 43 | 0009bd74··00000008·R_386_RELATIVE········ |
| 44 | 0009 | 44 | 0009bd7c··00000008·R_386_RELATIVE········ |
| 45 | 0009 | 45 | 0009bd80··00000008·R_386_RELATIVE········ |
| 46 | 0009 | 46 | 0009bd84··00000008·R_386_RELATIVE········ |
| 47 | 0009 | 47 | 0009bd90··00000008·R_386_RELATIVE········ |
| 48 | 0009 | 48 | 0009bd94··00000008·R_386_RELATIVE········ |
| 49 | 0009 | 49 | 0009bd98··00000008·R_386_RELATIVE········ |
| 50 | 0009 | 50 | 0009bda0··00000008·R_386_RELATIVE········ |
| 51 | 0009 | 51 | 0009bda4··00000008·R_386_RELATIVE········ |
| 52 | 0009 | 52 | 0009bda8··00000008·R_386_RELATIVE········ |
| 53 | 0009 | 53 | 0009bdac··00000008·R_386_RELATIVE········ |
| 54 | 0009 | 54 | 0009bdb0··00000008·R_386_RELATIVE········ |
| 55 | 0009 | 55 | 0009bdb8··00000008·R_386_RELATIVE········ |
| 56 | 0009 | 56 | 0009bdbc··00000008·R_386_RELATIVE········ |
| 57 | 0009 | 57 | 0009bdc0··00000008·R_386_RELATIVE········ |
| 58 | 0009 | 58 | 0009bdcc··00000008·R_386_RELATIVE········ |
| 59 | 0009 | 59 | 0009bdd0··00000008·R_386_RELATIVE········ |
| 60 | 0009 | 60 | 0009bdd4··00000008·R_386_RELATIVE········ |
| 61 | 0009 | 61 | 0009bddc··00000008·R_386_RELATIVE········ |
| 62 | 0009 | 62 | 0009bde0··00000008·R_386_RELATIVE········ |
| 63 | 0009 | 63 | 0009bde4··00000008·R_386_RELATIVE········ |
| 64 | 0009 | 64 | 0009bde8··00000008·R_386_RELATIVE········ |
| 65 | 0009 | 65 | 0009bdec··00000008·R_386_RELATIVE········ |
| 66 | 0009 | 66 | 0009bdf4··00000008·R_386_RELATIVE········ |
| 67 | 0009 | 67 | 0009bdf8··00000008·R_386_RELATIVE········ |
| 68 | 0009 | 68 | 0009bdfc··00000008·R_386_RELATIVE········ |
| 69 | 0009 | 69 | 0009be08··00000008·R_386_RELATIVE········ |
| 70 | 0009 | 70 | 0009be0c··00000008·R_386_RELATIVE········ |
| 71 | 0009 | 71 | 0009be10··00000008·R_386_RELATIVE········ |
| 72 | 0009 | 72 | 0009be18··00000008·R_386_RELATIVE········ |
| 73 | 0009 | 73 | 0009be1c··00000008·R_386_RELATIVE········ |
| 74 | 0009 | 74 | 0009be20··00000008·R_386_RELATIVE········ |
| 75 | 0009 | 75 | 0009be24··00000008·R_386_RELATIVE········ |
| 76 | 0009 | 76 | 0009be28··00000008·R_386_RELATIVE········ |
| 77 | 0009 | 77 | 0009be30··00000008·R_386_RELATIVE········ |
| 78 | 0009 | 78 | 0009be34··00000008·R_386_RELATIVE········ |
| 79 | 0009 | 79 | 0009be38··00000008·R_386_RELATIVE········ |
| 80 | 0009 | 80 | 0009be44··00000008·R_386_RELATIVE········ |
| 81 | 0009 | 81 | 0009be48··00000008·R_386_RELATIVE········ |
| 82 | 0009 | 82 | 0009be4c··00000008·R_386_RELATIVE········ |
| 83 | 0009 | 83 | 0009bf94··00000008·R_386_RELATIVE········ |
| 84 | 0009 | 84 | 0009bfb0··00000008·R_386_RELATIVE········ |
| 85 | 0009 | 85 | 0009c300··00000008·R_386_RELATIVE········ |
| 86 | 0009 | 86 | 0009c308··00000008·R_386_RELATIVE········ |
| 87 | 0009 | 87 | 0009c30c··00000008·R_386_RELATIVE········ |
| 88 | 0009 | 88 | 0009c310··00000008·R_386_RELATIVE········ |
| 89 | 0009 | 89 | 0009bc48··00005001·R_386_32···············00000000···_ZTVN10__cxxabiv117__class_type_infoE@CXXABI_1.3 |
| 90 | 0009 | 90 | 0009bc50··00005001·R_386_32···············00000000···_ZTVN10__cxxabiv117__class_type_infoE@CXXABI_1.3 |
| 91 | 0009 | 91 | 0009bc58··00009801·R_386_32···············00000000···_ZTVN10__cxxabiv120__si_class_type_infoE@CXXABI_1.3 |
| 92 | 0009 | 92 | 0009bc64··00009801·R_386_32···············00000000···_ZTVN10__cxxabiv120__si_class_type_infoE@CXXABI_1.3 |
| 93 | 0009 | 93 | 0009bc60··0000de01·R_386_32···············00000000···_ZTISt13runtime_error@GLIBCXX_3.4 |
| 94 | 0009 | 94 | 0009bc6c··0000de01·R_386_32···············00000000···_ZTISt13runtime_error@GLIBCXX_3.4 |
| 95 | 0009 | 95 | 0009bc70··0000c701·R_386_32···············00000000···_ZTVN10__cxxabiv121__vmi_class_type_infoE@CXXABI_1.3 |
| 96 | 0009 | 96 | 0009bc98··0000c701·R_386_32···············00000000···_ZTVN10__cxxabiv121__vmi_class_type_infoE@CXXABI_1.3 |
| 97 | 0009 | 97 | 0009bcc0··0000c701·R_386_32···············00000000···_ZTVN10__cxxabiv121__vmi_class_type_infoE@CXXABI_1.3 |
| 98 | 0009 | 98 | 0009bce8··0000c701·R_386_32···············00000000···_ZTVN10__cxxabiv121__vmi_class_type_infoE@CXXABI_1.3 |
| 99 | 0009 | 99 | 0009bc88··00003401·R_386_32···············00000000···_ZTISt12domain_error@GLIBCXX_3.4 |
| 100 | 0009 | 100 | 0009bcb0··00003d01·R_386_32···············00000000···_ZTISt14overflow_error@GLIBCXX_3.4 |
| 101 | 0009 | 101 | 0009bd18··0000d501·R_386_32···············00000000···__cxa_pure_virtual@CXXABI_1.3 |
| 102 | 0009 | 102 | 0009bd1c··0000d501·R_386_32···············00000000···__cxa_pure_virtual@CXXABI_1.3 |
| 103 | 0009 | 103 | 0009bd28··0000d501·R_386_32···············00000000···__cxa_pure_virtual@CXXABI_1.3 |
| 104 | 0009 | 104 | 0009bd2c··0000d501·R_386_32···············00000000···__cxa_pure_virtual@CXXABI_1.3 |
| 105 | 0009 | 105 | 0009bd48··00009e01·R_386_32···············00000000···_ZNKSt13runtime_error4whatEv@GLIBCXX_3.4 |
| 106 | 0009 | 106 | 0009bd5c··00009e01·R_386_32···············00000000···_ZNKSt13runtime_error4whatEv@GLIBCXX_3.4 |
| 107 | 0009 | 107 | 0009bdc4··00009e01·R_386_32···············00000000···_ZNKSt13runtime_error4whatEv@GLIBCXX_3.4 |
| 108 | 0009 | 108 | 0009be00··00009e01·R_386_32···············00000000···_ZNKSt13runtime_error4whatEv@GLIBCXX_3.4 |
| 109 | 0009 | 109 | 0009be3c··00009e01·R_386_32···············00000000···_ZNKSt13runtime_error4whatEv@GLIBCXX_3.4 |
| 110 | 0009 | 110 | 0009bd88··0000a601·R_386_32···············00000000···_ZNKSt11logic_error4whatEv@GLIBCXX_3.4 |
| 111 | 0009 | 111 | 0009bf80··00000906·R_386_GLOB_DAT·········00000000···__cxa_finalize@GLIBC_2.1.3 |
| 112 | 0009 | 112 | 0009bf84··00001206·R_386_GLOB_DAT·········00000000···_ZTVSt9basic_iosIcSt11char_traitsIcEE@GLIBCXX_3.4 |
| 113 | 0009 | 113 | 0009bf88··00001706·R_386_GLOB_DAT·········00000000···_ZSt7nothrow@GLIBCXX_3.4 |
| 114 | 0009 | 114 | 0009bf8c··00001b06·R_386_GLOB_DAT·········00000000···_ZTVNSt7__cxx1119basic_istringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21 |
| 115 | 0009 | 115 | 0009bf90··00001f06·R_386_GLOB_DAT·········00000000···_ZTTNSt7__cxx1118basic_stringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21 |
| 116 | 0009 | 116 | 0009bf98··00004806·R_386_GLOB_DAT·········00000000···_ZTVSt15basic_streambufIcSt11char_traitsIcEE@GLIBCXX_3.4 |
| 117 | 0009 | 117 | 0009bf9c··00004906·R_386_GLOB_DAT·········00000000···stdout@GLIBC_2.0 |
| 118 | 0009 | 118 | 0009bfa0··00005a06·R_386_GLOB_DAT·········00000000···_ZTTSt14basic_ofstreamIcSt11char_traitsIcEE@GLIBCXX_3.4 |
| 119 | 0009 | 119 | 0009bfa4··00007006·R_386_GLOB_DAT·········00000000···_ZTTNSt7__cxx1119basic_istringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21 |
| 120 | 0009 | 120 | 0009bfa8··00007406·R_386_GLOB_DAT·········00000000···_ZTVNSt7__cxx1119basic_ostringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21 |
| 121 | 0009 | 121 | 0009bfac··00007606·R_386_GLOB_DAT·········00000000···_ZTVSt14basic_ifstreamIcSt11char_traitsIcEE@GLIBCXX_3.4 |
| 122 | 0009 | 122 | 0009bfb4··00007b06·R_386_GLOB_DAT·········00000000···_ZTVSt14overflow_error@GLIBCXX_3.4 |
| 123 | 0009 | 123 | 0009bfb8··00007d06·R_386_GLOB_DAT·········00000000···_ZTVNSt7__cxx1118basic_stringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21 |
| 124 | 0009 | 124 | 0009bfbc··00008206·R_386_GLOB_DAT·········00000000···_ZTVSt12domain_error@GLIBCXX_3.4 |
| 125 | 0009 | 125 | 0009bfc0··00008606·R_386_GLOB_DAT·········00000000···_ZTTNSt7__cxx1119basic_ostringstreamIcSt11char_traitsIcESaIcEEE@GLIBCXX_3.4.21 |
| 126 | 0009 | 126 | 0009bfc4··00009606·R_386_GLOB_DAT·········00000000···_ZSt4cout@GLIBCXX_3.4 |
| Max diff block lines reached; 36836/54271 bytes (67.87%) of diff not shown. | |||
| Offset 1, 37 lines modified | Offset 1, 37 lines modified | ||
| 1 | Dynamic·section·at·offset·0x9 | 1 | Dynamic·section·at·offset·0x9be50·contains·34·entries: |
| 2 | ··Tag········Type·························Name/Value | 2 | ··Tag········Type·························Name/Value |
| 3 | ·0x00000001·(NEEDED)·····················Shared·library:·[libbamtools.so.2.5.2] | 3 | ·0x00000001·(NEEDED)·····················Shared·library:·[libbamtools.so.2.5.2] |
| 4 | ·0x00000001·(NEEDED)·····················Shared·library:·[libz.so.1] | 4 | ·0x00000001·(NEEDED)·····················Shared·library:·[libz.so.1] |
| 5 | ·0x00000001·(NEEDED)·····················Shared·library:·[libjsoncpp.so.25] | 5 | ·0x00000001·(NEEDED)·····················Shared·library:·[libjsoncpp.so.25] |
| 6 | ·0x00000001·(NEEDED)·····················Shared·library:·[libsmithwaterman.so.0] | 6 | ·0x00000001·(NEEDED)·····················Shared·library:·[libsmithwaterman.so.0] |
| 7 | ·0x00000001·(NEEDED)·····················Shared·library:·[libdisorder.so.0] | 7 | ·0x00000001·(NEEDED)·····················Shared·library:·[libdisorder.so.0] |
| 8 | ·0x00000001·(NEEDED)·····················Shared·library:·[libstdc++.so.6] | 8 | ·0x00000001·(NEEDED)·····················Shared·library:·[libstdc++.so.6] |
| 9 | ·0x00000001·(NEEDED)·····················Shared·library:·[libm.so.6] | 9 | ·0x00000001·(NEEDED)·····················Shared·library:·[libm.so.6] |
| 10 | ·0x00000001·(NEEDED)·····················Shared·library:·[libgcc_s.so.1] | 10 | ·0x00000001·(NEEDED)·····················Shared·library:·[libgcc_s.so.1] |
| 11 | ·0x00000001·(NEEDED)·····················Shared·library:·[libc.so.6] | 11 | ·0x00000001·(NEEDED)·····················Shared·library:·[libc.so.6] |
| 12 | ·0x0000000c·(INIT)·······················0x13000 | 12 | ·0x0000000c·(INIT)·······················0x13000 |
| 13 | ·0x0000000d·(FINI)·······················0x | 13 | ·0x0000000d·(FINI)·······················0x7e5c4 |
| 14 | ·0x00000019·(INIT_ARRAY)·················0x9 | 14 | ·0x00000019·(INIT_ARRAY)·················0x9bc20 |
| 15 | ·0x0000001b·(INIT_ARRAYSZ)···············36·(bytes) | 15 | ·0x0000001b·(INIT_ARRAYSZ)···············36·(bytes) |
| 16 | ·0x0000001a·(FINI_ARRAY)·················0x9 | 16 | ·0x0000001a·(FINI_ARRAY)·················0x9bc44 |
| 17 | ·0x0000001c·(FINI_ARRAYSZ)···············4·(bytes) | 17 | ·0x0000001c·(FINI_ARRAYSZ)···············4·(bytes) |
| 18 | ·0x6ffffef5·(GNU_HASH)···················0x1ec | 18 | ·0x6ffffef5·(GNU_HASH)···················0x1ec |
| 19 | ·0x00000005·(STRTAB)·····················0x4bbc | 19 | ·0x00000005·(STRTAB)·····················0x4bbc |
| 20 | ·0x00000006·(SYMTAB)·····················0x15fc | 20 | ·0x00000006·(SYMTAB)·····················0x15fc |
| 21 | ·0x0000000a·(STRSZ)······················52 | 21 | ·0x0000000a·(STRSZ)······················52040·(bytes) |
| 22 | ·0x0000000b·(SYMENT)·····················16·(bytes) | 22 | ·0x0000000b·(SYMENT)·····················16·(bytes) |
| 23 | ·0x00000015·(DEBUG)······················0x0 | 23 | ·0x00000015·(DEBUG)······················0x0 |
| 24 | ·0x00000003·(PLTGOT)·····················0x9 | 24 | ·0x00000003·(PLTGOT)·····················0x9bff4 |
| 25 | ·0x00000002·(PLTRELSZ)···················1528·(bytes) | 25 | ·0x00000002·(PLTRELSZ)···················1528·(bytes) |
| 26 | ·0x00000014·(PLTREL)·····················REL | 26 | ·0x00000014·(PLTREL)·····················REL |
| 27 | ·0x00000017·(JMPREL)·····················0x12 | 27 | ·0x00000017·(JMPREL)·····················0x123ac |
| 28 | ·0x00000011·(REL)························0x1 | 28 | ·0x00000011·(REL)························0x11f6c |
| 29 | ·0x00000012·(RELSZ)······················1088·(bytes) | 29 | ·0x00000012·(RELSZ)······················1088·(bytes) |
| 30 | ·0x00000013·(RELENT)·····················8·(bytes) | 30 | ·0x00000013·(RELENT)·····················8·(bytes) |
| 31 | ·0x6ffffffb·(FLAGS_1)····················Flags:·PIE | 31 | ·0x6ffffffb·(FLAGS_1)····················Flags:·PIE |
| 32 | ·0x6ffffffe·(VERNEED)····················0x11 | 32 | ·0x6ffffffe·(VERNEED)····················0x11dbc |
| 33 | ·0x6fffffff·(VERNEEDNUM)·················4 | 33 | ·0x6fffffff·(VERNEEDNUM)·················4 |
| 34 | ·0x6ffffff0·(VERSYM)·····················0x11 | 34 | ·0x6ffffff0·(VERSYM)·····················0x11704 |
| 35 | ·0x6ffffffa·(RELCOUNT)···················86 | 35 | ·0x6ffffffa·(RELCOUNT)···················86 |
| 36 | ·0x00000000·(NULL)·······················0x0 | 36 | ·0x00000000·(NULL)·······················0x0 |
| Offset 1, 8 lines modified | Offset 1, 8 lines modified | ||
| 1 | Displaying·notes·found·in:·.note.gnu.build-id | 1 | Displaying·notes·found·in:·.note.gnu.build-id |
| 2 | ··Owner················Data·size·» Description | 2 | ··Owner················Data·size·» Description |
| 3 | ··GNU··················0x00000014» NT_GNU_BUILD_ID·(unique·build·ID·bitstring)» ····Build·ID:· | 3 | ··GNU··················0x00000014» NT_GNU_BUILD_ID·(unique·build·ID·bitstring)» ····Build·ID:·75c35a2e593a19c76059c06af8374cca2dc53b60 |
| 4 | Displaying·notes·found·in:·.note.ABI-tag | 4 | Displaying·notes·found·in:·.note.ABI-tag |
| 5 | ··Owner················Data·size·» Description | 5 | ··Owner················Data·size·» Description |
| 6 | ··GNU··················0x00000010» NT_GNU_ABI_TAG·(ABI·version·tag)» ····OS:·Linux,·ABI:·3.2.0 | 6 | ··GNU··················0x00000010» NT_GNU_ABI_TAG·(ABI·version·tag)» ····OS:·Linux,·ABI:·3.2.0 |
| Offset 1, 33 lines modified | Offset 1, 33 lines modified | ||
| 1 | Version·symbols·section·'.gnu.version'·contains·860·entries: | 1 | Version·symbols·section·'.gnu.version'·contains·860·entries: |
| 2 | ·Addr:·0x0000000000011 | 2 | ·Addr:·0x0000000000011704··Offset:·0x00011704··Link:·5·(.dynsym) |
| 3 | ··000:···0·(*local*)·······2·(GLIBC_2.3.4)···3·(GLIBC_2.0)·····4·(GLIBCXX_3.4) | 3 | ··000:···0·(*local*)·······2·(GLIBC_2.3.4)···3·(GLIBC_2.0)·····4·(GLIBCXX_3.4) |
| 4 | ··004:···1·(*global*)······4·(GLIBCXX_3.4)···3·(GLIBC_2.0)·····5·(GLIBCXX_3.4.15)· | 4 | ··004:···1·(*global*)······4·(GLIBCXX_3.4)···3·(GLIBC_2.0)·····5·(GLIBCXX_3.4.15)· |
| 5 | ··008:···1·(*global*)······6·(GLIBC_2.1.3)···3·(GLIBC_2.0)·····7·(GLIBC_2.0)·· | 5 | ··008:···1·(*global*)······6·(GLIBC_2.1.3)···3·(GLIBC_2.0)·····7·(GLIBC_2.0)·· |
| 6 | ··00c:···7·(GLIBC_2.0)·····8·(GLIBC_2.3)·····9·(GLIBCXX_3.4.21)····4·(GLIBCXX_3.4) | 6 | ··00c:···7·(GLIBC_2.0)·····8·(GLIBC_2.3)·····9·(GLIBCXX_3.4.21)····4·(GLIBCXX_3.4) |
| 7 | ··010:···4·(GLIBCXX_3.4)···5·(GLIBCXX_3.4.15)····4·(GLIBCXX_3.4)···4·(GLIBCXX_3.4) | 7 | ··010:···4·(GLIBCXX_3.4)···5·(GLIBCXX_3.4.15)····4·(GLIBCXX_3.4)···4·(GLIBCXX_3.4) |
| 8 | ··014:···4·(GLIBCXX_3.4)···9·(GLIBCXX_3.4.21)····4·(GLIBCXX_3.4)···4·(GLIBCXX_3.4) | 8 | ··014:···4·(GLIBCXX_3.4)···9·(GLIBCXX_3.4.21)····4·(GLIBCXX_3.4)···4·(GLIBCXX_3.4) |
| 9 | ··018:···3·(GLIBC_2.0)·····9·(GLIBCXX_3.4.21)····4·(GLIBCXX_3.4)···9·(GLIBCXX_3.4.21)· | 9 | ··018:···3·(GLIBC_2.0)·····9·(GLIBCXX_3.4.21)····4·(GLIBCXX_3.4)···9·(GLIBCXX_3.4.21)· |
| 10 | ··01c:···4·(GLIBCXX_3.4)···3·(GLIBC_2.0)·····9·(GLIBCXX_3.4.21)···· | 10 | ··01c:···4·(GLIBCXX_3.4)···3·(GLIBC_2.0)·····9·(GLIBCXX_3.4.21)····9·(GLIBCXX_3.4.21)· |
| 11 | ··020:···1·(*global*)······9·(GLIBCXX_3.4.21)····a·(GLIBC_2.1)·····b·(CXXABI_1.3)· | ||
| 12 | ··024:···9·(GLIBCXX_3.4.21)····3·(GLIBC_2.0)·····1·(*global*)······9·(GLIBCXX_3.4.21)· | ||
| 13 | ··028:···9·(GLIBCXX_3.4.21)····1·(*global*)······1·(*global*)······4·(GLIBCXX_3.4) | ||
| 14 | ··02c:···b·(CXXABI_1.3)····4·(GLIBCXX_3.4)···3·(GLIBC_2.0)·····3·(GLIBC_2.0)·· | ||
| 15 | ··0 | 11 | ··020:···4·(GLIBCXX_3.4)···1·(*global*)······9·(GLIBCXX_3.4.21)····a·(GLIBC_2.1)·· |
| 16 | ··0 | 12 | ··024:···b·(CXXABI_1.3)····9·(GLIBCXX_3.4.21)····3·(GLIBC_2.0)·····1·(*global*)··· |
| 13 | ··028:···9·(GLIBCXX_3.4.21)····9·(GLIBCXX_3.4.21)····1·(*global*)······1·(*global*)··· | ||
| 14 | ··02c:···4·(GLIBCXX_3.4)···b·(CXXABI_1.3)····4·(GLIBCXX_3.4)···3·(GLIBC_2.0)·· | ||
| 15 | ··030:···3·(GLIBC_2.0)·····3·(GLIBC_2.0)·····1·(*global*)······c·(GLIBCXX_3.4.9) | ||
| 16 | ··034:···4·(GLIBCXX_3.4)···3·(GLIBC_2.0)·····9·(GLIBCXX_3.4.21)····3·(GLIBC_2.0)·· | ||
| 17 | ··038:··· | 17 | ··038:···1·(*global*)······4·(GLIBCXX_3.4)···9·(GLIBCXX_3.4.21)····3·(GLIBC_2.0)·· |
| 18 | ··03c:···3·(GLIBC_2.0)·····4·(GLIBCXX_3.4)···1·(*global*)······3·(GLIBC_2.0)·· | ||
| 19 | ··040:···9·(GLIBCXX_3.4.21)····9·(GLIBCXX_3.4.21)····2·(GLIBC_2.3.4)···1·(*global*)··· | ||
| 18 | ··0 | 20 | ··044:···4·(GLIBCXX_3.4)···1·(*global*)······2·(GLIBC_2.3.4)···4·(GLIBCXX_3.4) |
| 19 | ··04 | 21 | ··048:···4·(GLIBCXX_3.4)···3·(GLIBC_2.0)·····c·(GLIBCXX_3.4.9)···c·(GLIBCXX_3.4.9) |
| 22 | ··04c:···4·(GLIBCXX_3.4)···6·(GLIBC_2.1.3)···d·(CXXABI_1.3.9)···4·(GLIBCXX_3.4) | ||
| 23 | ··050:···b·(CXXABI_1.3)····1·(*global*)······e·(GLIBCXX_3.4.26)····4·(GLIBCXX_3.4) | ||
| 20 | ··0 | 24 | ··054:···1·(*global*)······b·(CXXABI_1.3)····9·(GLIBCXX_3.4.21)····3·(GLIBC_2.0)·· |
| 21 | ··048:···3·(GLIBC_2.0)·····c·(GLIBCXX_3.4.9)···c·(GLIBCXX_3.4.9)···4·(GLIBCXX_3.4) | ||
| 22 | ··04c:···6·(GLIBC_2.1.3)···d·(CXXABI_1.3.9)···4·(GLIBCXX_3.4)···b·(CXXABI_1.3)· | ||
| 23 | ··050:···1·(*global*)······e·(GLIBCXX_3.4.26)····4·(GLIBCXX_3.4)···1·(*global*)··· | ||
| 24 | ··054:···b·(CXXABI_1.3)····9·(GLIBCXX_3.4.21)····3·(GLIBC_2.0)·····f·(GLIBC_2.34)· | ||
| 25 | ··058:···1·(*global*)······4·(GLIBCXX_3.4)···1·(*global*) | 25 | ··058:···f·(GLIBC_2.34)····1·(*global*)······4·(GLIBCXX_3.4)···1·(*global*)··· |
| 26 | ··05c:···9·(GLIBCXX_3.4.21)····3·(GLIBC_2.0)·····7·(GLIBC_2.0)····10·(GLIBCXX_3.4.29)· | 26 | ··05c:···9·(GLIBCXX_3.4.21)····3·(GLIBC_2.0)·····7·(GLIBC_2.0)····10·(GLIBCXX_3.4.29)· |
| 27 | ··060:···4·(GLIBCXX_3.4)···3·(GLIBC_2.0)·····1·(*global*)······3·(GLIBC_2.0)·· | 27 | ··060:···4·(GLIBCXX_3.4)···3·(GLIBC_2.0)·····1·(*global*)······3·(GLIBC_2.0)·· |
| 28 | ··064:··11·(GLIBC_2.29)····3·(GLIBC_2.0)····12·(GLIBC_2.1)·····9·(GLIBCXX_3.4.21)· | 28 | ··064:··11·(GLIBC_2.29)····3·(GLIBC_2.0)····12·(GLIBC_2.1)·····9·(GLIBCXX_3.4.21)· |
| 29 | ··068:···4·(GLIBCXX_3.4)···1·(*global*)······4·(GLIBCXX_3.4)··13·(GLIBC_2.33)· | 29 | ··068:···4·(GLIBCXX_3.4)···1·(*global*)······4·(GLIBCXX_3.4)··13·(GLIBC_2.33)· |
| 30 | ··06c:···3·(GLIBC_2.0)·····1·(*global*)······3·(GLIBC_2.0)·····3·(GLIBC_2.0)·· | 30 | ··06c:···3·(GLIBC_2.0)·····1·(*global*)······3·(GLIBC_2.0)·····3·(GLIBC_2.0)·· |
| 31 | ··070:···9·(GLIBCXX_3.4.21)····c·(GLIBCXX_3.4.9)···9·(GLIBCXX_3.4.21)····a·(GLIBC_2.1)·· | 31 | ··070:···9·(GLIBCXX_3.4.21)····c·(GLIBCXX_3.4.9)···9·(GLIBCXX_3.4.21)····a·(GLIBC_2.1)·· |
| 32 | ··074:···9·(GLIBCXX_3.4.21)···14·(GLIBC_2.7)·····4·(GLIBCXX_3.4)···9·(GLIBCXX_3.4.21)· | 32 | ··074:···9·(GLIBCXX_3.4.21)···14·(GLIBC_2.7)·····4·(GLIBCXX_3.4)···9·(GLIBCXX_3.4.21)· |
| Offset 214, 15 lines modified | Offset 214, 15 lines modified | ||
| 214 | ··348:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 214 | ··348:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 215 | ··34c:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 215 | ··34c:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 216 | ··350:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 216 | ··350:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 217 | ··354:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 217 | ··354:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 218 | ··358:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· | 218 | ··358:···1·(*global*)······1·(*global*)······1·(*global*)······1·(*global*)··· |
| 219 | Version·needs·section·'.gnu.version_r'·contains·4·entries: | 219 | Version·needs·section·'.gnu.version_r'·contains·4·entries: |
| 220 | ·Addr:·0x0000000000011 | 220 | ·Addr:·0x0000000000011dbc··Offset:·0x00011dbc··Link:·6·(.dynstr) |
| 221 | ··000000:·Version:·1··File:·libgcc_s.so.1··Cnt:·1 | 221 | ··000000:·Version:·1··File:·libgcc_s.so.1··Cnt:·1 |
| 222 | ··0x0010:···Name:·GCC_3.0··Flags:·none··Version:·24 | 222 | ··0x0010:···Name:·GCC_3.0··Flags:·none··Version:·24 |
| 223 | ··0x0020:·Version:·1··File:·libm.so.6··Cnt:·3 | 223 | ··0x0020:·Version:·1··File:·libm.so.6··Cnt:·3 |
| 224 | ··0x0030:···Name:·GLIBC_2.1··Flags:·none··Version:·18 | 224 | ··0x0030:···Name:·GLIBC_2.1··Flags:·none··Version:·18 |
| 225 | ··0x0040:···Name:·GLIBC_2.29··Flags:·none··Version:·17 | 225 | ··0x0040:···Name:·GLIBC_2.29··Flags:·none··Version:·17 |
| 226 | ··0x0050:···Name:·GLIBC_2.0··Flags:·none··Version:·7 | 226 | ··0x0050:···Name:·GLIBC_2.0··Flags:·none··Version:·7 |
| 227 | ··0x0060:·Version:·1··File:·libstdc++.so.6··Cnt:·10 | 227 | ··0x0060:·Version:·1··File:·libstdc++.so.6··Cnt:·10 |
| Offset 8, 15 lines modified | Offset 8, 15 lines modified | ||
| 8 | ··Data·alignment·factor:·-4 | 8 | ··Data·alignment·factor:·-4 |
| 9 | ··Return·address·column:·8 | 9 | ··Return·address·column:·8 |
| 10 | ··Augmentation·data:·····1b | 10 | ··Augmentation·data:·····1b |
| 11 | ··DW_CFA_def_cfa:·r4·(esp)·ofs·4 | 11 | ··DW_CFA_def_cfa:·r4·(esp)·ofs·4 |
| 12 | ··DW_CFA_offset:·r8·(eip)·at·cfa-4 | 12 | ··DW_CFA_offset:·r8·(eip)·at·cfa-4 |
| 13 | ··DW_CFA_undefined:·r8·(eip) | 13 | ··DW_CFA_undefined:·r8·(eip) |
| 14 | 00000018·00000010·0000001c·FDE·cie=00000000·pc=000194 | 14 | 00000018·00000010·0000001c·FDE·cie=00000000·pc=00019430..0001945c |
| 15 | ··DW_CFA_nop | 15 | ··DW_CFA_nop |
| 16 | ··DW_CFA_nop | 16 | ··DW_CFA_nop |
| 17 | ··DW_CFA_nop | 17 | ··DW_CFA_nop |
| 18 | 0000002c·00000014·00000000·CIE | 18 | 0000002c·00000014·00000000·CIE |
| 19 | ··Version:···············1 | 19 | ··Version:···············1 |
| 20 | ··Augmentation:··········"zR" | 20 | ··Augmentation:··········"zR" |
| Offset 43, 1298 lines modified | Offset 43, 1277 lines modified | ||
| 43 | 0000007c·0000001c·00000000·CIE | 43 | 0000007c·0000001c·00000000·CIE |
| 44 | ··Version:···············1 | 44 | ··Version:···············1 |
| 45 | ··Augmentation:··········"zPLR" | 45 | ··Augmentation:··········"zPLR" |
| 46 | ··Code·alignment·factor:·1 | 46 | ··Code·alignment·factor:·1 |
| 47 | ··Data·alignment·factor:·-4 | 47 | ··Data·alignment·factor:·-4 |
| 48 | ··Return·address·column:·8 | 48 | ··Return·address·column:·8 |
| 49 | ··Augmentation·data:·····9b· | 49 | ··Augmentation·data:·····9b·bd·68·01·00·1b·1b |
| 50 | ··DW_CFA_def_cfa:·r4·(esp)·ofs·4 | 50 | ··DW_CFA_def_cfa:·r4·(esp)·ofs·4 |
| 51 | ··DW_CFA_offset:·r8·(eip)·at·cfa-4 | 51 | ··DW_CFA_offset:·r8·(eip)·at·cfa-4 |
| 52 | ··DW_CFA_nop | 52 | ··DW_CFA_nop |
| 53 | ··DW_CFA_nop | 53 | ··DW_CFA_nop |
| 54 | 0000009c·00000038·00000024·FDE·cie=0000007c·pc=000195 | 54 | 0000009c·00000038·00000024·FDE·cie=0000007c·pc=00019560..000196c5 |
| 55 | ··Augmentation·data:····· | 55 | ··Augmentation·data:·····73·1f·01·00 |
| 56 | ··DW_CFA_advance_loc:·1·to·000195 | 56 | ··DW_CFA_advance_loc:·1·to·00019561 |
| 57 | ··DW_CFA_def_cfa_offset:·8 | 57 | ··DW_CFA_def_cfa_offset:·8 |
| 58 | ··DW_CFA_offset:·r5·(ebp)·at·cfa-8 | 58 | ··DW_CFA_offset:·r5·(ebp)·at·cfa-8 |
| 59 | ··DW_CFA_advance_loc:·2·to·000195 | 59 | ··DW_CFA_advance_loc:·2·to·00019563 |
| 60 | ··DW_CFA_def_cfa_register:·r5·(ebp) | 60 | ··DW_CFA_def_cfa_register:·r5·(ebp) |
| 61 | ··DW_CFA_advance_loc:·2·to·000195 | 61 | ··DW_CFA_advance_loc:·2·to·00019565 |
| 62 | ··DW_CFA_offset:·r7·(edi)·at·cfa-12 | 62 | ··DW_CFA_offset:·r7·(edi)·at·cfa-12 |
| 63 | ··DW_CFA_offset:·r6·(esi)·at·cfa-16 | 63 | ··DW_CFA_offset:·r6·(esi)·at·cfa-16 |
| 64 | ··DW_CFA_advance_loc:·15·to·000195 | 64 | ··DW_CFA_advance_loc:·15·to·00019574 |
| 65 | ··DW_CFA_offset:·r3·(ebx)·at·cfa-20 | 65 | ··DW_CFA_offset:·r3·(ebx)·at·cfa-20 |
| 66 | ··DW_CFA_advance_loc:·47·to·000195 | 66 | ··DW_CFA_advance_loc:·47·to·000195a3 |
| 67 | ··DW_CFA_GNU_args_size:·16 | 67 | ··DW_CFA_GNU_args_size:·16 |
| 68 | ··DW_CFA_advance_loc:·36·to·000195 | 68 | ··DW_CFA_advance_loc:·36·to·000195c7 |
| 69 | ··DW_CFA_GNU_args_size:·32 | 69 | ··DW_CFA_GNU_args_size:·32 |
| 70 | ··DW_CFA_advance_loc1:·224·to·000196 | 70 | ··DW_CFA_advance_loc1:·224·to·000196a7 |
| 71 | ··DW_CFA_remember_state | 71 | ··DW_CFA_remember_state |
| 72 | ··DW_CFA_restore:·r3·(ebx) | 72 | ··DW_CFA_restore:·r3·(ebx) |
| 73 | ··DW_CFA_advance_loc:·1·to·000196 | 73 | ··DW_CFA_advance_loc:·1·to·000196a8 |
| 74 | ··DW_CFA_restore:·r6·(esi) | 74 | ··DW_CFA_restore:·r6·(esi) |
| 75 | ··DW_CFA_advance_loc:·1·to·000196 | 75 | ··DW_CFA_advance_loc:·1·to·000196a9 |
| 76 | ··DW_CFA_restore:·r7·(edi) | 76 | ··DW_CFA_restore:·r7·(edi) |
| 77 | ··DW_CFA_advance_loc:·1·to·000196 | 77 | ··DW_CFA_advance_loc:·1·to·000196aa |
| 78 | ··DW_CFA_restore:·r5·(ebp) | 78 | ··DW_CFA_restore:·r5·(ebp) |
| 79 | ··DW_CFA_def_cfa:·r4·(esp)·ofs·4 | 79 | ··DW_CFA_def_cfa:·r4·(esp)·ofs·4 |
| 80 | ··DW_CFA_advance_loc:·1·to·000196 | 80 | ··DW_CFA_advance_loc:·1·to·000196ab |
| 81 | ··DW_CFA_restore_state | 81 | ··DW_CFA_restore_state |
| 82 | ··DW_CFA_nop | 82 | ··DW_CFA_nop |
| 83 | ··DW_CFA_nop | 83 | ··DW_CFA_nop |
| 84 | 000000d8·0000001c·00000060·FDE·cie=0000007c·pc=00013c30..00013c65 | 84 | 000000d8·0000001c·00000060·FDE·cie=0000007c·pc=00013c30..00013c65 |
| 85 | ··Augmentation·data:····· | 85 | ··Augmentation·data:·····53·1f·01·00 |
| 86 | ··DW_CFA_def_cfa:·r5·(ebp)·ofs·8 | 86 | ··DW_CFA_def_cfa:·r5·(ebp)·ofs·8 |
| 87 | ··DW_CFA_offset:·r3·(ebx)·at·cfa-20 | 87 | ··DW_CFA_offset:·r3·(ebx)·at·cfa-20 |
| 88 | ··DW_CFA_offset:·r5·(ebp)·at·cfa-8 | 88 | ··DW_CFA_offset:·r5·(ebp)·at·cfa-8 |
| 89 | ··DW_CFA_offset:·r6·(esi)·at·cfa-16 | 89 | ··DW_CFA_offset:·r6·(esi)·at·cfa-16 |
| 90 | ··DW_CFA_offset:·r7·(edi)·at·cfa-12 | 90 | ··DW_CFA_offset:·r7·(edi)·at·cfa-12 |
| 91 | 000000f8·0000004c·00000080·FDE·cie=0000007c·pc=00018f | 91 | 000000f8·0000004c·00000080·FDE·cie=0000007c·pc=00018f70..00019157 |
| 92 | ··Augmentation·data:····· | 92 | ··Augmentation·data:·····3b·1f·01·00 |
| 93 | ··DW_CFA_advance_loc:·4·to·00018f | 93 | ··DW_CFA_advance_loc:·4·to·00018f74 |
| 94 | ··DW_CFA_def_cfa:·r1·(ecx)·ofs·0 | 94 | ··DW_CFA_def_cfa:·r1·(ecx)·ofs·0 |
| 95 | ··DW_CFA_advance_loc:·9·to·00018f | 95 | ··DW_CFA_advance_loc:·9·to·00018f7d |
| 96 | ··DW_CFA_expression:·r5·(ebp)·(DW_OP_breg5·(ebp):·0) | 96 | ··DW_CFA_expression:·r5·(ebp)·(DW_OP_breg5·(ebp):·0) |
| 97 | ··DW_CFA_advance_loc:·2·to·00018f | 97 | ··DW_CFA_advance_loc:·2·to·00018f7f |
| 98 | ··DW_CFA_expression:·r7·(edi)·(DW_OP_breg5·(ebp):·-4) | 98 | ··DW_CFA_expression:·r7·(edi)·(DW_OP_breg5·(ebp):·-4) |
| 99 | ··DW_CFA_expression:·r6·(esi)·(DW_OP_breg5·(ebp):·-8) | 99 | ··DW_CFA_expression:·r6·(esi)·(DW_OP_breg5·(ebp):·-8) |
| 100 | ··DW_CFA_advance_loc:·13·to·00018f | 100 | ··DW_CFA_advance_loc:·13·to·00018f8c |
| 101 | ··DW_CFA_def_cfa_expression·(DW_OP_breg5·(ebp):·-16;·DW_OP_deref) | 101 | ··DW_CFA_def_cfa_expression·(DW_OP_breg5·(ebp):·-16;·DW_OP_deref) |
| 102 | ··DW_CFA_expression:·r3·(ebx)·(DW_OP_breg5·(ebp):·-12) | 102 | ··DW_CFA_expression:·r3·(ebx)·(DW_OP_breg5·(ebp):·-12) |
| 103 | ··DW_CFA_advance_loc1:·159·to·000190 | 103 | ··DW_CFA_advance_loc1:·159·to·0001902b |
| 104 | ··DW_CFA_GNU_args_size:·16 | 104 | ··DW_CFA_GNU_args_size:·16 |
| 105 | ··DW_CFA_advance_loc:·48·to·000190 | 105 | ··DW_CFA_advance_loc:·48·to·0001905b |
| 106 | ··DW_CFA_remember_state | 106 | ··DW_CFA_remember_state |
| 107 | ··DW_CFA_restore:·r1·(ecx) | 107 | ··DW_CFA_restore:·r1·(ecx) |
| 108 | ··DW_CFA_def_cfa:·r1·(ecx)·ofs·0 | 108 | ··DW_CFA_def_cfa:·r1·(ecx)·ofs·0 |
| 109 | ··DW_CFA_advance_loc:·1·to·000190 | 109 | ··DW_CFA_advance_loc:·1·to·0001905c |
| 110 | ··DW_CFA_restore:·r3·(ebx) | 110 | ··DW_CFA_restore:·r3·(ebx) |
| 111 | ··DW_CFA_advance_loc:·1·to·000190 | 111 | ··DW_CFA_advance_loc:·1·to·0001905d |
| 112 | ··DW_CFA_restore:·r6·(esi) | 112 | ··DW_CFA_restore:·r6·(esi) |
| 113 | ··DW_CFA_advance_loc:·1·to·000190 | 113 | ··DW_CFA_advance_loc:·1·to·0001905e |
| 114 | ··DW_CFA_restore:·r7·(edi) | 114 | ··DW_CFA_restore:·r7·(edi) |
| 115 | ··DW_CFA_advance_loc:·1·to·000190 | 115 | ··DW_CFA_advance_loc:·1·to·0001905f |
| 116 | ··DW_CFA_restore:·r5·(ebp) | 116 | ··DW_CFA_restore:·r5·(ebp) |
| 117 | ··DW_CFA_advance_loc:·3·to·000190 | 117 | ··DW_CFA_advance_loc:·3·to·00019062 |
| 118 | ··DW_CFA_def_cfa:·r4·(esp)·ofs·4 | 118 | ··DW_CFA_def_cfa:·r4·(esp)·ofs·4 |
| 119 | ··DW_CFA_advance_loc:·1·to·000190 | 119 | ··DW_CFA_advance_loc:·1·to·00019063 |
| 120 | ··DW_CFA_restore_state | 120 | ··DW_CFA_restore_state |
| 121 | ··DW_CFA_nop | 121 | ··DW_CFA_nop |
| 122 | ··DW_CFA_nop | 122 | ··DW_CFA_nop |
| 123 | ··DW_CFA_nop | 123 | ··DW_CFA_nop |
| 124 | 00000148·0000002c·000000d0·FDE·cie=0000007c·pc=00013c65..00013c7e | 124 | 00000148·0000002c·000000d0·FDE·cie=0000007c·pc=00013c65..00013c7e |
| 125 | ··Augmentation·data:····· | 125 | ··Augmentation·data:·····10·1f·01·00 |
| 126 | ··DW_CFA_def_cfa_expression·(DW_OP_breg5·(ebp):·-16;·DW_OP_deref) | 126 | ··DW_CFA_def_cfa_expression·(DW_OP_breg5·(ebp):·-16;·DW_OP_deref) |
| 127 | ··DW_CFA_expression:·r3·(ebx)·(DW_OP_breg5·(ebp):·-12) | 127 | ··DW_CFA_expression:·r3·(ebx)·(DW_OP_breg5·(ebp):·-12) |
| 128 | ··DW_CFA_expression:·r5·(ebp)·(DW_OP_breg5·(ebp):·0) | 128 | ··DW_CFA_expression:·r5·(ebp)·(DW_OP_breg5·(ebp):·0) |
| 129 | ··DW_CFA_expression:·r6·(esi)·(DW_OP_breg5·(ebp):·-8) | 129 | ··DW_CFA_expression:·r6·(esi)·(DW_OP_breg5·(ebp):·-8) |
| 130 | ··DW_CFA_expression:·r7·(edi)·(DW_OP_breg5·(ebp):·-4) | 130 | ··DW_CFA_expression:·r7·(edi)·(DW_OP_breg5·(ebp):·-4) |
| 131 | ··DW_CFA_nop | 131 | ··DW_CFA_nop |
| 132 | ··DW_CFA_nop | 132 | ··DW_CFA_nop |
| 133 | 00000178·00000034·00000150·FDE·cie=0000002c·pc=000191 | 133 | 00000178·00000034·00000150·FDE·cie=0000002c·pc=00019160..00019198 |
| 134 | ··DW_CFA_advance_loc:·1·to·000191 | 134 | ··DW_CFA_advance_loc:·1·to·00019161 |
| 135 | ··DW_CFA_def_cfa_offset:·8 | 135 | ··DW_CFA_def_cfa_offset:·8 |
| 136 | ··DW_CFA_offset:·r6·(esi)·at·cfa-8 | 136 | ··DW_CFA_offset:·r6·(esi)·at·cfa-8 |
| 137 | ··DW_CFA_advance_loc:·1·to·000191 | 137 | ··DW_CFA_advance_loc:·1·to·00019162 |
| 138 | ··DW_CFA_def_cfa_offset:·12 | 138 | ··DW_CFA_def_cfa_offset:·12 |
| 139 | ··DW_CFA_offset:·r3·(ebx)·at·cfa-12 | 139 | ··DW_CFA_offset:·r3·(ebx)·at·cfa-12 |
| 140 | ··DW_CFA_advance_loc:·14·to·000191 | 140 | ··DW_CFA_advance_loc:·14·to·00019170 |
| 141 | ··DW_CFA_def_cfa_offset:·28 | 141 | ··DW_CFA_def_cfa_offset:·28 |
| 142 | ··DW_CFA_advance_loc:·7·to·000191 | 142 | ··DW_CFA_advance_loc:·7·to·00019177 |
| 143 | ··DW_CFA_def_cfa_offset:·32 | 143 | ··DW_CFA_def_cfa_offset:·32 |
| 144 | ··DW_CFA_advance_loc:·8·to·000191 | 144 | ··DW_CFA_advance_loc:·8·to·0001917f |
| 145 | ··DW_CFA_def_cfa_offset:·20 | 145 | ··DW_CFA_def_cfa_offset:·20 |
| 146 | ··DW_CFA_advance_loc:·7·to·000191 | 146 | ··DW_CFA_advance_loc:·7·to·00019186 |
| 147 | ··DW_CFA_def_cfa_offset:·24 | 147 | ··DW_CFA_def_cfa_offset:·24 |
| Max diff block lines reached; 2003773/2009648 bytes (99.71%) of diff not shown. | |||
| Offset 75, 14 lines modified | Offset 75, 15 lines modified | ||
| 75 | _ZNSt14basic_ifstreamIcSt11char_traitsIcEED1Ev | 75 | _ZNSt14basic_ifstreamIcSt11char_traitsIcEED1Ev |
| 76 | _ZNSt12__basic_fileIcED1Ev | 76 | _ZNSt12__basic_fileIcED1Ev |
| 77 | _ZTVSt14basic_ifstreamIcSt11char_traitsIcEE | 77 | _ZTVSt14basic_ifstreamIcSt11char_traitsIcEE |
| 78 | _ZTVSt14basic_ofstreamIcSt11char_traitsIcEE | 78 | _ZTVSt14basic_ofstreamIcSt11char_traitsIcEE |
| 79 | _ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE13find_first_ofEPKcjj | 79 | _ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE13find_first_ofEPKcjj |
| 80 | _ZNSt8ios_baseD2Ev | 80 | _ZNSt8ios_baseD2Ev |
| 81 | _ZTTNSt7__cxx1118basic_stringstreamIcSt11char_traitsIcESaIcEEE | 81 | _ZTTNSt7__cxx1118basic_stringstreamIcSt11char_traitsIcESaIcEEE |
| 82 | _ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE6substrEjj | ||
| 82 | _ZTVNSt7__cxx1119basic_ostringstreamIcSt11char_traitsIcESaIcEEE | 83 | _ZTVNSt7__cxx1119basic_ostringstreamIcSt11char_traitsIcESaIcEEE |
| 83 | _ZNSt12domain_errorD1Ev | 84 | _ZNSt12domain_errorD1Ev |
| 84 | _ZTVSt12domain_error | 85 | _ZTVSt12domain_error |
| 85 | _ZNKSt7__cxx1115basic_stringbufIcSt11char_traitsIcESaIcEE3strEv | 86 | _ZNKSt7__cxx1115basic_stringbufIcSt11char_traitsIcESaIcEE3strEv |
| 86 | _ZSt18_Rb_tree_incrementPSt18_Rb_tree_node_base | 87 | _ZSt18_Rb_tree_incrementPSt18_Rb_tree_node_base |
| 87 | _ZSt28_Rb_tree_rebalance_for_erasePSt18_Rb_tree_node_baseRS_ | 88 | _ZSt28_Rb_tree_rebalance_for_erasePSt18_Rb_tree_node_baseRS_ |
| 88 | __cxa_begin_catch | 89 | __cxa_begin_catch |
| Offset 116, 15 lines modified | Offset 117, 14 lines modified | ||
| 116 | _ZNSt14overflow_errorC1ERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE | 117 | _ZNSt14overflow_errorC1ERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE |
| 117 | _ZTTSt14basic_ifstreamIcSt11char_traitsIcEE | 118 | _ZTTSt14basic_ifstreamIcSt11char_traitsIcEE |
| 118 | _ZNSt13runtime_errorD2Ev | 119 | _ZNSt13runtime_errorD2Ev |
| 119 | _ZTTSt14basic_ofstreamIcSt11char_traitsIcEE | 120 | _ZTTSt14basic_ofstreamIcSt11char_traitsIcEE |
| 120 | _ZNSt14overflow_errorD2Ev | 121 | _ZNSt14overflow_errorD2Ev |
| 121 | _ZSt24__throw_out_of_range_fmtPKcz | 122 | _ZSt24__throw_out_of_range_fmtPKcz |
| 122 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE9push_backEc | 123 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE9push_backEc |
| 123 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE6insertEjPKc | ||
| 124 | _ZnwjRKSt9nothrow_t | 124 | _ZnwjRKSt9nothrow_t |
| 125 | _ZSt4cerr | 125 | _ZSt4cerr |
| 126 | _ZNSt13basic_filebufIcSt11char_traitsIcEEC1Ev | 126 | _ZNSt13basic_filebufIcSt11char_traitsIcEEC1Ev |
| 127 | _ZNSt11logic_errorC2ERKS_ | 127 | _ZNSt11logic_errorC2ERKS_ |
| 128 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE14_M_replace_auxEjjjc | 128 | _ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE14_M_replace_auxEjjjc |
| 129 | __gxx_personality_v0 | 129 | __gxx_personality_v0 |
| 130 | _ZNSo3putEc | 130 | _ZNSo3putEc |
| Offset 203, 15 lines modified | Offset 203, 14 lines modified | ||
| 203 | _ZSt4moveISt15_Deque_iteratorI6AlleleRS1_PS1_ES3_ET0_T_S6_S5_ | 203 | _ZSt4moveISt15_Deque_iteratorI6AlleleRS1_PS1_ES3_ET0_T_S6_S5_ |
| 204 | _ZN5boost4math14rounding_errorD1Ev | 204 | _ZN5boost4math14rounding_errorD1Ev |
| 205 | _ZTIN5boost16exception_detail10clone_baseE | 205 | _ZTIN5boost16exception_detail10clone_baseE |
| 206 | _ZN7OptArgs20StringToDoubleVectorERSt6vectorIdSaIdEERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESB_c | 206 | _ZN7OptArgs20StringToDoubleVectorERSt6vectorIdSaIdEERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESB_c |
| 207 | _ZNSt5dequeIN3vcf9RuleTokenESaIS1_EE4backEv | 207 | _ZNSt5dequeIN3vcf9RuleTokenESaIS1_EE4backEv |
| 208 | _ZN3vcf13VariantFilterC1ENSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEENS0_17VariantFilterTypeERSt3mapIS6_NS_16VariantFieldTypeESt4lessIS6_ESaISt4pairIKS6_S9_EEE | 208 | _ZN3vcf13VariantFilterC1ENSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEENS0_17VariantFilterTypeERSt3mapIS6_NS_16VariantFieldTypeESt4lessIS6_ESaISt4pairIKS6_S9_EEE |
| 209 | _ZN3vcf5isHomERSt3mapIiiSt4lessIiESaISt4pairIKiiEEE | 209 | _ZN3vcf5isHomERSt3mapIiiSt4lessIiESaISt4pairIKiiEEE |
| 210 | _ZSt15__copy_move_ditILb0EbRKbPS0_St15_Deque_iteratorIbRbPbEET3_S3_IT0_T1_T2_ESB_S7_ | ||
| 211 | ti_close | 210 | ti_close |
| 212 | _ZNSt6vectorISt5dequeI6AlleleSaIS1_EESaIS3_EEC2EjRKS4_ | 211 | _ZNSt6vectorISt5dequeI6AlleleSaIS1_EESaIS3_EEC2EjRKS4_ |
| 213 | _ZN6AlleleC2ERKS_ | 212 | _ZN6AlleleC2ERKS_ |
| 214 | _Z5splitRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcRSt6vectorIS4_SaIS4_EE | 213 | _Z5splitRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcRSt6vectorIS4_SaIS4_EE |
| 215 | _ZNSt5dequeI6AlleleSaIS0_EED1Ev | 214 | _ZNSt5dequeI6AlleleSaIS0_EED1Ev |
| 216 | ks_ksmall_offt | 215 | ks_ksmall_offt |
| 217 | _ZThn4_N5boost10wrapexceptISt12domain_errorED0Ev | 216 | _ZThn4_N5boost10wrapexceptISt12domain_errorED0Ev |
| Offset 235, 23 lines modified | Offset 234, 23 lines modified | ||
| 235 | _ZNK7OptArgs8IsOptionERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE | 234 | _ZNK7OptArgs8IsOptionERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE |
| 236 | _ZThn12_N5boost10wrapexceptISt14overflow_errorED1Ev | 235 | _ZThn12_N5boost10wrapexceptISt14overflow_errorED1Ev |
| 237 | _ZNKSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_iESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE4findERS7_ | 236 | _ZNKSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_iESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE4findERS7_ |
| 238 | _ZNSt5dequeIN3vcf9RuleTokenESaIS1_EE9push_backERKS1_ | 237 | _ZNSt5dequeIN3vcf9RuleTokenESaIS1_EE9push_backERKS1_ |
| 239 | _ZSt13__upper_boundISt15_Deque_iteratorI6AlleleRS1_PS1_ES1_N9__gnu_cxx5__ops14_Val_comp_iterIPFbRKS1_S9_EEEET_SD_SD_RKT0_T1_ | 238 | _ZSt13__upper_boundISt15_Deque_iteratorI6AlleleRS1_PS1_ES1_N9__gnu_cxx5__ops14_Val_comp_iterIPFbRKS1_S9_EEEET_SD_SD_RKT0_T1_ |
| 240 | _ZN3vcf18tokenizeFilterSpecERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERSt5queueINS_9RuleTokenESt5dequeIS8_SaIS8_EEERSt3mapIS5_NS_16VariantFieldTypeESt4lessIS5_ESaISt4pairIKS5_SF_EEE | 239 | _ZN3vcf18tokenizeFilterSpecERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERSt5queueINS_9RuleTokenESt5dequeIS8_SaIS8_EEERSt3mapIS5_NS_16VariantFieldTypeESt4lessIS5_ESaISt4pairIKS5_SF_EEE |
| 241 | _Z17push_format_fieldRN3vcf7VariantENSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES7_ | 240 | _Z17push_format_fieldRN3vcf7VariantENSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES7_ |
| 241 | _ZSt4moveISt15_Deque_iteratorI6AlleleRS1_PS1_ES4_ET0_T_S6_S5_ | ||
| 242 | _ZN3vcf7Variant13getNumSamplesEv | 242 | _ZN3vcf7Variant13getNumSamplesEv |
| 243 | _ZN5boost4math19unchecked_factorialIeEET_j | 243 | _ZN5boost4math19unchecked_factorialIeEET_j |
| 244 | _ZNSt11_Deque_baseIbSaIbEED1Ev | 244 | _ZNSt11_Deque_baseIbSaIbEED1Ev |
| 245 | _ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_N3vcf16VariantFieldTypeEESt10_Select1stISA_ESt4lessIS5_ESaISA_EE24_M_get_insert_unique_posERS7_ | 245 | _ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_N3vcf16VariantFieldTypeEESt10_Select1stISA_ESt4lessIS5_ESaISA_EE24_M_get_insert_unique_posERS7_ |
| 246 | _ZN5TabixC2Ev | 246 | _ZN5TabixC2Ev |
| 247 | _ZN3vcf15VariantCallFile7infoIdsB5cxx11Ev | 247 | _ZN3vcf15VariantCallFile7infoIdsB5cxx11Ev |
| 248 | _ZN3vcf15VariantCallFile11parseHeaderERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE | 248 | _ZN3vcf15VariantCallFile11parseHeaderERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE |
| 249 | _ZNSt5dequeIbSaIbEE13_M_insert_auxISt15_Deque_iteratorIbRKbPS4_EEEvS3_IbRbPbET_SB_j | 249 | _ZNSt5dequeIbSaIbEE13_M_insert_auxISt15_Deque_iteratorIbRKbPS4_EEEvS3_IbRbPbET_SB_j |
| 250 | _ZSt15__copy_move_ditILb0ENSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERKS5_PS6_St15_Deque_iteratorIS5_RS5_PS5_EET3_S9_IT0_T1_T2_ESH_SD_ | ||
| 251 | _ZN7OptArgs9GetOptionERSt6vectorIjSaIjEERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcSB_c | 250 | _ZN7OptArgs9GetOptionERSt6vectorIjSaIjEERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcSB_c |
| 252 | _ZNSt7__cxx1110_List_baseINS_4listIiSaIiEEESaIS3_EE8_M_clearEv | 251 | _ZNSt7__cxx1110_List_baseINS_4listIiSaIiEEESaIS3_EE8_M_clearEv |
| 253 | ti_index_build2 | 252 | ti_index_build2 |
| 254 | _ZN3vcf7Variant12getValueBoolERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES7_i | 253 | _ZN3vcf7Variant12getValueBoolERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES7_i |
| 255 | _ZSt13__adjust_heapIN9__gnu_cxx17__normal_iteratorIPPN14TargetsManager14UnmergedTargetESt6vectorIS4_SaIS4_EEEEiS4_NS0_5__ops15_Iter_comp_iterIPFbS4_S4_EEEEvT_T0_SG_T1_T2_ | 254 | _ZSt13__adjust_heapIN9__gnu_cxx17__normal_iteratorIPPN14TargetsManager14UnmergedTargetESt6vectorIS4_SaIS4_EEEEiS4_NS0_5__ops15_Iter_comp_iterIPFbS4_S4_EEEEvT_T0_SG_T1_T2_ |
| 256 | _ZNSt6vectorI9ReferenceSaIS0_EED1Ev | 255 | _ZNSt6vectorI9ReferenceSaIS0_EED1Ev |
| 257 | _ZN7BedLineC2ERKS_ | 256 | _ZN7BedLineC2ERKS_ |
| Offset 266, 29 lines modified | Offset 265, 29 lines modified | ||
| 266 | _ZN11bgzf_stream5flushEv | 265 | _ZN11bgzf_stream5flushEv |
| 267 | _Z19PrepareHotspotsHelpv | 266 | _Z19PrepareHotspotsHelpv |
| 268 | _Z13check_on_readNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES4_ | 267 | _Z13check_on_readNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES4_ |
| 269 | _ZN12markov_chainIjE15generate_statesEjj | 268 | _ZN12markov_chainIjE15generate_statesEjj |
| 270 | _ZN10IonVersion10GetVersionB5cxx11Ev | 269 | _ZN10IonVersion10GetVersionB5cxx11Ev |
| 271 | _ZN5boost4math8policies6detail21replace_all_in_stringERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEPKcSB_ | 270 | _ZN5boost4math8policies6detail21replace_all_in_stringERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEPKcSB_ |
| 272 | _ZN6AlleleD2Ev | 271 | _ZN6AlleleD2Ev |
| 272 | _ZNSt6vectorISt5dequeI6AlleleSaIS1_EESaIS3_EED2Ev | ||
| 273 | _ZN3vcf10mergeCigarERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES7_ | 273 | _ZN3vcf10mergeCigarERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES7_ |
| 274 | _ZN3vcf15VariantCallFile11parseHeaderEv | 274 | _ZN3vcf15VariantCallFile11parseHeaderEv |
| 275 | _ZNSt17_Temporary_bufferISt15_Deque_iteratorI6AlleleRS1_PS1_ES1_ED2Ev | 275 | _ZNSt17_Temporary_bufferISt15_Deque_iteratorI6AlleleRS1_PS1_ES1_ED2Ev |
| 276 | _ZN23markov_chain_comparatorclERK12markov_stateS2_ | 276 | _ZN23markov_chain_comparatorclERK12markov_stateS2_ |
| 277 | _ZN16VcfOrderedMergerD1Ev | 277 | _ZN16VcfOrderedMergerD1Ev |
| 278 | _ZSt14__copy_move_a1ILb1EP7BedLineS0_EN9__gnu_cxx11__enable_ifIXsrSt23__is_random_access_iterIT0_NSt15iterator_traitsIS5_E17iterator_categoryEE7__valueESt15_Deque_iteratorIT1_RSB_PSB_EE6__typeES5_S5_SE_ | 278 | _ZSt14__copy_move_a1ILb1EP7BedLineS0_EN9__gnu_cxx11__enable_ifIXsrSt23__is_random_access_iterIT0_NSt15iterator_traitsIS5_E17iterator_categoryEE7__valueESt15_Deque_iteratorIT1_RSB_PSB_EE6__typeES5_S5_SE_ |
| 279 | _bgzf_seek | 279 | _bgzf_seek |
| 280 | _ZTVN5boost4math16evaluation_errorE | 280 | _ZTVN5boost4math16evaluation_errorE |
| 281 | _ZNSt6vectorI9ReferenceSaIS0_EED2Ev | 281 | _ZNSt6vectorI9ReferenceSaIS0_EED2Ev |
| 282 | ti_lazy_index_load | 282 | ti_lazy_index_load |
| 283 | _ZThn12_N5boost10wrapexceptINS_4math16evaluation_errorEED0Ev | 283 | _ZThn12_N5boost10wrapexceptINS_4math16evaluation_errorEED0Ev |
| 284 | _ZNSt6vectorIjSaIjEE17_M_realloc_insertIJjEEEvN9__gnu_cxx17__normal_iteratorIPjS1_EEDpOT_ | 284 | _ZNSt6vectorIjSaIjEE17_M_realloc_insertIJjEEEvN9__gnu_cxx17__normal_iteratorIPjS1_EEDpOT_ |
| 285 | _ZN13PriorityQueueC2ERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEER16VcfOrderedMergerRK15ReferenceReadermbb | 285 | _ZN13PriorityQueueC2ERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEER16VcfOrderedMergerRK15ReferenceReadermbb |
| 286 | _bgzf_read | 286 | _bgzf_read |
| 287 | _ZSt15__copy_move_ditILb0E7BedLineRKS0_PS1_St15_Deque_iteratorIS0_RS0_PS0_EET3_S4_IT0_T1_T2_ESC_S8_ | ||
| 288 | _ZN11OptArgumentC1Ev | 287 | _ZN11OptArgumentC1Ev |
| 289 | _ZNSt5dequeI10LineStatusSaIS0_EED1Ev | 288 | _ZNSt5dequeI10LineStatusSaIS0_EED1Ev |
| 290 | _bgzf_open | 289 | _bgzf_open |
| 291 | _ZTIN5boost10wrapexceptINS_4math14rounding_errorEEE | 290 | _ZTIN5boost10wrapexceptINS_4math14rounding_errorEEE |
| 292 | _ZNSt5dequeI7BedLineSaIS0_EE8_M_eraseESt15_Deque_iteratorIS0_RS0_PS0_E | 291 | _ZNSt5dequeI7BedLineSaIS0_EE8_M_eraseESt15_Deque_iteratorIS0_RS0_PS0_E |
| 293 | _ZN11bgzf_streamlsIN3vcf7VariantEEERS_RT_ | 292 | _ZN11bgzf_streamlsIN3vcf7VariantEEERS_RT_ |
| 294 | _ZTIN5boost4math14rounding_errorE | 293 | _ZTIN5boost4math14rounding_errorE |
| Offset 309, 14 lines modified | Offset 308, 15 lines modified | ||
| 309 | _ZN5boost10wrapexceptINS_4math16evaluation_errorEED0Ev | 308 | _ZN5boost10wrapexceptINS_4math16evaluation_errorEED0Ev |
| 310 | _ZSt19piecewise_construct | 309 | _ZSt19piecewise_construct |
| 311 | _ZN7OptArgs9GetOptionERbRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcS8_ | 310 | _ZN7OptArgs9GetOptionERbRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcS8_ |
| 312 | _ZN7OptArgs12ParseCmdLineEiPPKc | 311 | _ZN7OptArgs12ParseCmdLineEiPPKc |
| 313 | _ZN5boost10wrapexceptINS_4math14rounding_errorEED1Ev | 312 | _ZN5boost10wrapexceptINS_4math14rounding_errorEED1Ev |
| 314 | _ZNSt5dequeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS5_EE24_M_new_elements_at_frontEj | 313 | _ZNSt5dequeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS5_EE24_M_new_elements_at_frontEj |
| 315 | _ZSt16__insertion_sortIN9__gnu_cxx17__normal_iteratorIPPN14TargetsManager14UnmergedTargetESt6vectorIS4_SaIS4_EEEENS0_5__ops15_Iter_comp_iterIPFbS4_S4_EEEEvT_SF_T0_ | 314 | _ZSt16__insertion_sortIN9__gnu_cxx17__normal_iteratorIPPN14TargetsManager14UnmergedTargetESt6vectorIS4_SaIS4_EEEENS0_5__ops15_Iter_comp_iterIPFbS4_S4_EEEEvT_SF_T0_ |
| 315 | _ZNSt6vectorISt5dequeI6AlleleSaIS1_EESaIS3_EED1Ev | ||
| 316 | ti_querys | 316 | ti_querys |
| 317 | _ZSt14__copy_move_a1ILb1EPbbEN9__gnu_cxx11__enable_ifIXsrSt23__is_random_access_iterIT0_NSt15iterator_traitsIS4_E17iterator_categoryEE7__valueESt15_Deque_iteratorIT1_RSA_PSA_EE6__typeES4_S4_SD_ | 317 | _ZSt14__copy_move_a1ILb1EPbbEN9__gnu_cxx11__enable_ifIXsrSt23__is_random_access_iterIT0_NSt15iterator_traitsIS4_E17iterator_categoryEE7__valueESt15_Deque_iteratorIT1_RSA_PSA_EE6__typeES4_S4_SD_ |
| 318 | _ZN7OptArgs9GetOptionERiRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcS8_ | 318 | _ZN7OptArgs9GetOptionERiRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcS8_ |
| 319 | _ZNSt11_Deque_baseI10LineStatusSaIS0_EEC2Ev | 319 | _ZNSt11_Deque_baseI10LineStatusSaIS0_EEC2Ev |
| 320 | _Z15ValidateBedHelpv | 320 | _Z15ValidateBedHelpv |
| 321 | _ZNSt6vectorIS_IlSaIlEESaIS1_EE17_M_realloc_insertIJRKS1_EEEvN9__gnu_cxx17__normal_iteratorIPS1_S3_EEDpOT_ | 321 | _ZNSt6vectorIS_IlSaIlEESaIS1_EE17_M_realloc_insertIJRKS1_EEEvN9__gnu_cxx17__normal_iteratorIPS1_S3_EEDpOT_ |
| 322 | _ZNSt12_Vector_baseIP20ComparableVcfVariantSaIS1_EED2Ev | 322 | _ZNSt12_Vector_baseIP20ComparableVcfVariantSaIS1_EED2Ev |
| Offset 383, 26 lines modified | Offset 383, 26 lines modified | ||
| 383 | _ZN3vcflsERSoNS_16VariantFieldTypeE | 383 | _ZN3vcflsERSoNS_16VariantFieldTypeE |
| 384 | _ZN5boost4math6detail5sinpxIeEET_S3_ | 384 | _ZN5boost4math6detail5sinpxIeEET_S3_ |
| 385 | _ZNSt15_Deque_iteratorI6AlleleRS0_PS0_EmmEv | 385 | _ZNSt15_Deque_iteratorI6AlleleRS0_PS0_EmmEv |
| 386 | _ZN3vcf7Variant9addFilterERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE | 386 | _ZN3vcf7Variant9addFilterERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE |
| 387 | _ZN13PriorityQueue13open_vcf_fileERN3vcf15VariantCallFileENSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEb | 387 | _ZN13PriorityQueue13open_vcf_fileERN3vcf15VariantCallFileENSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEb |
| 388 | _ZSt22__merge_without_bufferISt15_Deque_iteratorI6AlleleRS1_PS1_EiN9__gnu_cxx5__ops15_Iter_comp_iterIPFbRKS1_S9_EEEEvT_SD_SD_T0_SE_T1_ | 388 | _ZSt22__merge_without_bufferISt15_Deque_iteratorI6AlleleRS1_PS1_EiN9__gnu_cxx5__ops15_Iter_comp_iterIPFbRKS1_S9_EEEEvT_SD_SD_T0_SE_T1_ |
| 389 | _ZN5boost4math14rounding_errorD0Ev | 389 | _ZN5boost4math14rounding_errorD0Ev |
| Max diff block lines reached; 10459/18079 bytes (57.85%) of diff not shown. | |||
| Offset 1, 324 lines modified | Offset 1, 324 lines modified | ||
| 1 | Hex·dump·of·section·'.gnu.hash': | 1 | Hex·dump·of·section·'.gnu.hash': |
| 2 | ··0x000001ec·09020000·e5000000·80000000·0c000000·................ | 2 | ··0x000001ec·09020000·e5000000·80000000·0c000000·................ |
| 3 | ··0x000001fc·442c58c5·08005148·00040908·c1920008·D,X...QH........ | 3 | ··0x000001fc·442c58c5·08005148·00040908·c1920008·D,X...QH........ |
| 4 | ··0x0000020c·2986a203·a8058808·2500080a·51046110·).......%...Q.a. | 4 | ··0x0000020c·2986a203·a8058808·2500080a·51046110·).......%...Q.a. |
| 5 | ··0x0000021c·506022a6·61001490·90051548·0f019040·P`".a......H...@ | 5 | ··0x0000021c·506022a6·61001490·90051548·0f019040·P`".a......H...@ |
| 6 | ··0x0000022c·e1044512·61008458·90156111·6 | 6 | ··0x0000022c·e1044512·61008458·90156111·64089220·..E.a..X..a.d..· |
| 7 | ··0x0000023c·00228101· | 7 | ··0x0000023c·00228101·831c4528·51040210·02442442·."....E(Q....D$B |
| 8 | ··0x0000024c·448c0134·80a08000·b0409060·24095080·D..4.....@.`$.P. | 8 | ··0x0000024c·448c0134·80a08000·b0409060·24095080·D..4.....@.`$.P. |
| 9 | ··0x0000025c·b48c0 | 9 | ··0x0000025c·b48c0412·3a30bd41·243da201·53008040·....:0.A$=..S..@ |
| 10 | ··0x0000026c·f48c10f8·6d5052ab·8f212000·026408a0·....mPR..!·..d.. | 10 | ··0x0000026c·f48c10f8·6d5052ab·8f212000·026408a0·....mPR..!·..d.. |
| 11 | ··0x0000027c·54000ca0·00605003·63043804·2422c121·T....`P.c.8.$".! | 11 | ··0x0000027c·54000ca0·00605003·63043804·2422c121·T....`P.c.8.$".! |
| 12 | ··0x0000028c·00414002·42 | 12 | ··0x0000028c·00414002·4234c8c0·42010008·8415818c·.A@.B4..B....... |
| 13 | ··0x0000029c·80a61819·098c52a0·08481444·0e61ac80·......R..H.D.a.. | 13 | ··0x0000029c·80a61819·098c52a0·08481444·0e61ac80·......R..H.D.a.. |
| 14 | ··0x000002ac·02000a90·8190a000·10300002·a780a0b0·.........0...... | 14 | ··0x000002ac·02000a90·8190a000·10300002·a780a0b0·.........0...... |
| 15 | ··0x000002bc·58981270·2420098e·d2348226·8 | 15 | ··0x000002bc·58981270·2420098e·d2348226·80000010·X..p$·...4.&.... |
| 16 | ··0x000002cc·60001608·46048279·01280020·8a00040a·`...F..y.(.·.... | 16 | ··0x000002cc·60001608·46048279·01280020·8a00040a·`...F..y.(.·.... |
| 17 | ··0x000002dc·04800202·6cca1844·009400c2·64646420·....l..D....ddd· | 17 | ··0x000002dc·04800202·6cca1844·009400c2·64646420·....l..D....ddd· |
| 18 | ··0x000002ec·422d2401·92c600e2·c1682c09·44224900·B-$......h,.D"I. | 18 | ··0x000002ec·422d2401·92c600e2·c1682c09·44224900·B-$......h,.D"I. |
| 19 | ··0x000002fc·86204000·1c45ef22·706a7075·45f04900·.·@..E."pjpuE.I. | 19 | ··0x000002fc·86204000·1c45ef22·706a7075·45f04900·.·@..E."pjpuE.I. |
| 20 | ··0x0000030c·a2a0a100· | 20 | ··0x0000030c·a2a0a100·f90020b0·6d000204·840070c0·......·.m.....p. |
| 21 | ··0x0000031c·0020a200·18042404·a881a486·0404f348·.·....$........H | 21 | ··0x0000031c·0020a200·18042404·a881a486·0404f348·.·....$........H |
| 22 | ··0x0000032c·04500004·d0a18984·20440005·0ab0a40a·.P......·D...... | 22 | ··0x0000032c·04500004·d0a18984·20440005·0ab0a40a·.P......·D...... |
| 23 | ··0x0000033c· | 23 | ··0x0000033c·441418a0·0a508204·91080222·8e008010·D....P.....".... |
| 24 | ··0x0000034c·24ac0828·00308010·8 | 24 | ··0x0000034c·24ac0828·00308010·8d031000·82a86004·$..(.0........`. |
| 25 | ··0x0000035c·4a19cb84·90884004·12802743·8d803680·J.....@...'C..6. | 25 | ··0x0000035c·4a19cb84·90884004·12802743·8d803680·J.....@...'C..6. |
| 26 | ··0x0000036c· | 26 | ··0x0000036c·01121000·06241040·aa1428ac·08804800·.....$.@..(...H. |
| 27 | ··0x0000037c·80020804·a0609100· | 27 | ··0x0000037c·80020804·a0609100·91a24400·85430810·.....`....D..C.. |
| 28 | ··0x0000038c·d2984c74·8260460e·a0e10240·d8005620·..Lt.`F....@..V· | 28 | ··0x0000038c·d2984c74·8260460e·a0e10240·d8005620·..Lt.`F....@..V· |
| 29 | ··0x0000039c·ab1a1820·06412094·1868d802·100c4488·...·.A·..h....D. | 29 | ··0x0000039c·ab1a1820·06412094·1868d802·100c4488·...·.A·..h....D. |
| 30 | ··0x000003ac·a | 30 | ··0x000003ac·a1234100·a2680200·4e328826·83020220·.#A..h..N2.&...· |
| 31 | ··0x000003bc·91030200·06818 | 31 | ··0x000003bc·91030200·06818542·b242a0da·000c4148·.......B.B....AH |
| 32 | ··0x000003cc·08048452·01048914·554db311·00213280·...R....UM...!2. | 32 | ··0x000003cc·08048452·01048914·554db311·00213280·...R....UM...!2. |
| 33 | ··0x000003dc·5 | 33 | ··0x000003dc·5124440d·4ac8e724·04020800·963cca01·Q$D.J..$.....<.. |
| 34 | ··0x000003ec·41080020·81 | 34 | ··0x000003ec·41080020·813205c2·000016c8·05654080·A..·.2.......e@. |
| 35 | ··0x000003fc·e5000000·00000000·e8000000·e9000000·................ | 35 | ··0x000003fc·e5000000·00000000·e8000000·e9000000·................ |
| 36 | ··0x0000040c·eb000000·ed000000·ee000000·00000000·................ | ||
| 36 | ··0x000004 | 37 | ··0x0000041c·f0000000·f1000000·f2000000·f3000000·................ |
| 37 | ··0x0000041c·f1000000·f3000000·f4000000·f5000000·................ | ||
| 38 | ··0x0000042c·00000000·f | 38 | ··0x0000042c·00000000·f4000000·f8000000·fb000000·................ |
| 39 | ··0x0000043c·fe000000·00000000·ff000000·00000000·................ | ||
| 39 | ··0x000004 | 40 | ··0x0000044c·00010000·00000000·02010000·03010000·................ |
| 40 | ··0x0000044c·03010000·00000000·05010000·06010000·................ | ||
| 41 | ··0x0000045c·0 | 41 | ··0x0000045c·04010000·00000000·06010000·07010000·................ |
| 42 | ··0x0000046c·0b010000·0c010000·0e010000·12010000·................ | ||
| 42 | ··0x000004 | 43 | ··0x0000047c·13010000·14010000·16010000·18010000·................ |
| 43 | ··0x0000047c·16010000·17010000·19010000·1b010000·................ | ||
| 44 | ··0x0000048c·00000000·1 | 44 | ··0x0000048c·00000000·1a010000·00000000·1d010000·................ |
| 45 | ··0x0000049c· | 45 | ··0x0000049c·1f010000·20010000·23010000·24010000·....·...#...$... |
| 46 | ··0x000004ac·00000000·2 | 46 | ··0x000004ac·00000000·26010000·00000000·27010000·....&.......'... |
| 47 | ··0x000004bc·2 | 47 | ··0x000004bc·28010000·2b010000·2d010000·2f010000·(...+...-.../... |
| 48 | ··0x000004cc·00000000·3 | 48 | ··0x000004cc·00000000·31010000·32010000·33010000·....1...2...3... |
| 49 | ··0x000004dc·3 | 49 | ··0x000004dc·34010000·36010000·39010000·3c010000·4...6...9...<... |
| 50 | ··0x000004ec· | 50 | ··0x000004ec·3e010000·3f010000·00000000·00000000·>...?........... |
| 51 | ··0x000004fc·00000000·4 | 51 | ··0x000004fc·00000000·41010000·00000000·00000000·....A........... |
| 52 | ··0x0000050c·4 | 52 | ··0x0000050c·42010000·00000000·43010000·00000000·B.......C....... |
| 53 | ··0x0000051c·4 | 53 | ··0x0000051c·46010000·47010000·48010000·4b010000·F...G...H...K... |
| 54 | ··0x0000052c·00000000·4 | 54 | ··0x0000052c·00000000·4c010000·4d010000·00000000·....L...M....... |
| 55 | ··0x0000053c· | 55 | ··0x0000053c·4e010000·51010000·52010000·00000000·N...Q...R....... |
| 56 | ··0x0000054c·5 | 56 | ··0x0000054c·54010000·00000000·00000000·55010000·T...........U... |
| 57 | ··0x0000055c·00000000·5 | 57 | ··0x0000055c·00000000·56010000·59010000·00000000·....V...Y....... |
| 58 | ··0x0000056c·5 | 58 | ··0x0000056c·5b010000·00000000·5e010000·61010000·[.......^...a... |
| 59 | ··0x0000057c·6 | 59 | ··0x0000057c·62010000·64010000·00000000·00000000·b...d........... |
| 60 | ··0x0000058c·6 | 60 | ··0x0000058c·67010000·68010000·00000000·69010000·g...h.......i... |
| 61 | ··0x0000059c·6 | 61 | ··0x0000059c·6a010000·6d010000·6e010000·71010000·j...m...n...q... |
| 62 | ··0x000005ac·7 | 62 | ··0x000005ac·72010000·74010000·76010000·00000000·r...t...v....... |
| 63 | ··0x000005bc·7 | 63 | ··0x000005bc·77010000·00000000·00000000·79010000·w...........y... |
| 64 | ··0x000005cc·7c010000·7d010000·7e010000·81010000·|...}...~....... | ||
| 65 | ··0x000005dc·82010000·86010000·88010000·89010000·................ | ||
| 64 | ··0x000005 | 66 | ··0x000005ec·8c010000·8e010000·8f010000·90010000·................ |
| 65 | ··0x000005dc·86010000·8a010000·8c010000·8d010000·................ | ||
| 66 | ··0x000005ec·90010000·92010000·93010000·94010000·................ | ||
| 67 | ··0x000005fc·9 | 67 | ··0x000005fc·92010000·00000000·00000000·00000000·................ |
| 68 | ··0x0000060c·00000000·00000000·00000000·9 | 68 | ··0x0000060c·00000000·00000000·00000000·94010000·................ |
| 69 | ··0x0000061c·9 | 69 | ··0x0000061c·96010000·97010000·00000000·99010000·................ |
| 70 | ··0x0000062c·00000000·9 | 70 | ··0x0000062c·00000000·9a010000·00000000·9c010000·................ |
| 71 | ··0x0000063c·00000000· | 71 | ··0x0000063c·00000000·9e010000·00000000·9f010000·................ |
| 72 | ··0x0000064c·a | 72 | ··0x0000064c·a0010000·a3010000·00000000·00000000·................ |
| 73 | ··0x0000065c·a | 73 | ··0x0000065c·a6010000·a7010000·00000000·a8010000·................ |
| 74 | ··0x0000066c·a | 74 | ··0x0000066c·a9010000·ab010000·00000000·00000000·................ |
| 75 | ··0x0000067c·b | 75 | ··0x0000067c·b0010000·b3010000·b4010000·00000000·................ |
| 76 | ··0x0000068c·b | 76 | ··0x0000068c·b8010000·ba010000·bd010000·be010000·................ |
| 77 | ··0x0000069c·00000000·c | 77 | ··0x0000069c·00000000·c0010000·c2010000·00000000·................ |
| 78 | ··0x000006ac·00000000·c | 78 | ··0x000006ac·00000000·c3010000·c6010000·c7010000·................ |
| 79 | ··0x000006bc·c | 79 | ··0x000006bc·c8010000·ca010000·cb010000·cd010000·................ |
| 80 | ··0x000006cc· | 80 | ··0x000006cc·ce010000·d0010000·d1010000·00000000·................ |
| 81 | ··0x000006dc·d | 81 | ··0x000006dc·d2010000·d3010000·d5010000·d8010000·................ |
| 82 | ··0x000006ec·d | 82 | ··0x000006ec·d9010000·00000000·da010000·00000000·................ |
| 83 | ··0x000006fc·dd010000·de010000·e0010000·e1010000·................ | ||
| 83 | ··0x00000 | 84 | ··0x0000070c·e2010000·e3010000·e4010000·e7010000·................ |
| 84 | ··0x0000070c·e6010000·e7010000·e8010000·ea010000·................ | ||
| 85 | ··0x0000071c· | 85 | ··0x0000071c·e9010000·ea010000·00000000·ec010000·................ |
| 86 | ··0x0000072c·e | 86 | ··0x0000072c·ed010000·00000000·00000000·ee010000·................ |
| 87 | ··0x0000073c·f | 87 | ··0x0000073c·f0010000·f1010000·00000000·f2010000·................ |
| 88 | ··0x0000074c·f | 88 | ··0x0000074c·f5010000·f7010000·00000000·f8010000·................ |
| 89 | ··0x0000075c·f | 89 | ··0x0000075c·f9010000·00000000·00000000·fb010000·................ |
| 90 | ··0x0000076c·f | 90 | ··0x0000076c·fc010000·fe010000·02020000·05020000·................ |
| 91 | ··0x0000077c·0 | 91 | ··0x0000077c·06020000·00000000·00000000·08020000·................ |
| 92 | ··0x0000078c·0 | 92 | ··0x0000078c·09020000·00000000·0a020000·0b020000·................ |
| 93 | ··0x0000079c·0 | 93 | ··0x0000079c·0c020000·0d020000·00000000·00000000·................ |
| 94 | ··0x000007ac·00000000· | 94 | ··0x000007ac·00000000·0f020000·10020000·11020000·................ |
| 95 | ··0x000007bc·1 | 95 | ··0x000007bc·13020000·15020000·16020000·00000000·................ |
| 96 | ··0x000007cc·1 | 96 | ··0x000007cc·17020000·18020000·1b020000·1c020000·................ |
| 97 | ··0x000007dc·00000000· | 97 | ··0x000007dc·00000000·1e020000·1f020000·20020000·............·... |
| 98 | ··0x000007ec·2 | 98 | ··0x000007ec·22020000·24020000·26020000·00000000·"...$...&....... |
| 99 | ··0x000007fc·2 | 99 | ··0x000007fc·28020000·29020000·2a020000·00000000·(...)...*....... |
| 100 | ··0x0000080c·2 | 100 | ··0x0000080c·2b020000·2c020000·2d020000·00000000·+...,...-....... |
| 101 | ··0x0000081c·00000000·00000000·3 | 101 | ··0x0000081c·00000000·00000000·30020000·00000000·........0....... |
| 102 | ··0x0000082c·3 | 102 | ··0x0000082c·31020000·00000000·36020000·38020000·1.......6...8... |
| 103 | ··0x0000083c·00000000·3 | 103 | ··0x0000083c·00000000·3a020000·00000000·3b020000·....:.......;... |
| 104 | ··0x0000084c·3 | 104 | ··0x0000084c·3c020000·3e020000·3f020000·41020000·<...>...?...A... |
| 105 | ··0x0000085c·4 | 105 | ··0x0000085c·43020000·00000000·00000000·45020000·C...........E... |
| 106 | ··0x0000086c·4 | 106 | ··0x0000086c·46020000·47020000·4c020000·4d020000·F...G...L...M... |
| 107 | ··0x0000087c· | 107 | ··0x0000087c·4f020000·00000000·00000000·50020000·O...........P... |
| 108 | ··0x0000088c·00000000·00000000·5 | 108 | ··0x0000088c·00000000·00000000·52020000·54020000·........R...T... |
| 109 | ··0x0000089c·5 | 109 | ··0x0000089c·56020000·00000000·57020000·58020000·V.......W...X... |
| 110 | ··0x000008ac·5 | 110 | ··0x000008ac·59020000·5a020000·5c020000·00000000·Y...Z...\....... |
| 111 | ··0x000008bc·00000000·00000000· | 111 | ··0x000008bc·00000000·00000000·5f020000·00000000·........_....... |
| 112 | ··0x000008cc·00000000·6 | 112 | ··0x000008cc·00000000·60020000·61020000·63020000·....`...a...c... |
| 113 | ··0x000008dc·00000000·00000000· | 113 | ··0x000008dc·00000000·00000000·65020000·66020000·........e...f... |
| 114 | ··0x000008ec·67020000·68020000·6c020000·6e020000·g...h...l...n... | 114 | ··0x000008ec·67020000·68020000·6c020000·6e020000·g...h...l...n... |
| 115 | ··0x000008fc·00000000·6f020000·70020000·72020000·....o...p...r... | 115 | ··0x000008fc·00000000·6f020000·70020000·72020000·....o...p...r... |
| 116 | ··0x0000090c·00000000·73020000· | 116 | ··0x0000090c·00000000·73020000·00000000·74020000·....s.......t... |
| 117 | ··0x0000091c·7 | 117 | ··0x0000091c·75020000·76020000·7b020000·7c020000·u...v...{...|... |
| 118 | ··0x0000092c·8 | 118 | ··0x0000092c·81020000·00000000·84020000·86020000·................ |
| 119 | ··0x0000093c·00000000·00000000·8 | 119 | ··0x0000093c·00000000·00000000·87020000·00000000·................ |
| 120 | ··0x0000094c·00000000·8 | 120 | ··0x0000094c·00000000·89020000·8c020000·8d020000·................ |
| Max diff block lines reached; 20638/40727 bytes (50.67%) of diff not shown. | |||
| Offset 265, 3010 lines modified | Offset 265, 2992 lines modified | ||
| 265 | ··0x00005c1c·73496345·53614963·45453133·66696e64·sIcESaIcEE13find | 265 | ··0x00005c1c·73496345·53614963·45453133·66696e64·sIcESaIcEE13find |
| 266 | ··0x00005c2c·5f666972·73745f6f·6645504b·636a6a00·_first_ofEPKcjj. | 266 | ··0x00005c2c·5f666972·73745f6f·6645504b·636a6a00·_first_ofEPKcjj. |
| 267 | ··0x00005c3c·5f5a4e53·7438696f·735f6261·73654432·_ZNSt8ios_baseD2 | 267 | ··0x00005c3c·5f5a4e53·7438696f·735f6261·73654432·_ZNSt8ios_baseD2 |
| 268 | ··0x00005c4c·4576005f·5a54544e·5374375f·5f637878·Ev._ZTTNSt7__cxx | 268 | ··0x00005c4c·4576005f·5a54544e·5374375f·5f637878·Ev._ZTTNSt7__cxx |
| 269 | ··0x00005c5c·31313138·62617369·635f7374·72696e67·1118basic_string | 269 | ··0x00005c5c·31313138·62617369·635f7374·72696e67·1118basic_string |
| 270 | ··0x00005c6c·73747265·616d4963·53743131·63686172·streamIcSt11char | 270 | ··0x00005c6c·73747265·616d4963·53743131·63686172·streamIcSt11char |
| 271 | ··0x00005c7c·5f747261·69747349·63455361·49634545·_traitsIcESaIcEE | 271 | ··0x00005c7c·5f747261·69747349·63455361·49634545·_traitsIcESaIcEE |
| 272 | ··0x00005c8c·45005f5a·54564e53·74375f5f·63787831·E._ZTVNSt7__cxx1 | ||
| 273 | ··0x00005c9c·31313962·61736963·5f6f7374·72696e67·119basic_ostring | ||
| 274 | ··0x00005cac·73747265·616d4963·53743131·63686172·streamIcSt11char | ||
| 275 | ··0x00005cbc·5f747261·69747349·63455361·49634545·_traitsIcESaIcEE | ||
| 276 | ··0x00005ccc·45005f5a·4e537431·32646f6d·61696e5f·E._ZNSt12domain_ | ||
| 277 | ··0x00005cdc·6572726f·72443145·76005f5a·54565374·errorD1Ev._ZTVSt | ||
| 278 | ··0x00005cec·3132646f·6d61696e·5f657272·6f72005f·12domain_error._ | ||
| 279 | ··0x00005cfc·5a6e616a·005f5a4e·4b537437·5f5f6378·Znaj._ZNKSt7__cx | ||
| 280 | ··0x00005d0c·78313131·35626173·69635f73·7472696e·x1115basic_strin | ||
| 281 | ··0x00005d1c·67627566·49635374·31316368·61725f74·gbufIcSt11char_t | ||
| 282 | ··0x00005d2c·72616974·73496345·53614963·45453373·raitsIcESaIcEE3s | ||
| 283 | ··0x00005d3c·74724576·005f5a53·7431385f·52625f74·trEv._ZSt18_Rb_t | ||
| 284 | ··0x00005d4c·7265655f·696e6372·656d656e·74505374·ree_incrementPSt | ||
| 285 | ··0x00005d5c·31385f52·625f7472·65655f6e·6f64655f·18_Rb_tree_node_ | ||
| 286 | ··0x00005d6c·62617365·005f5a53·7432385f·52625f74·base._ZSt28_Rb_t | ||
| 287 | ··0x00005d7c·7265655f·72656261·6c616e63·655f666f·ree_rebalance_fo | ||
| 288 | ··0x00005d8c·725f6572·61736550·53743138·5f52625f·r_erasePSt18_Rb_ | ||
| 289 | ··0x00005d9c·74726565·5f6e6f64·655f6261·73655253·tree_node_baseRS | ||
| 290 | ··0x00005dac·5f005f5f·6378615f·62656769·6e5f6361·_.__cxa_begin_ca | ||
| 291 | ··0x00005dbc·74636800·5f5a5374·34656e64·6c496353·tch._ZSt4endlIcS | ||
| 292 | ··0x00005dcc·74313163·6861725f·74726169·74734963·t11char_traitsIc | ||
| 293 | ··0x00005ddc·45455253·74313362·61736963·5f6f7374·EERSt13basic_ost | ||
| 294 | ··0x00005dec·7265616d·49545f54·305f4553·365f005f·reamIT_T0_ES6_._ | ||
| 295 | ··0x00005dfc·5a4e5374·375f5f63·78783131·31326261·ZNSt7__cxx1112ba | ||
| 296 | ··0x00005e0c·7369635f·73747269·6e674963·53743131·sic_stringIcSt11 | ||
| 297 | ··0x00005e1c·63686172·5f747261·69747349·63455361·char_traitsIcESa | ||
| 298 | ··0x00005e2c·49634545·395f4d5f·6d757461·7465456a·IcEE9_M_mutateEj | ||
| 299 | ··0x00005e3c·6a504b63·6a005f5a·4e537437·5f5f6378·jPKcj._ZNSt7__cx | ||
| 300 | ··0x00005e4c·78313131·39626173·69635f6f·73747269·x1119basic_ostri | ||
| 301 | ··0x00005e5c·6e677374·7265616d·49635374·31316368·ngstreamIcSt11ch | ||
| 302 | ··0x00005e6c·61725f74·72616974·73496345·53614963·ar_traitsIcESaIc | ||
| 303 | ··0x00005e7c·45454431·4576005f·5a537437·6765746c·EED1Ev._ZSt7getl | ||
| 304 | ··0x00005e8c·696e6549·63537431·31636861·725f7472·ineIcSt11char_tr | ||
| 305 | ··0x00005e9c·61697473·49634553·61496345·45525374·aitsIcESaIcEERSt | ||
| 306 | ··0x00005eac·31336261·7369635f·69737472·65616d49·13basic_istreamI | ||
| 307 | ··0x00005ebc·545f5430·5f455337·5f524e53·74375f5f·T_T0_ES7_RNSt7__ | ||
| 308 | ··0x00005ecc·63787831·31313262·61736963·5f737472·cxx1112basic_str | ||
| 309 | ··0x00005edc·696e6749·53345f53·355f5431·5f454553·ingIS4_S5_T1_EES | ||
| 310 | ··0x00005eec·345f005f·5a537432·395f5262·5f747265·4_._ZSt29_Rb_tre | ||
| 311 | ··0x00005efc·655f696e·73657274·5f616e64·5f726562·e_insert_and_reb | ||
| 312 | ··0x00005f0c·616c616e·63656250·53743138·5f52625f·alancebPSt18_Rb_ | ||
| 313 | ··0x00005f1c·74726565·5f6e6f64·655f6261·73655330·tree_node_baseS0 | ||
| 314 | ··0x00005f2c·5f52535f·005f5a4e·536f395f·4d5f696e·_RS_._ZNSo9_M_in | ||
| 315 | ··0x00005f3c·73657274·496d4545·52536f54·5f005f5a·sertImEERSoT_._Z | ||
| 316 | ··0x00005f4c·4e537431·33626173·69635f66·696c6562·NSt13basic_fileb | ||
| 317 | ··0x00005f5c·75664963·53743131·63686172·5f747261·ufIcSt11char_tra | ||
| 318 | ··0x00005f6c·69747349·63454544·31457600·5f5a5374·itsIcEED1Ev._ZSt | ||
| 319 | ··0x00005f7c·32305f5f·7468726f·775f6c65·6e677468·20__throw_length | ||
| 320 | ··0x00005f8c·5f657272·6f72504b·63005f5f·6378615f·_errorPKc.__cxa_ | ||
| 321 | ··0x00005f9c·72657468·726f7700·5f5a5374·31365f5f·rethrow._ZSt16__ | ||
| 322 | ··0x00005fac·6f737472·65616d5f·696e7365·72744963·ostream_insertIc | ||
| 323 | ··0x00005fbc·53743131·63686172·5f747261·69747349·St11char_traitsI | ||
| 324 | ··0x00005fcc·63454552·53743133·62617369·635f6f73·cEERSt13basic_os | ||
| 325 | ··0x00005fdc·74726561·6d49545f·54305f45·53365f50·treamIT_T0_ES6_P | ||
| 326 | ··0x00005fec·4b53335f·69005f5a·4e537437·5f5f6378·KS3_i._ZNSt7__cx | ||
| 327 | ··0x00005ffc·78313131·32626173·69635f73·7472696e·x1112basic_strin | ||
| 328 | ··0x0000600c·67496353·74313163·6861725f·74726169·gIcSt11char_trai | ||
| 329 | ··0x0000601c·74734963·45536149·63454537·72657365·tsIcESaIcEE7rese | ||
| 330 | ··0x0000602c·72766545·6a005f5a·4e4b5374·31337275·rveEj._ZNKSt13ru | ||
| 331 | ··0x0000603c·6e74696d·655f6572·726f7234·77686174·ntime_error4what | ||
| 332 | ··0x0000 | 272 | ··0x00005c8c·45005f5a·4e4b5374·375f5f63·78783131·E._ZNKSt7__cxx11 |
| 333 | ··0x0000 | 273 | ··0x00005c9c·31326261·7369635f·73747269·6e674963·12basic_stringIc |
| 274 | ··0x00005cac·53743131·63686172·5f747261·69747349·St11char_traitsI | ||
| 275 | ··0x00005cbc·63455361·49634545·36737562·73747245·cESaIcEE6substrE | ||
| 276 | ··0x00005ccc·6a6a005f·5a54564e·5374375f·5f637878·jj._ZTVNSt7__cxx | ||
| 277 | ··0x00005cdc·31313139·62617369·635f6f73·7472696e·1119basic_ostrin | ||
| 278 | ··0x00005cec·67737472·65616d49·63537431·31636861·gstreamIcSt11cha | ||
| 279 | ··0x00005cfc·725f7472·61697473·49634553·61496345·r_traitsIcESaIcE | ||
| 280 | ··0x00005d0c·4545005f·5a4e5374·3132646f·6d61696e·EE._ZNSt12domain | ||
| 281 | ··0x00005d1c·5f657272·6f724431·4576005f·5a545653·_errorD1Ev._ZTVS | ||
| 282 | ··0x00005d2c·74313264·6f6d6169·6e5f6572·726f7200·t12domain_error. | ||
| 283 | ··0x00005d3c·5f5a6e61·6a005f5a·4e4b5374·375f5f63·_Znaj._ZNKSt7__c | ||
| 284 | ··0x00005d4c·78783131·31356261·7369635f·73747269·xx1115basic_stri | ||
| 285 | ··0x00005d5c·6e676275·66496353·74313163·6861725f·ngbufIcSt11char_ | ||
| 286 | ··0x00005d6c·74726169·74734963·45536149·63454533·traitsIcESaIcEE3 | ||
| 287 | ··0x00005d7c·73747245·76005f5a·53743138·5f52625f·strEv._ZSt18_Rb_ | ||
| 288 | ··0x00005d8c·74726565·5f696e63·72656d65·6e745053·tree_incrementPS | ||
| 289 | ··0x00005d9c·7431385f·52625f74·7265655f·6e6f6465·t18_Rb_tree_node | ||
| 290 | ··0x00005dac·5f626173·65005f5a·53743238·5f52625f·_base._ZSt28_Rb_ | ||
| 291 | ··0x00005dbc·74726565·5f726562·616c616e·63655f66·tree_rebalance_f | ||
| 292 | ··0x00005dcc·6f725f65·72617365·50537431·385f5262·or_erasePSt18_Rb | ||
| 293 | ··0x00005ddc·5f747265·655f6e6f·64655f62·61736552·_tree_node_baseR | ||
| 294 | ··0x00005dec·535f005f·5f637861·5f626567·696e5f63·S_.__cxa_begin_c | ||
| 295 | ··0x00005dfc·61746368·005f5a53·7434656e·646c4963·atch._ZSt4endlIc | ||
| 334 | ··0x0000 | 296 | ··0x00005e0c·53743131·63686172·5f747261·69747349·St11char_traitsI |
| 297 | ··0x00005e1c·63454552·53743133·62617369·635f6f73·cEERSt13basic_os | ||
| 298 | ··0x00005e2c·74726561·6d49545f·54305f45·53365f00·treamIT_T0_ES6_. | ||
| 299 | ··0x00005e3c·5f5a4e53·74375f5f·63787831·31313262·_ZNSt7__cxx1112b | ||
| 300 | ··0x00005e4c·61736963·5f737472·696e6749·63537431·asic_stringIcSt1 | ||
| 335 | ··0x0000607c·63455361·49634545·31325f4d·5f636f6e·cESaIcEE12_M_con | ||
| 336 | ··0x0000608c·73747275·6374456a·63005f5a·4e537436·structEjc._ZNSt6 | ||
| 337 | ··0x0000609c·6c6f6361·6c654331·4576005f·5a4e5374·localeC1Ev._ZNSt | ||
| 338 | ··0x000060ac·375f5f63·78783131·31386261·7369635f·7__cxx1118basic_ | ||
| 339 | ··0x000060bc·73747269·6e677374·7265616d·49635374·stringstreamIcSt | ||
| 340 | ··0x0000 | 301 | ··0x00005e5c·31636861·725f7472·61697473·49634553·1char_traitsIcES |
| 341 | ··0x0000 | 302 | ··0x00005e6c·61496345·45395f4d·5f6d7574·61746545·aIcEE9_M_mutateE |
| 303 | ··0x00005e7c·6a6a504b·636a005f·5a4e5374·375f5f63·jjPKcj._ZNSt7__c | ||
| 342 | ··0x0000 | 304 | ··0x00005e8c·78783131·31396261·7369635f·6f737472·xx1119basic_ostr |
| 343 | ··0x000060fc·73747269·6e674963·53743131·63686172·stringIcSt11char | ||
| 344 | ··0x0000610c·5f747261·69747349·63455361·49634545·_traitsIcESaIcEE | ||
| 345 | ··0x0000611c·395f4d5f·61737369·676e4552·4b53345f·9_M_assignERKS4_ | ||
| 346 | ··0x0000612c·005f5a53·7431385f·52625f74·7265655f·._ZSt18_Rb_tree_ | ||
| 347 | ··0x0000613c·64656372·656d656e·74505374·31385f52·decrementPSt18_R | ||
| 348 | ··0x0000614c·625f7472·65655f6e·6f64655f·62617365·b_tree_node_base | ||
| 349 | ··0x0000615c·005f5a4e·5374375f·5f637878·31313139·._ZNSt7__cxx1119 | ||
| 350 | ··0x0000616c·62617369·635f6973·7472696e·67737472·basic_istringstr | ||
| 351 | ··0x0000617c·65616d49·63537431·31636861·725f7472·eamIcSt11char_tr | ||
| 352 | ··0x0000618c·61697473·49634553·61496345·45443145·aitsIcESaIcEED1E | ||
| 353 | ··0x0000619c·76005f5a·4e537431·34626173·69635f6f·v._ZNSt14basic_o | ||
| 354 | ··0x0000 | 305 | ··0x00005e9c·696e6773·74726561·6d496353·74313163·ingstreamIcSt11c |
| 355 | ··0x000061bc·725f7472·61697473·49634545·44314576·r_traitsIcEED1Ev | ||
| 356 | ··0x000061cc·005f5a4e·53743869·6f735f62·61736534·._ZNSt8ios_base4 | ||
| 357 | ··0x0000 | 306 | ··0x00005eac·6861725f·74726169·74734963·45536149·har_traitsIcESaI |
| 307 | ··0x00005ebc·63454544·31457600·5f5a5374·37676574·cEED1Ev._ZSt7get | ||
| 308 | ··0x00005ecc·6c696e65·49635374·31316368·61725f74·lineIcSt11char_t | ||
| 309 | ··0x00005edc·72616974·73496345·53614963·45455253·raitsIcESaIcEERS | ||
| 310 | ··0x00005eec·74313362·61736963·5f697374·7265616d·t13basic_istream | ||
| 311 | ··0x00005efc·49545f54·305f4553·375f524e·5374375f·IT_T0_ES7_RNSt7_ | ||
| 358 | ··0x0000 | 312 | ··0x00005f0c·5f637878·31313132·62617369·635f7374·_cxx1112basic_st |
| 313 | ··0x00005f1c·72696e67·4953345f·53355f54·315f4545·ringIS4_S5_T1_EE | ||
| Max diff block lines reached; 388658/401280 bytes (96.85%) of diff not shown. | |||
| Offset 3, 16 lines modified | Offset 3, 16 lines modified | ||
| 3 | Disassembly·of·section·.init: | 3 | Disassembly·of·section·.init: |
| 4 | 00013000·<.init>: | 4 | 00013000·<.init>: |
| 5 | _init(): | 5 | _init(): |
| 6 | » push···%ebx | 6 | » push···%ebx |
| 7 | » sub····$0x8,%esp | 7 | » sub····$0x8,%esp |
| 8 | » call···194 | 8 | » call···19460·<_start@@Base+0x30> |
| 9 | » add····$0x8 | 9 | » add····$0x88feb,%ebx |
| 10 | » mov····-0x18(%ebx),%eax | 10 | » mov····-0x18(%ebx),%eax |
| 11 | » test···%eax,%eax | 11 | » test···%eax,%eax |
| 12 | » je·····1301b·<__printf_chk@plt-0x15> | 12 | » je·····1301b·<__printf_chk@plt-0x15> |
| 13 | » call···*%eax | 13 | » call···*%eax |
| 14 | » add····$0x8,%esp | 14 | » add····$0x8,%esp |
| 15 | » pop····%ebx | 15 | » pop····%ebx |
| 16 | » ret | 16 | » ret |
| Offset 130, 290 lines modified | Offset 130, 290 lines modified | ||
| 130 | » jmp····13020·<__printf_chk@plt-0x10> | 130 | » jmp····13020·<__printf_chk@plt-0x10> |
| 131 | 000131b0·<strdup@plt>: | 131 | 000131b0·<strdup@plt>: |
| 132 | » jmp····*0x6c(%ebx) | 132 | » jmp····*0x6c(%ebx) |
| 133 | » push···$0xc0 | 133 | » push···$0xc0 |
| 134 | » jmp····13020·<__printf_chk@plt-0x10> | 134 | » jmp····13020·<__printf_chk@plt-0x10> |
| 135 | 000131c0·<std::__thr | 135 | 000131c0·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::substr(unsigned·int,·unsigned·int)·const@plt>: |
| 136 | » jmp····*0x70(%ebx) | 136 | » jmp····*0x70(%ebx) |
| 137 | » push···$0xc8 | 137 | » push···$0xc8 |
| 138 | » jmp····13020·<__printf_chk@plt-0x10> | 138 | » jmp····13020·<__printf_chk@plt-0x10> |
| 139 | 000131d0·< | 139 | 000131d0·<std::__throw_bad_alloc()@plt>: |
| 140 | » jmp····*0x74(%ebx) | 140 | » jmp····*0x74(%ebx) |
| 141 | » push···$0xd0 | 141 | » push···$0xd0 |
| 142 | » jmp····13020·<__printf_chk@plt-0x10> | 142 | » jmp····13020·<__printf_chk@plt-0x10> |
| 143 | 000131e0·< | 143 | 000131e0·<Json::Value::operator[](char·const*)@plt>: |
| 144 | » jmp····*0x78(%ebx) | 144 | » jmp····*0x78(%ebx) |
| 145 | » push···$0xd8 | 145 | » push···$0xd8 |
| 146 | » jmp····13020·<__printf_chk@plt-0x10> | 146 | » jmp····13020·<__printf_chk@plt-0x10> |
| 147 | 000131f0·< | 147 | 000131f0·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_replace(unsigned·int,·unsigned·int,·char·const*,·unsigned·int)@plt>: |
| 148 | » jmp····*0x7c(%ebx) | 148 | » jmp····*0x7c(%ebx) |
| 149 | » push···$0xe0 | 149 | » push···$0xe0 |
| 150 | » jmp····13020·<__printf_chk@plt-0x10> | 150 | » jmp····13020·<__printf_chk@plt-0x10> |
| 151 | 00013200·< | 151 | 00013200·<fseeko@plt>: |
| 152 | » jmp····*0x80(%ebx) | 152 | » jmp····*0x80(%ebx) |
| 153 | » push···$0xe8 | 153 | » push···$0xe8 |
| 154 | » jmp····13020·<__printf_chk@plt-0x10> | 154 | » jmp····13020·<__printf_chk@plt-0x10> |
| 155 | 00013210·< | 155 | 00013210·<__cxa_begin_catch@plt>: |
| 156 | » jmp····*0x84(%ebx) | 156 | » jmp····*0x84(%ebx) |
| 157 | » push···$0xf0 | 157 | » push···$0xf0 |
| 158 | » jmp····13020·<__printf_chk@plt-0x10> | 158 | » jmp····13020·<__printf_chk@plt-0x10> |
| 159 | 00013220·<calloc@plt>: | 159 | 00013220·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::reserve(unsigned·int)@plt>: |
| 160 | » jmp····*0x88(%ebx) | 160 | » jmp····*0x88(%ebx) |
| 161 | » push···$0xf8 | 161 | » push···$0xf8 |
| 162 | » jmp····13020·<__printf_chk@plt-0x10> | 162 | » jmp····13020·<__printf_chk@plt-0x10> |
| 163 | 00013230·< | 163 | 00013230·<calloc@plt>: |
| 164 | » jmp····*0x8c(%ebx) | 164 | » jmp····*0x8c(%ebx) |
| 165 | » push···$0x100 | 165 | » push···$0x100 |
| 166 | » jmp····13020·<__printf_chk@plt-0x10> | 166 | » jmp····13020·<__printf_chk@plt-0x10> |
| 167 | 00013240·< | 167 | 00013240·<Json::Value::Value(Json::ValueType)@plt>: |
| 168 | » jmp····*0x90(%ebx) | 168 | » jmp····*0x90(%ebx) |
| 169 | » push···$0x108 | 169 | » push···$0x108 |
| 170 | » jmp····13020·<__printf_chk@plt-0x10> | 170 | » jmp····13020·<__printf_chk@plt-0x10> |
| 171 | 00013250·<std::__cxx11::basic_ | 171 | 00013250·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::basic_string(std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&)@plt>: |
| 172 | » jmp····*0x94(%ebx) | 172 | » jmp····*0x94(%ebx) |
| 173 | » push···$0x110 | 173 | » push···$0x110 |
| 174 | » jmp····13020·<__printf_chk@plt-0x10> | 174 | » jmp····13020·<__printf_chk@plt-0x10> |
| 175 | 00013260·<de | 175 | 00013260·<std::__cxx11::basic_istringstream<char,·std::char_traits<char>,·std::allocator<char>·>::~basic_istringstream()@plt>: |
| 176 | » jmp····*0x98(%ebx) | 176 | » jmp····*0x98(%ebx) |
| 177 | » push···$0x118 | 177 | » push···$0x118 |
| 178 | » jmp····13020·<__printf_chk@plt-0x10> | 178 | » jmp····13020·<__printf_chk@plt-0x10> |
| 179 | 00013270·< | 179 | 00013270·<deflate@plt>: |
| 180 | » jmp····*0x9c(%ebx) | 180 | » jmp····*0x9c(%ebx) |
| 181 | » push···$0x120 | 181 | » push···$0x120 |
| 182 | » jmp····13020·<__printf_chk@plt-0x10> | 182 | » jmp····13020·<__printf_chk@plt-0x10> |
| 183 | 00013280·< | 183 | 00013280·<CSmithWatermanGotoh::~CSmithWatermanGotoh()@plt>: |
| 184 | » jmp····*0xa0(%ebx) | 184 | » jmp····*0xa0(%ebx) |
| 185 | » push···$0x128 | 185 | » push···$0x128 |
| 186 | » jmp····13020·<__printf_chk@plt-0x10> | 186 | » jmp····13020·<__printf_chk@plt-0x10> |
| 187 | 00013290·<__c | 187 | 00013290·<std::basic_ostream<char,·std::char_traits<char>·>&·std::endl<char,·std::char_traits<char>·>(std::basic_ostream<char,·std::char_traits<char>·>&)@plt>: |
| 188 | » jmp····*0xa4(%ebx) | 188 | » jmp····*0xa4(%ebx) |
| 189 | » push···$0x130 | 189 | » push···$0x130 |
| 190 | » jmp····13020·<__printf_chk@plt-0x10> | 190 | » jmp····13020·<__printf_chk@plt-0x10> |
| 191 | 000132a0·< | 191 | 000132a0·<__cxa_allocate_exception@plt>: |
| 192 | » jmp····*0xa8(%ebx) | 192 | » jmp····*0xa8(%ebx) |
| 193 | » push···$0x138 | 193 | » push···$0x138 |
| 194 | » jmp····13020·<__printf_chk@plt-0x10> | 194 | » jmp····13020·<__printf_chk@plt-0x10> |
| 195 | 000132b0·< | 195 | 000132b0·<std::overflow_error::~overflow_error()@plt>: |
| 196 | » jmp····*0xac(%ebx) | 196 | » jmp····*0xac(%ebx) |
| 197 | » push···$0x140 | 197 | » push···$0x140 |
| 198 | » jmp····13020·<__printf_chk@plt-0x10> | 198 | » jmp····13020·<__printf_chk@plt-0x10> |
| 199 | 000132c0·< | 199 | 000132c0·<isspace@plt>: |
| 200 | » jmp····*0xb0(%ebx) | 200 | » jmp····*0xb0(%ebx) |
| 201 | » push···$0x148 | 201 | » push···$0x148 |
| 202 | » jmp····13020·<__printf_chk@plt-0x10> | 202 | » jmp····13020·<__printf_chk@plt-0x10> |
| 203 | 000132d0·<f | 203 | 000132d0·<fputc@plt>: |
| 204 | » jmp····*0xb4(%ebx) | 204 | » jmp····*0xb4(%ebx) |
| 205 | » push···$0x150 | 205 | » push···$0x150 |
| 206 | » jmp····13020·<__printf_chk@plt-0x10> | 206 | » jmp····13020·<__printf_chk@plt-0x10> |
| 207 | 000132e0·< | 207 | 000132e0·<fgets@plt>: |
| 208 | » jmp····*0xb8(%ebx) | 208 | » jmp····*0xb8(%ebx) |
| 209 | » push···$0x158 | 209 | » push···$0x158 |
| 210 | » jmp····13020·<__printf_chk@plt-0x10> | 210 | » jmp····13020·<__printf_chk@plt-0x10> |
| 211 | 000132f0·< | 211 | 000132f0·<Json::Value::~Value()@plt>: |
| 212 | » jmp····*0xbc(%ebx) | 212 | » jmp····*0xbc(%ebx) |
| 213 | » push···$0x160 | 213 | » push···$0x160 |
| 214 | » jmp····13020·<__printf_chk@plt-0x10> | 214 | » jmp····13020·<__printf_chk@plt-0x10> |
| 215 | 00013300·< | 215 | 00013300·<std::ostream&·std::ostream::_M_insert<long·double>(long·double)@plt>: |
| 216 | » jmp····*0xc0(%ebx) | 216 | » jmp····*0xc0(%ebx) |
| 217 | » push···$0x168 | 217 | » push···$0x168 |
| 218 | » jmp····13020·<__printf_chk@plt-0x10> | 218 | » jmp····13020·<__printf_chk@plt-0x10> |
| 219 | 00013310·< | 219 | 00013310·<fwrite@plt>: |
| 220 | » jmp····*0xc4(%ebx) | 220 | » jmp····*0xc4(%ebx) |
| 221 | » push···$0x170 | 221 | » push···$0x170 |
| 222 | » jmp····13020·<__printf_chk@plt-0x10> | 222 | » jmp····13020·<__printf_chk@plt-0x10> |
| 223 | 00013320·< | 223 | 00013320·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_replace_aux(unsigned·int,·unsigned·int,·unsigned·int,·char)@plt>: |
| 224 | » jmp····*0xc8(%ebx) | 224 | » jmp····*0xc8(%ebx) |
| 225 | » push···$0x178 | 225 | » push···$0x178 |
| 226 | » jmp····13020·<__printf_chk@plt-0x10> | 226 | » jmp····13020·<__printf_chk@plt-0x10> |
| 227 | 00013330·< | 227 | 00013330·<memcpy@plt>: |
| 228 | » jmp····*0xcc(%ebx) | 228 | » jmp····*0xcc(%ebx) |
| 229 | » push···$0x180 | 229 | » push···$0x180 |
| 230 | » jmp····13020·<__printf_chk@plt-0x10> | 230 | » jmp····13020·<__printf_chk@plt-0x10> |
| Max diff block lines reached; 6888/12405 bytes (55.53%) of diff not shown. | |||
| Offset 1, 13 lines modified | Offset 1, 13 lines modified | ||
| 1 | Disassembly·of·section·.text: | 1 | Disassembly·of·section·.text: |
| 2 | 00013c30·<boost::wrapexcept<std:: | 2 | 00013c30·<boost::wrapexcept<std::overflow_error>::rethrow()·const@@Base-0x11c8>: |
| 3 | TVCUtilsHelp()·[clone·.cold]: | 3 | TVCUtilsHelp()·[clone·.cold]: |
| 4 | /usr/include/c++/12/bits/basic_string.h:795 | 4 | /usr/include/c++/12/bits/basic_string.h:795 |
| 5 | » sub····$0xc,%esp | 5 | » sub····$0xc,%esp |
| 6 | » push···-0x74(%ebp) | 6 | » push···-0x74(%ebp) |
| 7 | » mov····%esi,%ebx | 7 | » mov····%esi,%ebx |
| 8 | » call···13810·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> | 8 | » call···13810·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> |
| 9 | /usr/include/c++/12/bits/new_allocator.h:90 | 9 | /usr/include/c++/12/bits/new_allocator.h:90 |
| Offset 40, 21 lines modified | Offset 40, 21 lines modified | ||
| 40 | » mov····%eax,(%esp) | 40 | » mov····%eax,(%esp) |
| 41 | » call···13b00·<_Unwind_Resume@plt> | 41 | » call···13b00·<_Unwind_Resume@plt> |
| 42 | std::pair<std::_Rb_tree_iterator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·bool>·std::_Rb_tree<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::_Identity<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>::_M_insert_unique<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>(std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&)·[clone·.isra.0]·[clone·.cold]: | 42 | std::pair<std::_Rb_tree_iterator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·bool>·std::_Rb_tree<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::_Identity<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>::_M_insert_unique<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>(std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&)·[clone·.isra.0]·[clone·.cold]: |
| 43 | /usr/include/c++/12/bits/stl_tree.h:599 | 43 | /usr/include/c++/12/bits/stl_tree.h:599 |
| 44 | » sub····$0xc,%esp | 44 | » sub····$0xc,%esp |
| 45 | » push···%eax | 45 | » push···%eax |
| 46 | » mov····0x1c(%esp),%ebx | 46 | » mov····0x1c(%esp),%ebx |
| 47 | » call···132 | 47 | » call···13210·<__cxa_begin_catch@plt> |
| 48 | /usr/include/c++/12/bits/new_allocator.h:158 | 48 | /usr/include/c++/12/bits/new_allocator.h:158 |
| 49 | » pop····%eax | 49 | » pop····%eax |
| 50 | » pop····%edx | 50 | » pop····%edx |
| 51 | » push···$0x28 | 51 | » push···$0x28 |
| 52 | » push···%edi | 52 | » push···%edi |
| 53 | » call···134 | 53 | » call···13470·<operator·delete(void*,·unsigned·int)@plt> |
| 54 | /usr/include/c++/12/bits/stl_tree.h:603 | 54 | /usr/include/c++/12/bits/stl_tree.h:603 |
| 55 | » add····$0x10,%esp | 55 | » add····$0x10,%esp |
| 56 | » call···13920·<__cxa_rethrow@plt> | 56 | » call···13920·<__cxa_rethrow@plt> |
| 57 | /usr/include/c++/12/bits/stl_tree.h:599 | 57 | /usr/include/c++/12/bits/stl_tree.h:599 |
| 58 | » mov····0xc(%esp),%ebx | 58 | » mov····0xc(%esp),%ebx |
| 59 | » mov····%eax,%esi | 59 | » mov····%eax,%esi |
| 60 | » call···13a00·<__cxa_end_catch@plt> | 60 | » call···13a00·<__cxa_end_catch@plt> |
| Offset 86, 572 lines modified | Offset 86, 540 lines modified | ||
| 86 | » call···13b00·<_Unwind_Resume@plt> | 86 | » call···13b00·<_Unwind_Resume@plt> |
| 87 | std::_Rb_tree_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·>·std::_Rb_tree<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>,·std::_Select1st<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·>·>::_M_emplace_hint_unique<std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>,·std::tuple<>·>(std::_Rb_tree_const_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·>,·std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>&&,·std::tuple<>&&)·[clone·.isra.0]·[clone·.cold]: | 87 | std::_Rb_tree_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·>·std::_Rb_tree<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>,·std::_Select1st<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·>·>::_M_emplace_hint_unique<std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>,·std::tuple<>·>(std::_Rb_tree_const_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·>,·std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>&&,·std::tuple<>&&)·[clone·.isra.0]·[clone·.cold]: |
| 88 | /usr/include/c++/12/bits/new_allocator.h:90·(discriminator·3) | 88 | /usr/include/c++/12/bits/new_allocator.h:90·(discriminator·3) |
| 89 | » sub····$0xc,%esp | 89 | » sub····$0xc,%esp |
| 90 | » push···%eax | 90 | » push···%eax |
| 91 | » mov····0x18(%esp),%ebx | 91 | » mov····0x18(%esp),%ebx |
| 92 | /usr/include/c++/12/bits/stl_tree.h:599 | 92 | /usr/include/c++/12/bits/stl_tree.h:599 |
| 93 | » call···132 | 93 | » call···13210·<__cxa_begin_catch@plt> |
| 94 | /usr/include/c++/12/bits/new_allocator.h:158 | 94 | /usr/include/c++/12/bits/new_allocator.h:158 |
| 95 | » pop····%edi | 95 | » pop····%edi |
| 96 | » pop····%ebp | 96 | » pop····%ebp |
| 97 | » push···$0x40 | 97 | » push···$0x40 |
| 98 | » push···%esi | 98 | » push···%esi |
| 99 | » call···134 | 99 | » call···13470·<operator·delete(void*,·unsigned·int)@plt> |
| 100 | /usr/include/c++/12/bits/stl_tree.h:603 | 100 | /usr/include/c++/12/bits/stl_tree.h:603 |
| 101 | » add····$0x10,%esp | 101 | » add····$0x10,%esp |
| 102 | » call···13920·<__cxa_rethrow@plt> | 102 | » call···13920·<__cxa_rethrow@plt> |
| 103 | /usr/include/c++/12/bits/stl_tree.h:599 | 103 | /usr/include/c++/12/bits/stl_tree.h:599 |
| 104 | » mov····0x8(%esp),%ebx | 104 | » mov····0x8(%esp),%ebx |
| 105 | » mov····%eax,%esi | 105 | » mov····%eax,%esi |
| 106 | » call···13a00·<__cxa_end_catch@plt> | 106 | » call···13a00·<__cxa_end_catch@plt> |
| 107 | » sub····$0xc,%esp | 107 | » sub····$0xc,%esp |
| 108 | » push···%esi | 108 | » push···%esi |
| 109 | » call···13b00·<_Unwind_Resume@plt> | 109 | » call···13b00·<_Unwind_Resume@plt> |
| 110 | PrepareHotspots(int,·char·const**)·[clone·.cold]: | 110 | PrepareHotspots(int,·char·const**)·[clone·.cold]: |
| 111 | /usr/include/c++/12/bits/basic_string.h:795·(discriminator· | 111 | /usr/include/c++/12/bits/basic_string.h:795·(discriminator·5) |
| 112 | » sub····$0xc,%esp | 112 | » sub····$0xc,%esp |
| 113 | » | 113 | » push···-0x10bf0(%ebp) |
| 114 | » mov····-0x10b | 114 | » mov····-0x10bd0(%ebp),%ebx |
| 115 | » push···%eax | ||
| 116 | » call···13810·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> | 115 | » call···13810·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> |
| 117 | » lea····-0x1091c(%ebp),%eax | ||
| 118 | 116 | /usr/include/c++/12/bits/new_allocator.h:90·(discriminator·5) | |
| 117 | » add····$0x10,%esp | ||
| 118 | /usr/include/c++/12/bits/basic_string.h:795 | ||
| 119 | » sub····$0xc,%esp | ||
| 120 | » push···-0x10c18(%ebp) | ||
| 121 | » mov····-0x10bd0(%ebp),%ebx | ||
| 119 | » call···13810·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> | 122 | » call···13810·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> |
| 120 | /usr/include/c++/12/bits/new_allocator.h:90 | 123 | /usr/include/c++/12/bits/new_allocator.h:90 |
| 121 | » add····$0x10,%esp | 124 | » add····$0x10,%esp |
| 125 | ./obj-i686-linux-gnu/./VariantCaller/tvcutils/prepare_hotspots.cpp:386 | ||
| 122 | /usr/include/c++/12/bits/stl_vector.h:730 | ||
| 123 | » mov····-0x10b70(%ebp),%edi | ||
| 124 | » mov····-0x10b6c(%ebp),%ebx | ||
| 125 | /usr/include/c++/12/bits/alloc_traits.h:847 | ||
| 126 | » mov····%edi,-0x10bb4(%ebp) | ||
| 127 | /usr/include/c++/12/bits/stl_construct.h:162 | ||
| 128 | » mov····-0x10bb4(%ebp),%eax | ||
| 129 | » cmp····%eax,%ebx | ||
| 130 | » je·····13e70·<__cxa_finalize@plt+0x250> | ||
| 131 | /usr/include/c++/12/bits/stl_construct.h:151 | ||
| 132 | » sub····$0xc,%esp | 126 | » sub····$0xc,%esp |
| 133 | » push···-0x10b | 127 | » push···-0x10bf4(%ebp) |
| 128 | » call···22f10·<Allele::~Allele()@@Base> | ||
| 134 | » call···25ea0·<std::deque<Allele,·std::allocator<Allele>·>::~deque()@@Base> | ||
| 135 | /usr/include/c++/12/bits/stl_construct.h:162 | ||
| 136 | » addl···$0x28,-0x10bb4(%ebp) | ||
| 137 | » add····$0x10,%esp | 129 | » add····$0x10,%esp |
| 130 | ./obj-i686-linux-gnu/./VariantCaller/tvcutils/prepare_hotspots.cpp:978 | ||
| 138 | » jmp····13d51·<__cxa_finalize@plt+0x131> | ||
| 139 | /usr/include/c++/12/bits/basic_string.h:795·(discriminator·5) | ||
| 140 | » sub····$0xc,%esp | 131 | » sub····$0xc,%esp |
| 141 | » push···-0x10 | 132 | » push···-0x10c98(%ebp) |
| 142 | » mov····-0x10bb0(%ebp),%ebx | ||
| 143 | » call···13810·<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>::_M_dispose()@plt> | ||
| 144 | 133 | » call···26e10·<std::vector<std::deque<Allele,·std::allocator<Allele>·>,·std::allocator<std::deque<Allele,·std::allocator<Allele>·>·>·>::~vector()@@Base> | |
| 134 | » add····$0x10,%esp | ||
| 135 | » sub····$0xc,%esp | ||
| 136 | » push···-0x10c5c(%ebp) | ||
| 145 | » lea····-0x10b | 137 | » lea····-0x10ba0(%ebp),%edi |
| 138 | » call···232b0·<std::deque<LineStatus,·std::allocator<LineStatus>·>::~deque()@@Base> | ||
| 146 | » add····$0x10,%esp | 139 | » add····$0x10,%esp |
| 147 | » mov····%eax,-0x10bb8(%ebp) | ||
| 148 | ./obj-i686-linux-gnu/./VariantCaller/tvcutils/prepare_hotspots.cpp:165 | 140 | ./obj-i686-linux-gnu/./VariantCaller/tvcutils/prepare_hotspots.cpp:165 |
| 149 | » sub····$0xc,%esp | 141 | » sub····$0xc,%esp |
| 150 | » push··· | 142 | » push···%edi |
| 151 | » lea····-0x10b | 143 | » lea····-0x10bb0(%ebp),%edi |
| 152 | » call···2 | 144 | » call···23060·<std::vector<junction_chr,·std::allocator<junction_chr>·>::~vector()@@Base> |
| 153 | » add····$0x10,%esp | 145 | » add····$0x10,%esp |
| 154 | /usr/include/c++/12/bits/stl_tree.h:984 | 146 | /usr/include/c++/12/bits/stl_tree.h:984 |
| 155 | » mov····-0x10b | 147 | » mov····-0x10b80(%ebp),%eax |
| 156 | » call···19c | 148 | » call···19c80·<TVCUtilsHelp()@@Base+0x720> |
| 157 | ./obj-i686-linux-gnu/./VariantCaller/tvcutils/prepare_hotspots.cpp:978 | 149 | ./obj-i686-linux-gnu/./VariantCaller/tvcutils/prepare_hotspots.cpp:978 |
| 158 | » sub····$0xc,%esp | 150 | » sub····$0xc,%esp |
| 159 | » push···%edi | 151 | » push···%edi |
| 160 | » call···2 | 152 | » call···23150·<std::vector<Reference,·std::allocator<Reference>·>::~vector()@@Base> |
| 161 | » add····$0x10,%esp | 153 | » add····$0x10,%esp |
| 162 | /usr/include/c++/12/bits/basic_string.h:795 | 154 | /usr/include/c++/12/bits/basic_string.h:795 |
| 163 | » sub····$0xc,%esp | 155 | » sub····$0xc,%esp |
| 164 | » push···-0x10c | 156 | » push···-0x10c88(%ebp) |
| Max diff block lines reached; 12923638/12933593 bytes (99.92%) of diff not shown. | |||
| Offset 1, 14 lines modified | Offset 1, 14 lines modified | ||
| 1 | Disassembly·of·section·.fini: | 1 | Disassembly·of·section·.fini: |
| 2 | 000 | 2 | 0007e5c4·<.fini>: |
| 3 | _fini(): | 3 | _fini(): |
| 4 | » push···%ebx | 4 | » push···%ebx |
| 5 | » sub····$0x8,%esp | 5 | » sub····$0x8,%esp |
| 6 | » call···194 | 6 | » call···19460·<_start@@Base+0x30> |
| 7 | » add····$0x1d | 7 | » add····$0x1da27,%ebx |
| 8 | » add····$0x8,%esp | 8 | » add····$0x8,%esp |
| 9 | » pop····%ebx | 9 | » pop····%ebx |
| 10 | » ret | 10 | » ret |
| Offset 1, 1292 lines modified | Offset 1, 1290 lines modified | ||
| 1 | Hex·dump·of·section·'.rodata': | 1 | Hex·dump·of·section·'.rodata': |
| 2 | ··0x000 | 2 | ··0x0007f000·03000000·01000200·74766375·74696c73·........tvcutils |
| 3 | ··0x000 | 3 | ··0x0007f010·2025732d·25732028·25732920·2d204d69··%s-%s·(%s)·-·Mi |
| 4 | ··0x000 | 4 | ··0x0007f020·7363656c·6c616e65·6f757320·746f6f6c·scellaneous·tool |
| 5 | ··0x000 | 5 | ··0x0007f030·73207573·65642062·7920546f·7272656e·s·used·by·Torren |
| 6 | ··0x000 | 6 | ··0x0007f040·74205661·7269616e·74204361·6c6c6572·t·Variant·Caller |
| 7 | ··0x000 | 7 | ··0x0007f050·20706c75·67696e20·616e6420·776f726b··plugin·and·work |
| 8 | ··0x000 | 8 | ··0x0007f060·666c6f77·2e0a0000·55736167·653a2020·flow....Usage:·· |
| 9 | ··0x000 | 9 | ··0x0007f070·20747663·7574696c·73203c63·6f6d6d61··tvcutils·<comma |
| 10 | ··0x000 | 10 | ··0x0007f080·6e643e20·5b6f7074·696f6e73·5d000000·nd>·[options]... |
| 11 | ··0x000 | 11 | ··0x0007f090·20202020·20202020·20707265·70617265··········prepare |
| 12 | ··0x000 | 12 | ··0x0007f0a0·5f686f74·73706f74·73202043·6f6e7665·_hotspots··Conve |
| 13 | ··0x000 | 13 | ··0x0007f0b0·72742042·4544206f·72205643·46206669·rt·BED·or·VCF·fi |
| 14 | ··0x000 | 14 | ··0x0007f0c0·6c652069·6e746f20·61207661·6c696420·le·into·a·valid· |
| 15 | ··0x000 | 15 | ··0x0007f0d0·686f7473·706f7420·66696c65·00000000·hotspot·file.... |
| 16 | ··0x000 | 16 | ··0x0007f0e0·20202020·20202020·2076616c·69646174··········validat |
| 17 | ··0x000 | 17 | ··0x0007f0f0·655f6265·64202020·20202056·616c6964·e_bed······Valid |
| 18 | ··0x000 | 18 | ··0x0007f100·61746520·74617267·65747320·6f722068·ate·targets·or·h |
| 19 | ··0x000 | 19 | ··0x0007f110·6f747370·6f747320·66696c65·00000000·otspots·file.... |
| 20 | ··0x000 | 20 | ··0x0007f120·20202020·20202020·20756e69·66795f76··········unify_v |
| 21 | ··0x000 | 21 | ··0x0007f130·63662020·20202020·20202055·6e696679·cf·········Unify |
| 22 | ··0x000 | 22 | ··0x0007f140·20766172·69616e74·7320616e·6420616e··variants·and·an |
| 23 | ··0x000 | 23 | ··0x0007f150·6e6f7461·74696f6e·73206672·6f6d2061·notations·from·a |
| 24 | ··0x000 | 24 | ··0x0007f160·6c6c2073·6f757263·65732028·7476632c·ll·sources·(tvc, |
| 25 | ··0x000 | 25 | ··0x0007f170·496e6465·6c417373·656d626c·792c686f·IndelAssembly,ho |
| 26 | ··0x000 | 26 | ··0x0007f180·74706f74·73290000·62617369·635f7374·tpots)..basic_st |
| 27 | ··0x000 | 27 | ··0x0007f190·72696e67·3a20636f·6e737472·75637469·ring:·constructi |
| 28 | ··0x000 | 28 | ··0x0007f1a0·6f6e2066·726f6d20·6e756c6c·20697320·on·from·null·is· |
| 29 | ··0x000 | 29 | ··0x0007f1b0·6e6f7420·76616c69·64000000·4552524f·not·valid...ERRO |
| 30 | ··0x000 | 30 | ··0x0007f1c0·523a2075·6e726563·6f676e69·7a656420·R:·unrecognized· |
| 31 | ··0x000 | 31 | ··0x0007f1d0·74766375·74696c73·20636f6d·6d616e64·tvcutils·command |
| 32 | ··0x000 | 32 | ··0x0007f1e0·20272573·270a0043·6f6d6d61·6e64733a··'%s'..Commands: |
| 33 | ··0x000 | 33 | ··0x0007f1f0·00707265·70617265·5f686f74·73706f74·.prepare_hotspot |
| 34 | ··0x000 | 34 | ··0x0007f200·73007661·6c696461·74655f62·65640075·s.validate_bed.u |
| 35 | ··0x000 | 35 | ··0x0007f210·6e696679·5f766366·00000000·55736167·nify_vcf....Usag |
| 36 | ··0x000 | 36 | ··0x0007f220·653a2020·20747663·7574696c·73207072·e:···tvcutils·pr |
| 37 | ··0x000 | 37 | ··0x0007f230·65706172·655f686f·7473706f·7473205b·epare_hotspots·[ |
| 38 | ··0x000 | 38 | ··0x0007f240·6f707469·6f6e735d·00000000·20202d62·options]....··-b |
| 39 | ··0x000 | 39 | ··0x0007f250·2c2d2d69·6e707574·2d626564·20202020·,--input-bed···· |
| 40 | ··0x000 | 40 | ··0x0007f260·20202020·20202020·20202020·2046494c··············FIL |
| 41 | ··0x000 | 41 | ··0x0007f270·45202020·20202020·696e7075·74206973·E·······input·is |
| 42 | ··0x000 | 42 | ··0x0007f280·20612068·6f747370·6f747320·42454420··a·hotspots·BED· |
| 43 | ··0x000 | 43 | ··0x0007f290·66696c65·20286569·74686572·202d6220·file·(either·-b· |
| 44 | ··0x000 | 44 | ··0x0007f2a0·6f72202d·76207265·71756972·65642900·or·-v·required). |
| 45 | ··0x000 | 45 | ··0x0007f2b0·20202d76·2c2d2d69·6e707574·2d766366···-v,--input-vcf |
| 46 | ··0x000 | 46 | ··0x0007f2c0·20202020·20202020·20202020·20202020················· |
| 47 | ··0x000 | 47 | ··0x0007f2d0·2046494c·45202020·20202020·696e7075··FILE·······inpu |
| 48 | ··0x000 | 48 | ··0x0007f2e0·74206973·20612068·6f747370·6f747320·t·is·a·hotspots· |
| 49 | ··0x000 | 49 | ··0x0007f2f0·56434620·66696c65·20286569·74686572·VCF·file·(either |
| 50 | ··0x000 | 50 | ··0x0007f300·202d6220·6f72202d·76207265·71756972··-b·or·-v·requir |
| 51 | ··0x000 | 51 | ··0x0007f310·65642900·20202d64·2c2d2d6f·75747075·ed).··-d,--outpu |
| 52 | ··0x000 | 52 | ··0x0007f320·742d6265·64202020·20202020·20202020·t-bed··········· |
| 53 | ··0x000 | 53 | ··0x0007f330·20202020·2046494c·45202020·20202020······FILE······· |
| 54 | ··0x000 | 54 | ··0x0007f340·6f757470·7574206c·6566742d·616c6967·output·left-alig |
| 55 | ··0x000 | 55 | ··0x0007f350·6e656420·686f7473·706f7473·20696e20·ned·hotspots·in· |
| 56 | ··0x000 | 56 | ··0x0007f360·42454420·666f726d·6174205b·6e6f6e65·BED·format·[none |
| 57 | ··0x000 | 57 | ··0x0007f370·5d000000·20202d6f·2c2d2d6f·75747075·]...··-o,--outpu |
| 58 | ··0x000 | 58 | ··0x0007f380·742d7663·66202020·20202020·20202020·t-vcf··········· |
| 59 | ··0x0007f390·20202020·2046494c·45202020·20202020······FILE······· | ||
| 60 | ··0x0007f3a0·6f757470·75742069·73206120·686f7473·output·is·a·hots | ||
| 61 | ··0x0007f3b0·706f7473·20564346·2066696c·652e2054·pots·VCF·file.·T | ||
| 62 | ··0x0007f3c0·6f206265·20757365·64206173·20696e70·o·be·used·as·inp | ||
| 63 | ··0x0007f3d0·75742074·6f202d2d·686f7473·706f742d·ut·to·--hotspot- | ||
| 64 | ··0x0007f3e0·76636620·61726775·6d656e74·206f6620·vcf·argument·of· | ||
| 65 | ··0x0007f3f0·76617269·616e745f·63616c6c·65725f70·variant_caller_p | ||
| 66 | ··0x0007f400·6970656c·696e652e·70792028·7265636f·ipeline.py·(reco | ||
| 67 | ··0x0007f410·6d6d656e·64656429·205b6e6f·6e655d00·mmended)·[none]. | ||
| 68 | ··0x0007f420·20202d72·2c2d2d72·65666572·656e6365···-r,--reference | ||
| 69 | ··0x0007f430·20202020·20202020·20202020·20202020················· | ||
| 70 | ··0x0007f440·2046494c·45202020·20202020·46415354··FILE·······FAST | ||
| 71 | ··0x0007f450·41206669·6c652063·6f6e7461·696e696e·A·file·containin | ||
| 72 | ··0x0007f460·67207265·66657265·6e636520·67656e6f·g·reference·geno | ||
| 73 | ··0x0007f470·6d652028·72657175·69726564·29000000·me·(required)... | ||
| 74 | ··0x0007f480·20202d61·2c2d2d6c·6566742d·616c6967···-a,--left-alig | ||
| 75 | ··0x0007f490·6e6d656e·74202020·20202020·20202020·nment··········· | ||
| 76 | ··0x0007f4a0·206f6e2f·6f666620·20202020·70657266··on/off·····perf | ||
| 77 | ··0x0007f4b0·6f726d20·6c656674·2d616c69·676e6d65·orm·left-alignme | ||
| 78 | ··0x0007f4c0·6e74206f·6620696e·64656c73·205b6f66·nt·of·indels·[of | ||
| 79 | ··0x0007f4d0·665d0000·20202d73·2c2d2d61·6c6c6f77·f]..··-s,--allow | ||
| 80 | ··0x0007f4e0·2d626c6f·636b2d73·75627374·69747574·-block-substitut | ||
| 81 | ··0x0007f4f0·696f6e73·206f6e2f·6f666620·20202020·ions·on/off····· | ||
| 82 | ··0x0007f500·646f206e·6f742066·696c7465·72206f75·do·not·filter·ou | ||
| 83 | ··0x0007f510·7420626c·6f636b20·73756273·74697475·t·block·substitu | ||
| 84 | ··0x0007f520·74696f6e·20686f74·73706f74·73205b6f·tion·hotspots·[o | ||
| 85 | ··0x0007f530·6e5d0000·20202d75·2c2d2d75·6e6d6572·n]..··-u,--unmer | ||
| 86 | ··0x0007f540·6765642d·62656420·20202020·20202020·ged-bed········· | ||
| 87 | ··0x0007f550·20202020·2046494c·45202020·20202020······FILE······· | ||
| 88 | ··0x0007f560·696e7075·74206120·74617267·65742062·input·a·target·b | ||
| 89 | ··0x0007f570·65642066·696c6520·746f2066·696c7465·ed·file·to·filte | ||
| 90 | ··0x0007f580·72206f75·7420686f·7473706f·74732074·r·out·hotspots·t | ||
| 91 | ··0x0007f590·68617420·636f6e74·61696e20·61206a75·hat·contain·a·ju | ||
| 92 | ··0x0007f5a0·6e637469·6f6e206f·66203220·616d706c·nction·of·2·ampl | ||
| 93 | ··0x0007f5b0·69636f6e·7320286f·7074696f·6e616c29·icons·(optional) | ||
| 94 | ··0x0007f5c0·00000000·756e6d65·72676564·20626564·....unmerged·bed | ||
| 95 | ··0x0007f5d0·2066696c·65206e6f·7420696e·206f7264··file·not·in·ord | ||
| 96 | ··0x0007f5e0·65720a00·4d616c66·6f726d65·6420686f·er..Malformed·ho | ||
| 97 | ··0x0007f5f0·7473706f·74204245·44206c69·6e653a20·tspot·BED·line:· | ||
| 98 | ··0x0007f600·6c696e65·206c656e·67746820·65786365·line·length·exce | ||
| 99 | ··0x0007f610·65647320·36344b00·4d616c66·6f726d65·eds·64K.Malforme | ||
| 100 | ··0x0007f620·6420686f·7473706f·74204245·44206c69·d·hotspot·BED·li | ||
| 101 | ··0x0007f630·6e653a20·65787065·63746564·20617420·ne:·expected·at· | ||
| 102 | ··0x0007f640·6c656173·74203620·6669656c·64730000·least·6·fields.. | ||
| 103 | ··0x0007f650·4d616c66·6f726d65·6420686f·7473706f·Malformed·hotspo | ||
| 104 | ··0x0007f660·74204245·44206c69·6e653a20·52454620·t·BED·line:·REF· | ||
| 105 | ··0x0007f670·616e6420·4f425320·6669656c·64732072·and·OBS·fields·r | ||
| 106 | ··0x0007f680·65717569·72656420·696e2070·656e756c·equired·in·penul | ||
| 107 | ··0x0007f690·74696d61·74652063·6f6c756d·6e000000·timate·column... | ||
| 108 | ··0x0007f6a0·686f7473·706f7420·42454420·6c696e65·hotspot·BED·line | ||
| 109 | ··0x0007f6b0·20636f6e·7461696e·20746865·20636f6d··contain·the·com | ||
| 110 | ··0x0007f6c0·706c6574·65206f76·65726c61·7070696e·plete·overlappin | ||
| 111 | ··0x0007f6d0·67207265·67696f6e·206f6620·74776f20·g·region·of·two· | ||
| 112 | ··0x0007f6e0·616d706c·69636f6e·2c207468·65207661·amplicon,·the·va | ||
| 113 | ··0x0007f6f0·7269616e·74206361·6e6e6f74·20626520·riant·cannot·be· | ||
| 114 | ··0x0007f700·64657465·63746564·20627920·74766300·detected·by·tvc. | ||
| 115 | ··0x0007f710·4d616c66·6f726d65·6420686f·7473706f·Malformed·hotspo | ||
| 116 | ··0x0007f720·74205643·46206c69·6e653a20·6c696e65·t·VCF·line:·line | ||
| 117 | ··0x0007f730·206c656e·67746820·65786365·65647320··length·exceeds· | ||
| 118 | ··0x0007f740·36344b00·2323616c·6c6f7742·6c6f636b·64K.##allowBlock | ||
| 119 | ··0x0007f750·53756273·74697475·74696f6e·733d7472·Substitutions=tr | ||
| 120 | ··0x0007f760·75650000·4d616c66·6f726d65·6420686f·ue..Malformed·ho | ||
| 121 | ··0x0007f770·7473706f·74205643·46206c69·6e653a20·tspot·VCF·line:· | ||
| 122 | ··0x0007f780·65787065·63746564·20617420·6c656173·expected·at·leas | ||
| 123 | ··0x0007f790·74203520·6669656c·64730000·4552524f·t·5·fields..ERRO | ||
| 124 | ··0x0007f7a0·523a2043·616e6e6f·74206f70·656e2025·R:·Cannot·open·% | ||
| 125 | ··0x0007f7b0·7320666f·72207772·6974696e·670a0000·s·for·writing... | ||
| 126 | ··0x0007f7c0·2323616c·6c6f7742·6c6f636b·53756273·##allowBlockSubs | ||
| Max diff block lines reached; 130510/172575 bytes (75.63%) of diff not shown. | |||
| Offset 1, 411 lines modified | Offset 1, 408 lines modified | ||
| Diff chunk too large, falling back to line-by-line diff (405 lines added, 408 lines removed) | |||
| 1 | Hex·dump·of·section·'.eh_frame_hdr': | 1 | Hex·dump·of·section·'.eh_frame_hdr': |
| 2 | ··0x0008 | 2 | ··0x0008406c·011b033b·48190000·28030000·b4eff8ff·...;H...(....... |
| 3 | ··0x0008 | 3 | ··0x0008407c·90190000·b4fbf8ff·b4190000·c4fbf8ff·................ |
| 4 | ··0x0008 | 4 | ··0x0008408c·241a0000·f9fbf8ff·941a0000·12fcf8ff·$............... |
| 5 | ··0x0008 | 5 | ··0x0008409c·9c220000·45fcf8ff·50230000·7afcf8ff·."..E...P#..z... |
| 6 | ··0x0008 | 6 | ··0x000840ac·00370000·adfcf8ff·a0470000·7203f9ff·.7.......G..r... |
| 7 | ··0x0008 | 7 | ··0x000840bc·144f0000·9603f9ff·d44f0000·ba03f9ff·.O.......O...... |
| 8 | ··0x0008 | 8 | ··0x000840cc·fc510000·ef03f9ff·64520000·0404f9ff·.Q......dR...... |
| 9 | ··0x0008 | 9 | ··0x000840dc·cc5b0000·3704f9ff·b45e0000·a305f9ff·.[..7....^...... |
| 10 | ··0x0008 | 10 | ··0x000840ec·cc600000·b805f9ff·50610000·1506f9ff·.`......Pa...... |
| 11 | ··0x0008 | 11 | ··0x000840fc·e4650000·5706f9ff·a4670000·5a07f9ff·.e..W....g..Z... |
| 12 | ··0x0008 | 12 | ··0x0008410c·606a0000·a407f9ff·bc750000·6808f9ff·`j.......u..h... |
| 13 | ··0x0008 | 13 | ··0x0008411c·807a0000·af08f9ff·28800000·8c0df9ff·.z......(....... |
| 14 | ··0x0008 | 14 | ··0x0008412c·90830000·7a0ef9ff·bc830000·680ff9ff·....z.......h... |
| 15 | ··0x0008 | 15 | ··0x0008413c·e8830000·5c10f9ff·14840000·5011f9ff·....\.......P... |
| 16 | ··0x0008 | 16 | ··0x0008414c·48910000·8511f9ff·80920000·ea11f9ff·H............... |
| 17 | ··0x0008 | 17 | ··0x0008415c·a4940000·3213f9ff·00950000·5a13f9ff·....2.......Z... |
| 18 | ··0x0008 | 18 | ··0x0008416c·5c950000·8813f9ff·dc990000·0e14f9ff·\............... |
| 19 | ··0x0008 | 19 | ··0x0008417c·389a0000·9e14f9ff·949a0000·d015f9ff·8............... |
| 20 | ··0x0008 | 20 | ··0x0008418c·fc9a0000·e415f9ff·749f0000·1816f9ff·........t....... |
| 21 | ··0x0008 | 21 | ··0x0008419c·60a10000·4c16f9ff·c0a30000·7216f9ff·`...L.......r... |
| 22 | ··0x0008 | 22 | ··0x000841ac·38a40000·b016f9ff·c4a40000·3c17f9ff·8...........<... |
| 23 | ··0x0008 | 23 | ··0x000841bc·1ca50000·5217f9ff·90a60000·8517f9ff·....R........... |
| 24 | ··0x0008 | 24 | ··0x000841cc·b4a70000·d317f9ff·18a80000·1018f9ff·................ |
| 25 | ··0x0008 | 25 | ··0x000841dc·fca80000·4418f9ff·30aa0000·d21bf9ff·....D...0....... |
| 26 | ··0x0008 | 26 | ··0x000841ec·f0aa0000·4c1cf9ff·4cab0000·901cf9ff·....L...L....... |
| 27 | ··0x0008 | 27 | ··0x000841fc·b8ab0000·f21cf9ff·34ac0000·421df9ff·........4...B... |
| 28 | ··0x0008 | 28 | ··0x0008420c·f0ac0000·a21ef9ff·48ad0000·ba1ef9ff·........H....... |
| 29 | ··0x0008 | 29 | ··0x0008421c·ecae0000·f61ef9ff·90af0000·9a1ff9ff·................ |
| 30 | ··0x0008 | 30 | ··0x0008422c·f0af0000·b01ff9ff·e8b80000·bf20f9ff·.............·.. |
| 31 | ··0x0008 | 31 | ··0x0008423c·a4bb0000·f929f9ff·18b40000·7e2af9ff·.....)......~*.. |
| 32 | ··0x0008 | 32 | ··0x0008424c·98b50000·042bf9ff·a4bd0000·6c2bf9ff·.....+......l+.. |
| 33 | ··0x0008 | 33 | ··0x0008425c·80be0000·b22bf9ff·88c10000·722df9ff·.....+......r-.. |
| 34 | ··0x0008 | 34 | ··0x0008426c·98c30000·2a2ef9ff·80c50000·dc2ef9ff·....*........... |
| 35 | ··0x0008 | 35 | ··0x0008427c·a4c70000·2a2ff9ff·54ca0000·ea2ff9ff·....*/..T..../.. |
| 36 | ··0x0008 | 36 | ··0x0008428c·b4ca0000·3830f9ff·9ccb0000·9430f9ff·....80.......0.. |
| 37 | ··0x0008 | 37 | ··0x0008429c·88cc0000·da30f9ff·00cd0000·8831f9ff·.....0.......1.. |
| 38 | ··0x0008 | 38 | ··0x000842ac·5ccd0000·c631f9ff·c0cd0000·1a32f9ff·\....1.......2.. |
| 39 | ··0x0008 | 39 | ··0x000842bc·20ce0000·8a32f9ff·80ce0000·fe32f9ff··....2.......2.. |
| 40 | ··0x0008 | 40 | ··0x000842cc·e8ce0000·3a33f9ff·50cf0000·7633f9ff·....:3..P...v3.. |
| 41 | ··0x0008 | 41 | ··0x000842dc·bccf0000·fc33f9ff·18d00000·3a34f9ff·.....3......:4.. |
| 42 | ··0x0008 | 42 | ··0x000842ec·78d00000·ae34f9ff·d8d00000·2235f9ff·x....4......"5.. |
| 43 | ··0x0008 | 43 | ··0x000842fc·38d10000·5c35f9ff·98d10000·9635f9ff·8...\5.......5.. |
| 44 | ··0x0008 | 44 | ··0x0008430c·1cd20000·aa35f9ff·80d20000·d235f9ff·.....5.......5.. |
| 45 | ··0x0008 | 45 | ··0x0008431c·e0d20000·4e36f9ff·3cd30000·8836f9ff·....N6..<....6.. |
| 46 | ··0x0008 | 46 | ··0x0008432c·9cd30000·0437f9ff·fcd30000·3e37f9ff·.....7......>7.. |
| 47 | ··0x0008 | 47 | ··0x0008433c·80d40000·2a38f9ff·08d50000·d038f9ff·....*8.......8.. |
| 48 | ··0x0008 | 48 | ··0x0008434c·6cd50000·0c39f9ff·28dd0000·3d39f9ff·l....9..(...=9.. |
| 49 | ··0x0008 | 49 | ··0x0008435c·58e60000·d039f9ff·54e70000·063af9ff·X....9..T....:.. |
| 50 | ··0x0008 | 50 | ··0x0008436c·b4e70000·3c3af9ff·60e90000·f63af9ff·....<:..`....:.. |
| 51 | ··0x0008 | 51 | ··0x0008437c·40ea0000·0c3bf9ff·98ec0000·3a3bf9ff·@....;......:;.. |
| 52 | ··0x0008 | 52 | ··0x0008438c·f8ec0000·683bf9ff·8cee0000·883bf9ff·....h;.......;.. |
| 53 | ··0x0008 | 53 | ··0x0008439c·e8ee0000·b03bf9ff·88f10000·e73bf9ff·.....;.......;.. |
| 54 | ··0x0008 | 54 | ··0x000843ac·e0f10000·1d3cf9ff·40f20000·6c3cf9ff·.....<..@...l<.. |
| 55 | ··0x0008 | 55 | ··0x000843bc·a0f20000·b73cf9ff·7cf80000·3c3df9ff·.....<..|...<=.. |
| 56 | ··0x0008 | 56 | ··0x000843cc·60f90000·943df9ff·c0f90000·b83df9ff·`....=.......=.. |
| 57 | ··0x0008 | 57 | ··0x000843dc·64fa0000·ea3df9ff·a4fe0000·1e3ef9ff·d....=.......>.. |
| 58 | ··0x0008 | 58 | ··0x000843ec·a0ff0000·503ef9ff·e8010100·fc3ef9ff·....P>.......>.. |
| 59 | ··0x0008 | 59 | ··0x000843fc·a8050100·2e3ff9ff·1c060100·d040f9ff·.....?.......@.. |
| 60 | ··0x0008 | 60 | ··0x0008440c·84060100·0641f9ff·8c080100·e241f9ff·.....A.......A.. |
| 61 | ··0x0008 | 61 | ··0x0008441c·6c090100·1442f9ff·a80a0100·b846f9ff·l....B.......F.. |
| 62 | ··0x0008 | 62 | ··0x0008442c·380c0100·e746f9ff·280e0100·6547f9ff·8....F..(...eG.. |
| 63 | ··0x0008 | 63 | ··0x0008443c·d00e0100·8947f9ff·a40f0100·0248f9ff·.....G.......H.. |
| 64 | ··0x0008 | 64 | ··0x0008444c·fc0f0100·7c48f9ff·54100100·9a48f9ff·....|H..T....H.. |
| 65 | ··0x0008 | 65 | ··0x0008445c·ac100100·ae48f9ff·04110100·ec48f9ff·.....H.......H.. |
| 66 | ··0x0008 | 66 | ··0x0008446c·d8110100·bc49f9ff·30120100·e149f9ff·.....I..0....I.. |
| 67 | ··0x0008 | 67 | ··0x0008447c·10140100·2e4af9ff·a8140100·234bf9ff·.....J......#K.. |
| 68 | ··0x0008 | 68 | ··0x0008448c·78160100·f44bf9ff·d0160100·324cf9ff·x....K......2L.. |
| 69 | ··0x0008 | 69 | ··0x0008449c·e0170100·354ef9ff·04190100·494ef9ff·....5N......IN.. |
| 70 | ··0x0008 | 70 | ··0x000844ac·8c190100·6b4ef9ff·e8190100·904ef9ff·....kN.......N.. |
| 71 | ··0x0008 | 71 | ··0x000844bc·101b0100·b84ef9ff·bc1b0100·ce4ef9ff·.....N.......N.. |
| 72 | ··0x0008 | 72 | ··0x000844cc·d4380100·e24ef9ff·2c390100·044ff9ff·.8...N..,9...O.. |
| 73 | ··0x0008 | 73 | ··0x000844dc·441a0000·f450f9ff·c41a0000·3451f9ff·D....P......4Q.. |
| 74 | ··0x0008 | 74 | ··0x000844ec·c0470000·7451f9ff·48800000·b451f9ff·.G..tQ..H....Q.. |
| 75 | ··0x0008 | 75 | ··0x000844fc·78b70000·1452f9ff·c4bb0000·c452f9ff·x....R.......R.. |
| 76 | ··0x0008 | 76 | ··0x0008450c·b8c30000·0453f9ff·8cd50000·4453f9ff·.....S......DS.. |
| 77 | ··0x0008 | 77 | ··0x0008451c·00180100·8453f9ff·c01c0100·c453f9ff·.....S.......S.. |
| 78 | ··0x0008 | 78 | ··0x0008452c·64190000·f454f9ff·e8190000·5956f9ff·d....T......YV.. |
| 79 | ··0x0008 | 79 | ··0x0008453c·fc1a0000·6456f9ff·101b0000·f456f9ff·....dV.......V.. |
| 80 | ··0x0008 | 80 | ··0x0008454c·441b0000·a457f9ff·a01b0000·e457f9ff·D....W.......W.. |
| 81 | ··0x0008 | 81 | ··0x0008455c·e41b0000·2458f9ff·201c0000·6458f9ff·....$X..·...dX.. |
| 82 | ··0x0008 | 82 | ··0x0008456c·3c1c0000·2459f9ff·8c1c0000·d459f9ff·<...$Y.......Y.. |
| 83 | ··0x0008 | 83 | ··0x0008457c·e81c0000·b45af9ff·541d0000·345bf9ff·.....Z..T...4[.. |
| 84 | ··0x0008 | 84 | ··0x0008458c·e01d0000·145cf9ff·581e0000·e45ef9ff·.....\..X....^.. |
| 85 | ··0x0008 | 85 | ··0x0008459c·6c1f0000·7460f9ff·d01f0000·d461f9ff·l...t`.......a.. |
| 86 | ··0x0008 | 86 | ··0x000845ac·78200000·a464f9ff·8c210000·6465f9ff·x·...d...!..de.. |
| 87 | ··0x0008 | 87 | ··0x000845bc·f8210000·3467f9ff·d8220000·b467f9ff·.!..4g..."...g.. |
| 88 | ··0x0008 | 88 | ··0x000845cc·14230000·6469f9ff·bc290000·b46af9ff·.#..di...)...j.. |
| 89 | ··0x0008 | 89 | ··0x000845dc·60310000·948ef9ff·3c360000·5491f9ff·`1......<6..T... |
| 90 | ··0x0008 | 90 | ··0x000845ec·4c460000·e4ebf9ff·a41d0000·c4edf9ff·LF.............. |
| 91 | ··0x0008 | 91 | ··0x000845fc·70230000·a4eef9ff·e8230000·c4eff9ff·p#.......#...... |
| 92 | ··0x0008 | 92 | ··0x0008460c·84240000·f4eff9ff·b0240000·74f0f9ff·.$.......$..t... |
| 93 | ··0x0008 | 93 | ··0x0008461c·10250000·e4f0f9ff·64250000·54f1f9ff·.%......d%..T... |
| 94 | ··0x0008 | 94 | ··0x0008462c·b8250000·44f2f9ff·f4250000·64f4f9ff·.%..D....%..d... |
| 95 | ··0x0008 | 95 | ··0x0008463c·ac260000·94f4f9ff·c0260000·74f5f9ff·.&.......&..t... |
| 96 | ··0x0008 | 96 | ··0x0008464c·f8260000·94f8f9ff·ac270000·94f9f9ff·.&.......'...... |
| 97 | ··0x0008 | 97 | ··0x0008465c·1c280000·14fbf9ff·a4280000·54fdf9ff·.(.......(..T... |
| 98 | ··0x0008 | 98 | ··0x0008466c·0c290000·c400faff·3c2a0000·8402faff·.)......<*...... |
| 99 | ··0x0008 | 99 | ··0x0008467c·ac2a0000·0405faff·e82a0000·4405faff·.*.......*..D... |
| 100 | ··0x0008 | 100 | ··0x0008468c·042b0000·a406faff·ac2b0000·1408faff·.+.......+...... |
| 101 | ··0x0008 | 101 | ··0x0008469c·3c2c0000·040afaff·cc2c0000·640cfaff·<,.......,..d... |
| 102 | ··0x0008 | 102 | ··0x000846ac·842d0000·740efaff·482e0000·e40ffaff·.-..t...H....... |
| 103 | ··0x0008 | 103 | ··0x000846bc·d82e0000·d411faff·682f0000·5414faff·........h/..T... |
| 104 | ··0x0008 | 104 | ··0x000846cc·2c300000·3417faff·b8300000·041bfaff·,0..4....0...... |
| 105 | ··0x0008 | 105 | ··0x000846dc·1c350000·741cfaff·ac350000·e41dfaff·.5..t....5...... |
| 106 | ··0x0008 | 106 | ··0x000846ec·3c370000·941ffaff·88370000·4421faff·<7.......7..D!.. |
| 107 | ··0x0008 | 107 | ··0x000846fc·d4370000·4429faff·a4380000·a42dfaff·.7..D)...8...-.. |
| 108 | ··0x0008 | 108 | ··0x0008470c·283a0000·042efaff·783a0000·f42ffaff·(:......x:.../.. |
| 109 | ··0x0008 | 109 | ··0x0008471c·c03a0000·4430faff·d43a0000·b433faff·.:..D0...:...3.. |
| 110 | ··0x0008 | 110 | ··0x0008472c·883b0000·8438faff·7c3c0000·5440faff·.;...8..|<..T@.. |
| 111 | ··0x0008 | 111 | ··0x0008473c·8c3d0000·2445faff·103e0000·344dfaff·.=..$E...>..4M.. |
| 112 | ··0x0008 | 112 | ··0x0008474c·c83e0000·244efaff·483f0000·c455faff·.>..$N..H?...U.. |
| 113 | ··0x0008 | 113 | ··0x0008475c·64400000·245dfaff·14410000·145efaff·d@..$]...A...^.. |
| 114 | ··0x0008 | 114 | ··0x0008476c·98410000·346efaff·d4410000·3470faff·.A..4n...A..4p.. |
| 115 | ··0x0008 | 115 | ··0x0008477c·6c420000·1474faff·58430000·147ffaff·lB...t..XC...... |
| 116 | ··0x0008 | 116 | ··0x0008478c·4c450000·6481faff·10460000·0e84faff·LE..d....F...... |
| 117 | ··0x0008 | 117 | ··0x0008479c·f8470000·1284faff·0c480000·1684faff·.G.......H...... |
| 118 | ··0x0008 | 118 | ··0x000847ac·20480000·1a84faff·34480000·2484faff··H......4H..$... |
| 119 | ··0x0008 | 119 | ··0x000847bc·5c480000·5484faff·8c480000·8484faff·\H..T....H...... |
| 120 | ··0x0008 | 120 | ··0x000847cc·bc480000·2485faff·f0480000·8485faff·.H..$....H...... |
| 121 | ··0x0008 | 121 | ··0x000847dc·14490000·e485faff·3c490000·8486faff·.I......<I...... |
| 122 | ··0x0008 | 122 | ··0x000847ec·7c490000·c486faff·b8490000·7487faff·|I.......I..t... |
| 123 | ··0x0008 | 123 | ··0x000847fc·144a0000·b487faff·a84a0000·7488faff·.J.......J..t... |
| 124 | ··0x0008 | 124 | ··0x0008480c·f84a0000·2489faff·544b0000·048afaff·.J..$...TK...... |
| 125 | ··0x0008 | 125 | ··0x0008481c·104c0000·348bfaff·944c0000·348efaff·.L..4....L..4... |
| Max diff block lines reached; 0/54525 bytes (0.00%) of diff not shown. | |||
| Offset 1, 4638 lines modified | Offset 1, 4613 lines modified | ||
| Diff chunk too large, falling back to line-by-line diff (960 lines added, 443 lines removed) | |||
| 1 | Hex·dump·of·section·'.eh_frame': | 1 | Hex·dump·of·section·'.eh_frame': |
| 2 | ··0x0008 | 2 | ··0x000859b8·14000000·00000000·017a5200·017c0801·.........zR..|.. |
| 3 | ··0x0008 | 3 | ··0x000859c8·1b0c0404·88010708·10000000·1c000000·................ |
| 4 | ··0x0008 | 4 | ··0x000859d8·583af9ff·2c000000·00000000·14000000·X:..,........... |
| 5 | ··0x0008 | 5 | ··0x000859e8·00000000·017a5200·017c0801·1b0c0404·.....zR..|...... |
| 6 | ··0x0008 | 6 | ··0x000859f8·88010000·20000000·1c000000·1cd6f8ff·....·........... |
| 7 | ··0x0008 | 7 | ··0x00085a08·000c0000·000e0846·0e0c4a0f·0b740478·.......F..J..t.x |
| 8 | ··0x0008 | 8 | ··0x00085a18·003f1a3b·2a322422·10000000·40000000·.?.;*2$"....@... |
| 9 | ··0x0008 | 9 | ··0x00085a28·f8e1f8ff·08000000·00000000·1c000000·................ |
| 10 | ··0x0008 | 10 | ··0x00085a38·00000000·017a504c·5200017c·08079bbd·.....zPLR..|.... |
| 11 | ··0x0008 | 11 | ··0x00085a48·6801001b·1b0c0404·88010000·38000000·h...........8... |
| 12 | ··0x0008 | 12 | ··0x00085a58·24000000·043bf9ff·65010000·04731f01·$....;..e....s.. |
| 13 | ··0x0008 | 13 | ··0x00085a68·00410e08·8502420d·05428703·86044f83·.A....B..B....O. |
| 14 | ··0x0008 | 14 | ··0x00085a78·056f2e10·642e2002·e00ac341·c641c741·.o..d.·....A.A.A |
| 15 | ··0x0008 | 15 | ··0x00085a88·c50c0404·410b0000·1c000000·60000000·....A.......`... |
| 16 | ··0x0008 | 16 | ··0x00085a98·98e1f8ff·35000000·04531f01·000c0508·....5....S...... |
| 17 | ··0x0008 | 17 | ··0x00085aa8·83058502·86048703·4c000000·80000000·........L....... |
| 18 | ··0x0008 | 18 | ··0x00085ab8·b834f9ff·e7010000·043b1f01·00440c01·.4.......;...D.. |
| 19 | ··0x0008 | 19 | ··0x00085ac8·00491005·02750042·10070275·7c100602·.I...u.B...u|... |
| 20 | ··0x0008 | 20 | ··0x00085ad8·75784d0f·03757006·10030275·74029f2e·uxM..up....ut... |
| 21 | ··0x0008 | 21 | ··0x00085ae8·10700ac1·0c010041·c341c641·c741c543·.p.....A.A.A.A.C |
| 22 | ··0x0008 | 22 | ··0x00085af8·0c040441·0b000000·2c000000·d0000000·...A....,....... |
| 23 | ··0x0008 | 23 | ··0x00085b08·5de1f8ff·19000000·04101f01·000f0375·]..............u |
| 24 | ··0x0008 | 24 | ··0x00085b18·70061003·02757410·05027500·10060275·p....ut...u....u |
| 25 | ··0x0008 | 25 | ··0x00085b28·78100702·757c0000·34000000·50010000·x...u|..4...P... |
| 26 | ··0x0008 | 26 | ··0x00085b38·2836f9ff·38000000·00410e08·8602410e·(6..8....A....A. |
| 27 | ··0x0008 | 27 | ··0x00085b48·0c83034e·0e1c470e·20480e14·470e1841·...N..G.·H..G..A |
| 28 | ··0x0008 | 28 | ··0x00085b58·0e1c460e·20480e0c·41c30e08·41c60e04·..F.·H..A...A... |
| 29 | ··0x0008 | 29 | ··0x00085b68·10000000·88010000·553bf9ff·04000000·........U;...... |
| 30 | ··0x0008 | 30 | ··0x00085b78·00000000·30000000·9c010000·4c3bf9ff·....0.......L;.. |
| 31 | ··0x0008 | 31 | ··0x00085b88·81000000·00410e08·8602410e·0c830302·.....A....A..... |
| 32 | ··0x0008 | 32 | ··0x00085b98·5b0ac30e·0841c60e·04420b4b·0ac30e08·[....A...B.K.... |
| 33 | ··0x0008 | 33 | ··0x00085ba8·41c60e04·440b0000·58000000·d0010000·A...D...X....... |
| 34 | ··0x0008 | 34 | ··0x00085bb8·a83bf9ff·a7000000·00410e08·8502450e·.;.......A....E. |
| 35 | ··0x0008 | 35 | ··0x00085bc8·0c870343·0e108604·430e1483·054e0e30·...C....C....N.0 |
| 36 | ··0x0008 | 36 | ··0x00085bd8·7e0a0e14·41c30e10·41c60e0c·41c70e08·~...A...A...A... |
| 37 | ··0x0008 | 37 | ··0x00085be8·41c50e04·440b530e·34420e38·450e3c41·A...D.S.4B.8E.<A |
| 38 | ··0x0008 | 38 | ··0x00085bf8·0e404c0e·30480e34·410e3841·0e3c410e·.@L.0H.4A.8A.<A. |
| 39 | ··0x0008 | 39 | ··0x00085c08·404e0e30·40000000·2c020000·fc3bf9ff·@N.0@...,....;.. |
| 40 | ··0x0008 | 40 | ··0x00085c18·31000000·00410e08·8702430e·0c860343·1....A....C....C |
| 41 | ··0x0008 | 41 | ··0x00085c28·0e108304·4e0e1c41·0e20490e·24430e28·....N..A.·I.$C.( |
| 42 | ··0x0008 | 42 | ··0x00085c38·420e2c41·0e30480e·1041c30e·0c41c60e·B.,A.0H..A...A.. |
| 43 | ··0x0008 | 43 | ··0x00085c48·0841c70e·04000000·38000000·70020000·.A......8...p... |
| 44 | ··0x0008 | 44 | ··0x00085c58·f83bf9ff·39000000·00410e08·8702410e·.;..9....A....A. |
| 45 | ··0x0008 | 45 | ··0x00085c68·0c860343·0e108304·5d0e1441·0e18410e·...C....]..A..A. |
| 46 | ··0x0008 | 46 | ··0x00085c78·1c410e20·480e1049·c30e0c41·c60e0841·.A.·H..I...A...A |
| 47 | ··0x0008 | 47 | ··0x00085c88·c70e0400·18000000·ac020000·fc3bf9ff·.............;.. |
| 48 | ··0x0008 | 48 | ··0x00085c98·3d000000·00540e08·83025dc3·0e040000·=....T....]..... |
| 49 | ··0x0008 | 49 | ··0x00085ca8·4c000000·c8020000·203cf9ff·b5000000·L.......·<...... |
| 50 | ··0x0008 | 50 | ··0x00085cb8·00410e08·8702430e·0c860343·0e108304·.A....C....C.... |
| 51 | ··0x0008 | 51 | ··0x00085cc8·02420ac3·0e0c41c6·0e0841c7·0e04450b·.B....A...A...E. |
| 52 | ··0x0008 | 52 | ··0x00085cd8·6b0e1441·0e18410e·1c410e20·4d0e1054·k..A..A..A.·M..T |
| 53 | ··0x0008 | 53 | ··0x00085ce8·0ac30e0c·41c60e08·41c70e04·470b0000·....A...A...G... |
| 54 | ··0x0008 | 54 | ··0x00085cf8·58000000·18030000·903cf9ff·a7000000·X........<...... |
| 55 | ··0x0008 | 55 | ··0x00085d08·00410e08·8502450e·0c870343·0e108604·.A....E....C.... |
| 56 | ··0x0008 | 56 | ··0x00085d18·430e1483·054e0e30·7e0a0e14·41c30e10·C....N.0~...A... |
| 57 | ··0x0008 | 57 | ··0x00085d28·41c60e0c·41c70e08·41c50e04·440b530e·A...A...A...D.S. |
| 58 | ··0x0008 | 58 | ··0x00085d38·34420e38·450e3c41·0e404c0e·30480e34·4B.8E.<A.@L.0H.4 |
| 59 | ··0x0008 | 59 | ··0x00085d48·410e3841·0e3c410e·404e0e30·68000000·A.8A.<A.@N.0h... |
| 60 | ··0x0008 | 60 | ··0x00085d58·74030000·e43cf9ff·d8000000·00410e08·t....<.......A.. |
| 61 | ··0x0008 | 61 | ··0x00085d68·8502430e·0c870341·0e108604·430e1483·..C....A....C... |
| 62 | ··0x0008 | 62 | ··0x00085d78·05510e40·5d0e4c41·0e50480e·40720a0e·.Q.@].LA.PH.@r.. |
| 63 | ··0x0008 | 63 | ··0x00085d88·1441c30e·1041c60e·0c41c70e·0841c50e·.A...A...A...A.. |
| 64 | ··0x0008 | 64 | ··0x00085d98·044b0b53·0e44420e·48450e4c·410e5050·.K.S.DB.HE.LA.PP |
| 65 | ··0x0008 | 65 | ··0x00085da8·0e40460e·44410e48·410e4c41·0e504e0e·.@F.DA.HA.LA.PN. |
| 66 | ··0x0008 | 66 | ··0x00085db8·404a0e4c·470e5000·4c000000·e0030000·@J.LG.P.L....... |
| 67 | ··0x0008 | 67 | ··0x00085dc8·583df9ff·71000000·00410e08·8702410e·X=..q....A....A. |
| 68 | ··0x0008 | 68 | ··0x00085dd8·0c860341·0e108304·6e0e1844·0e1c410e·...A....n..D..A. |
| 69 | ··0x0008 | 69 | ··0x00085de8·20480e10·500e1844·0e1c410e·20480e10··H..P..D..A.·H.. |
| 70 | ··0x0008 | 70 | ··0x00085df8·430e1842·0e1c410e·20480e10·45c30e0c·C..B..A.·H..E... |
| 71 | ··0x0008 | 71 | ··0x00085e08·41c60e08·41c70e04·38000000·e0030000·A...A...8....... |
| 72 | ··0x0008 | 72 | ··0x00085e18·38cef9ff·d9010000·040b1c01·00410e08·8............A.. |
| 73 | ··0x0008 | 73 | ··0x00085e28·8502420d·05418703·43860443·83050292·..B..A..C..C.... |
| 74 | ··0x0008 | 74 | ··0x00085e38·2e10602e·0002550a·c341c641·c741c50c·..`...U..A.A.A.. |
| 75 | ··0x0008 | 75 | ··0x00085e48·0404410b·74000000·6c040000·4c3df9ff·..A.t...l...L=.. |
| 76 | ··0x0008 | 76 | ··0x00085e58·d8000000·00410e08·8502410e·0c870341·.....A....A....A |
| 77 | ··0x0008 | 77 | ··0x00085e68·0e108604·410e1483·054e0e30·024b0e38·....A....N.0.K.8 |
| 78 | ··0x0008 | 78 | ··0x00085e78·440e3c41·0e40480e·30500e38·440e3c41·D.<A.@H.0P.8D.<A |
| 79 | ··0x0008 | 79 | ··0x00085e88·0e40480e·30430e38·420e3c41·0e40480e·.@H.0C.8B.<A.@H. |
| 80 | ··0x0008 | 80 | ··0x00085e98·30540e38·440e3c41·0e40480e·30430e38·0T.8D.<A.@H.0C.8 |
| 81 | ··0x0008 | 81 | ··0x00085ea8·420e3c41·0e404c0e·304b0e14·41c30e10·B.<A.@L.0K..A... |
| 82 | ··0x0008 | 82 | ··0x00085eb8·41c60e0c·41c70e08·41c50e04·10010000·A...A...A....... |
| 83 | ··0x0008 | 83 | ··0x00085ec8·e4040000·b43df9ff·cc020000·00410e08·.....=.......A.. |
| 84 | ··0x0008 | 84 | ··0x00085ed8·8502410e·0c870341·0e108604·430e1483·..A....A....C... |
| 85 | ··0x0008 | 85 | ··0x00085ee8·054e0e40·02950e48·480e4c41·0e504c0e·.N.@...HH.LA.PL. |
| 86 | ··0x0008 | 86 | ··0x00085ef8·40430e48·420e4c41·0e50480e·40570e48·@C.HB.LA.PH.@W.H |
| 87 | ··0x0008 | 87 | ··0x00085f08·440e4c41·0e50480e·40430e48·420e4c41·D.LA.PH.@C.HB.LA |
| 88 | ··0x0008 | 88 | ··0x00085f18·0e50480e·405e0e48·440e4c41·0e50480e·.PH.@^.HD.LA.PH. |
| 89 | ··0x0008 | 89 | ··0x00085f28·40430e48·420e4c41·0e50480e·40700e48·@C.HB.LA.PH.@p.H |
| 90 | ··0x0008 | 90 | ··0x00085f38·440e4c41·0e50480e·40430e48·420e4c41·D.LA.PH.@C.HB.LA |
| 91 | ··0x0008 | 91 | ··0x00085f48·0e50480e·40650e48·440e4c41·0e50480e·.PH.@e.HD.LA.PH. |
| 92 | ··0x0008 | 92 | ··0x00085f58·40430e48·420e4c41·0e50480e·406a0e48·@C.HB.LA.PH.@j.H |
| 93 | ··0x0008 | 93 | ··0x00085f68·440e4c41·0e50480e·40430e48·420e4c41·D.LA.PH.@C.HB.LA |
| 94 | ··0x0008 | 94 | ··0x00085f78·0e50480e·405f0e48·440e4c41·0e50480e·.PH.@_.HD.LA.PH. |
| 95 | ··0x0008 | 95 | ··0x00085f88·40430e48·420e4c41·0e50480e·40640e48·@C.HB.LA.PH.@d.H |
| 96 | ··0x0008 | 96 | ··0x00085f98·440e4c41·0e50480e·40430e48·420e4c41·D.LA.PH.@C.HB.LA |
| 97 | ··0x0008 | 97 | ··0x00085fa8·0e50480e·405e0e48·440e4c41·0e50480e·.PH.@^.HD.LA.PH. |
| 98 | ··0x00088008·420e4c41·0e50480e·40 | 98 | ··0x00085fb8·40430e48·420e4c41·0e50480e·404e0e14·@C.HB.LA.PH.@N.. |
| 99 | ··0x0008 | 99 | ··0x00085fc8·41c30e10·41c60e0c·41c70e08·41c50e04·A...A...A...A... |
| 100 | ··0x0008 | 100 | ··0x00085fd8·60000000·f8050000·703ff9ff·81010000·`.......p?...... |
| 101 | ··0x0008 | 101 | ··0x00085fe8·00410e08·8502460e·0c870343·0e108604·.A....F....C.... |
| 102 | ··0x0008 | 102 | ··0x00085ff8·410e1483·054e0e30·026e0e38·440e3c41·A....N.0.n.8D.<A |
| 103 | ··0x0008 | 103 | ··0x00086008·0e40480e·30500e38·440e3c41·0e40480e·.@H.0P.8D.<A.@H. |
| 104 | ··0x0008 | 104 | ··0x00086018·30430e38·420e3c41·0e40480e·3002bd0e·0C.8B.<A.@H.0... |
| 105 | ··0x0008 | 105 | ··0x00086028·1441c30e·1041c60e·0c41c70e·0841c50e·.A...A...A...A.. |
| 106 | ··0x0008 | 106 | ··0x00086038·04000000·a4000000·5c060000·9c40f9ff·........\....@.. |
| 107 | ··0x0008 | 107 | ··0x00086048·60010000·00410e08·8502410e·0c870341·`....A....A....A |
| 108 | ··0x0008 | 108 | ··0x00086058·0e108604·410e1483·054e0e30·7a0e3844·....A....N.0z.8D |
| 109 | ··0x0008 | 109 | ··0x00086068·0e3c410e·40480e30·560e3844·0e3c410e·.<A.@H.0V.8D.<A. |
| 110 | ··0x0008 | 110 | ··0x00086078·40480e30·500e3844·0e3c410e·40480e30·@H.0P.8D.<A.@H.0 |
| 111 | ··0x0008 | 111 | ··0x00086088·5e0e3844·0e3c410e·40480e30·540e3843·^.8D.<A.@H.0T.8C |
| 112 | ··0x000880e | 112 | ··0x00086098·0e3c410e·40480e30·500e3844·0e3c410e·.<A.@H.0P.8D.<A. |
| 113 | ··0x000880 | 113 | ··0x000860a8·40480e30·500e3844·0e3c410e·40480e30·@H.0P.8D.<A.@H.0 |
| 114 | ··0x00088 | 114 | ··0x000860b8·500e3844·0e3c410e·40480e30·430e3845·P.8D.<A.@H.0C.8E |
| 115 | ··0x0008 | 115 | ··0x000860c8·0e3c410e·404c0e30·4b0e1441·c30e1041·.<A.@L.0K..A...A |
| 116 | ··0x0008 | 116 | ··0x000860d8·c60e0c41·c70e0841·c50e0400·10010000·...A...A........ |
| 117 | ··0x0008 | 117 | ··0x000860e8·04070000·5441f9ff·cc020000·00410e08·....TA.......A.. |
| 118 | ··0x0008 | 118 | ··0x000860f8·8502410e·0c870341·0e108604·430e1483·..A....A....C... |
| 119 | ··0x0008 | 119 | ··0x00086108·054e0e40·02950e48·480e4c41·0e504c0e·.N.@...HH.LA.PL. |
| 120 | ··0x0008 | 120 | ··0x00086118·40430e48·420e4c41·0e50480e·40570e48·@C.HB.LA.PH.@W.H |
| 121 | ··0x0008 | 121 | ··0x00086128·440e4c41·0e50480e·40430e48·420e4c41·D.LA.PH.@C.HB.LA |
| 122 | ··0x0008 | 122 | ··0x00086138·0e50480e·405e0e48·440e4c41·0e50480e·.PH.@^.HD.LA.PH. |
| 123 | ··0x00088 | 123 | ··0x00086148·40430e48·420e4c41·0e50480e·40700e48·@C.HB.LA.PH.@p.H |
| 124 | ··0x0008 | 124 | ··0x00086158·440e4c41·0e50480e·40430e48·420e4c41·D.LA.PH.@C.HB.LA |
| 125 | ··0x00088 | 125 | ··0x00086168·0e50480e·40650e48·440e4c41·0e50480e·.PH.@e.HD.LA.PH. |
| Max diff block lines reached; 525144/619270 bytes (84.80%) of diff not shown. | |||
| Offset 1, 828 lines modified | Offset 1, 822 lines modified | ||
| Diff chunk too large, falling back to line-by-line diff (819 lines added, 825 lines removed) | |||
| 1 | Hex·dump·of·section·'.gcc_except_table': | 1 | Hex·dump·of·section·'.gcc_except_table': |
| 2 | ··0x0009 | 2 | ··0x000979d8·ffff0118·23130000·4305de02·005205d7·....#...C....R.. |
| 3 | ··0x0009 | 3 | ··0x000979e8·02006705·d00200d1·01630000·ffff0104·..g......c...... |
| 4 | ··0x0009 | 4 | ··0x000979f8·30050000·ffff0121·bb0105e2·0300fe01·0......!........ |
| 5 | ··0x0009 | 5 | ··0x00097a08·050000e6·0205e203·00f00205·00009c03·................ |
| 6 | ··0x0009 | 6 | ··0x00097a18·23e20300·dd030500·00ffff01·04140500·#............... |
| 7 | ··0x0009 | 7 | ··0x00097a28·00000000·ff9b4d01·411d0500·00410599·......M.A....A.. |
| 8 | ··0x0009 | 8 | ··0x00097a38·02015705·9502037f·22a50201·bc01059d·..W....."....... |
| 9 | ··0x0009 | 9 | ··0x00097a48·0201d201·05a10203·fb0105a5·0201d302·................ |
| 10 | ··0x0009 | 10 | ··0x00097a58·05870300·820305c2·0303ac03·05c60300·................ |
| 11 | ··0x0009 | 11 | ··0x00097a68·bd030500·00d40305·00000100·007d0000·.............}.. |
| 12 | ··0x0009 | 12 | ··0x00097a78·00000000·ff9b1501·0be80105·00008802·................ |
| 13 | ··0x0009 | 13 | ··0x00097a88·05bc0301·01000000·00000000·ff9b1101·................ |
| 14 | ··0x0009 | 14 | ··0x00097a98·081a051f·002e0500·00010000·00000000·................ |
| 15 | ··0x0009 | 15 | ··0x00097aa8·ffff0119·23130000·4305a403·0052059d·....#...C....R.. |
| 16 | ··0x0009 | 16 | ··0x00097ab8·03006705·960300d1·01a90100·00ffff01·..g............. |
| 17 | ··0x0009 | 17 | ··0x00097ac8·04300500·00000000·ff9b2501·1a350500·.0........%..5.. |
| 18 | ··0x0009 | 18 | ··0x00097ad8·00500588·01019701·059c0103·c90105ce·.P.............. |
| 19 | ··0x0009 | 19 | ··0x00097ae8·0100dc01·05000001·00007d00·00000000·..........}..... |
| 20 | ··0x0009 | 20 | ··0x00097af8·ffff010a·407cbc01·00cd0105·00000000·....@|.......... |
| 21 | ··0x0009 | 21 | ··0x00097b08·ff9b2101·16900105·bb0501fd·043e0000·..!..........>.. |
| 22 | ··0x0009 | 22 | ··0x00097b18·e6050585·06009406·05000001·00000000·................ |
| 23 | ··0x0009 | 23 | ··0x00097b28·00000000·ffff0125·45050000·5e05ca02·.......%E...^... |
| 24 | ··0x0009 | 24 | ··0x00097b38·007a05da·02009201·05d20200·aa0105d6·.z.............. |
| 25 | ··0x0009 | 25 | ··0x00097b48·0200e901·05ce0200·b9030500·00000000·................ |
| 26 | ··0x0009 | 26 | ··0x00097b58·ff9b2501·1c850105·00009501·05c70401·..%............. |
| 27 | ··0x0009 | 27 | ··0x00097b68·8802bf02·0000e804·05ed0400·fb040500·................ |
| 28 | ··0x0009 | 28 | ··0x00097b78·00010000·00000000·ff9b2101·168f0205·..........!..... |
| 29 | ··0x0009 | 29 | ··0x00097b88·0000af02·05d20301·ec0305f1·0300ff03·................ |
| 30 | ··0x0009 | 30 | ··0x00097b98·05000001·00000000·00000000·ff9b1101·................ |
| 31 | ··0x0009 | 31 | ··0x00097ba8·09320500·005905ac·05010100·00000000·.2...Y.......... |
| 32 | ··0x0009 | 32 | ··0x00097bb8·ff9b1101·081a051f·002e0500·00010000·................ |
| 33 | ··0x0009 | 33 | ··0x00097bc8·00000000·ff9b3501·2c510500·009e0105·......5.,Q...... |
| 34 | ··0x0009 | 34 | ··0x00097bd8·b10201bc·0105af02·01aa0205·0000c402·................ |
| 35 | ··0x0009 | 35 | ··0x00097be8·05f80201·a50305b2·0301ad03·05b60300·................ |
| 36 | ··0x0009 | 36 | ··0x00097bf8·e7030500·00010000·00000000·ffff0110·................ |
| 37 | ··0x0009 | 37 | ··0x00097c08·82020300·00bf0c03·8120009a·20050000·.........·..·... |
| 38 | ··0x0009 | 38 | ··0x00097c18·ffff010c·f9018b03·940500a5·05050000·................ |
| 39 | ··0x0009 | 39 | ··0x00097c28·ff9bac07·01a107a9·012382b3·0100de01·.........#...... |
| 40 | ··0x0009 | 40 | ··0x00097c38·0590b301·008a0205·89b30100·b60205a6·................ |
| 41 | ··0x0009 | 41 | ··0x00097c48·b40100c7·0205f1b1·0100f302·05eab101·................ |
| 42 | ··0x0009 | 42 | ··0x00097c58·009f0305·97b30100·b003059b·b20100dc·................ |
| 43 | ··0x0009 | 43 | ··0x00097c68·0305a5b3·01008804·059eb301·00990405·................ |
| 44 | ··0x0009 | 44 | ··0x00097c78·c9b40100·c50405bb·b40100f1·0405c2b4·................ |
| 45 | ··0x0009 | 45 | ··0x00097c88·01008205·05b4b401·00ae0505·adb40100·................ |
| 46 | ··0x0009 | 46 | ··0x00097c98·da0505f4·b20100ed·05058db2·01009406·................ |
| 47 | ··0x0009 | 47 | ··0x00097ca8·0586b201·00ba0605·ffb10100·ca0605f8·................ |
| 48 | ··0x0009 | 48 | ··0x00097cb8·b10100e8·0605ffb1·0100f806·0588b101·................ |
| 49 | ··0x0009 | 49 | ··0x00097cc8·00960705·ffb10100·a70705fb·b20100bd·................ |
| 50 | ··0x0009 | 50 | ··0x00097cd8·078704ff·b10100f3·0b05ceb3·01008d0c·................ |
| 51 | ··0x0009 | 51 | ··0x00097ce8·05d5b301·00c50d05·bab30100·f70ecd01·................ |
| 52 | ··0x0009 | 52 | ··0x00097cf8·acb30100·de1005ba·b30100a2·1105eab3·................ |
| 53 | ··0x0009 | 53 | ··0x00097d08·0100da11·05f7b301·00dc177d·b3b30100·...........}.... |
| 54 | ··0x0009 | 54 | ··0x00097d18·881905ca·b20100c8·1905d1b2·0100cf1c·................ |
| 55 | ··0x0009 | 55 | ··0x00097d28·058ab401·00831d05·94b20100·c31d0591·................ |
| 56 | ··0x0009 | 56 | ··0x00097d38·b4010094·1f93028a·b40100dc·22d601b3·............"... |
| 57 | ··0x0009 | 57 | ··0x00097d48·b30100be·2905edb2·0100f029·05dcb301·....)......).... |
| 58 | ··0x0009 | 58 | ··0x00097d58·00c92c05·edb20100·fb2c05c7·b30100bd·..,......,...... |
| 59 | ··0x0009 | 59 | ··0x00097d68·30e0028a·b40100ca·3305e3b3·0100dd34·0.......3......4 |
| 60 | ··0x0009 | 60 | ··0x00097d78·058ab401·008f3505·bcb20100·823605c3·......5......6.. |
| 61 | ··0x0009 | 61 | ··0x00097d88·b20100fc·3705a2b2·01009e38·05b5b201·....7......8.... |
| 62 | ··0x0009 | 62 | ··0x00097d98·00c03c98·07feb301·00fc4305·85b40101·..<.......C..... |
| 63 | ··0x0009 | 63 | ··0x00097da8·c34605a2·b20100ab·4a05e6b2·0100ce4a·.F......J......J |
| 64 | ··0x0009 | 64 | ··0x00097db8·05d8b201·01e44a05·dfb20101·e94c05e6·......J......L.. |
| 65 | ··0x0009 | 65 | ··0x00097dc8·b20100fb·4ea9028a·b4010085·53940de6·....N.......S... |
| 66 | ··0x0009 | 66 | ··0x00097dd8·b20100ef·6005eab3·0100c162·05ceb101·....`......b.... |
| 67 | ··0x0009 | 67 | ··0x00097de8·00ea63d2·01eab301·00c76505·f3b40100·..c.......e..... |
| 68 | ··0x0009 | 68 | ··0x00097df8·bc6705ea·b30100d9·68ed028a·b40100fd·.g......h....... |
| 69 | ··0x0009 | 69 | ··0x00097e08·6e05b2b1·0100bf70·05e3b101·00907105·n......p......q. |
| 70 | ··0x0009 | 70 | ··0x00097e18·8ab40100·ea7105d5·b10100cc·730598b4·.....q......s... |
| 71 | ··0x0009 | 71 | ··0x00097e28·01009674·05d5b101·00ba74c4·028ab401·...t......t..... |
| 72 | ··0x0009 | 72 | ··0x00097e38·00a17805·9db10100·e37c05c0·b10100bd·..x......|...... |
| 73 | ··0x0009 | 73 | ··0x00097e48·7d05a4b1·01009f7f·05abb101·00e67f05·}............... |
| 74 | ··0x0009 | 74 | ··0x00097e58·a4b10100·84810105·ecb40100·db810184·................ |
| 75 | ··0x0009 | 75 | ··0x00097e68·018ab401·00b68601·05d5b101·00e08c01·................ |
| 76 | ··0x0009 | 76 | ··0x00097e78·05b9b101·00989001·cf039fb4·0100da94·................ |
| 77 | ··0x0009 | 77 | ··0x00097e88·0105e5b4·0100aa95·018a019f·b40100c4·................ |
| 78 | ··0x0009 | 78 | ··0x00097e98·960114de·b4010081·9701309f·b40100c1·..........0..... |
| 79 | ··0x0009a | 79 | ··0x00097ea8·97011481·b50100b4·9801058a·b40100e0·................ |
| 80 | ··0x0009 | 80 | ··0x00097eb8·980105b9·b1010081·990144a4·b10100c0·..........D..... |
| 81 | ··0x0009 | 81 | ··0x00097ec8·9b0105b9·b10100de·9b0105d5·b10100ec·................ |
| 82 | ··0x0009 | 82 | ··0x00097ed8·9b0105d7·b40100b0·9d0156a4·b10100f9·..........V..... |
| 83 | ··0x0009 | 83 | ··0x00097ee8·a001058f·b10100fa·a10105a4·b101008a·................ |
| 84 | ··0x0009 | 84 | ··0x00097ef8·a2010fc7·b10100a2·a30105fa·b40100e1·................ |
| 85 | ··0x0009 | 85 | ··0x00097f08·a50105dc·b10100ad·a6019202·a4b10100·................ |
| 86 | ··0x0009 | 86 | ··0x00097f18·c8a80105·96b10100·f9a80105·b9b10100·................ |
| 87 | ··0x0009 | 87 | ··0x00097f28·99a90150·d5b10100·f3a90105·d0b40100·...P............ |
| 88 | ··0x0009 | 88 | ··0x00097f38·adaa0105·eab30100·caaa0105·a4b10100·................ |
| 89 | ··0x0009 | 89 | ··0x00097f48·82ab0144·f3b40100·efab015e·8ab40100·...D.......^.... |
| 90 | ··0x0009 | 90 | ··0x00097f58·e4ac0123·b9b10100·a2ad0144·a4b10100·...#.......D.... |
| 91 | ··0x0009 | 91 | ··0x00097f68·f6ad0105·81b10100·b9ae0105·cab20100·................ |
| 92 | ··0x0009 | 92 | ··0x00097f78·ceae0105·d1b20100·eeae0105·a2b20100·................ |
| 93 | ··0x0009 | 93 | ··0x00097f88·83af0105·c7b30100·a0af0105·b3b30100·................ |
| 94 | ··0x0009 | 94 | ··0x00097f98·b5af0105·91b40100·84b00105·ffb10100·................ |
| 95 | ··0x0009 | 95 | ··0x00097fa8·a8b00105·dcb30100·bdb00105·e3b30100·................ |
| 96 | ··0x0009 | 96 | ··0x00097fb8·d2b00105·bcb20100·e7b00105·94b20100·................ |
| 97 | ··0x0009 | 97 | ··0x00097fc8·fcb00105·ceb30100·01000000·00000000·................ |
| 98 | ··0x0009 | 98 | ··0x00097fd8·ff9b1901·11b10205·00008808·05c10500·................ |
| 99 | ··0x0009 | 99 | ··0x00097fe8·c50a0580·0a000100·00000000·ffff010b·................ |
| 100 | ··0x0009 | 100 | ··0x00097ff8·a501058f·0400bb02·4a0000ff·ff01041f·........J....... |
| 101 | ··0x0009 | 101 | ··0x00098008·050000ff·ff010ba5·0105ef03·00b10246·...............F |
| 102 | ··0x0009 | 102 | ··0x00098018·0000ffff·01041f05·0000ffff·0100ffff·................ |
| 103 | ··0x0009 | 103 | ··0x00098028·01192313·00004305·da030052·05d30300·..#...C....R.... |
| 104 | ··0x0009 | 104 | ··0x00098038·6705cc03·00d101df·010000ff·ff010430·g..............0 |
| 105 | ··0x0009 | 105 | ··0x00098048·050000ff·ff01063a·a502ee02·00ffff01·.......:........ |
| 106 | ··0x0009 | 106 | ··0x00098058·040f0500·00ffff01·0a407cbc·0100cd01·.........@|..... |
| 107 | ··0x0009 | 107 | ··0x00098068·05000000·ff9b2101·16900105·9b0601dd·......!......... |
| 108 | ··0x0009 | 108 | ··0x00098078·053e0000·c60605e5·0600f406·05000001·.>.............. |
| 109 | ··0x0009 | 109 | ··0x00098088·00000000·00000000·ff9b2501·1b500500·..........%..P.. |
| 110 | ··0x0009 | 110 | ··0x00098098·00830105·8c0201c0·0205c502·03f20205·................ |
| 111 | ··0x0009a | 111 | ··0x000980a8·f7020085·03050000·0100007d·00000000·...........}.... |
| 112 | ··0x0009 | 112 | ··0x000980b8·ff9b2501·1a420500·007305dc·01019002·..%..B...s...... |
| 113 | ··0x0009 | 113 | ··0x000980c8·05950203·c20205c7·0200d502·05000001·................ |
| 114 | ··0x0009 | 114 | ··0x000980d8·00007d00·00000000·ff9b2d01·204f0500·..}.......-.·O.. |
| 115 | ··0x0009 | 115 | ··0x000980e8·00830105·9d020198·02050000·d10205d6·................ |
| 116 | ··0x0009 | 116 | ··0x000980f8·02038303·05880300·96030500·00010000·................ |
| 117 | ··0x0009 | 117 | ··0x00098108·7d000000·00000000·ff9b1101·09320500·}............2.. |
| 118 | ··0x0009 | 118 | ··0x00098118·0059058c·06010100·00000000·ff9b1101·.Y.............. |
| 119 | ··0x0009 | 119 | ··0x00098128·081a051f·002e0500·00010000·00000000·................ |
| 120 | ··0x0009 | 120 | ··0x00098138·ffff0138·557f0000·80020581·0f009402·...8U........... |
| 121 | ··0x0009 | 121 | ··0x00098148·53fd0e00·9905e005·f90e0097·0b05fd0e·S............... |
| 122 | ··0x0009 | 122 | ··0x00098158·00800c05·0000a00d·05810f00·ba0d4800·..............H. |
| 123 | ··0x0009 | 123 | ··0x00098168·00a10e4e·fd0e00b3·0f050000·ff9b2101·...N..........!. |
| 124 | ··0x0009 | 124 | ··0x00098178·16ba0105·810201df·01220000·be0205c3·........."...... |
| 125 | ··0x0009 | 125 | ··0x00098188·0200d102·05000001·00000000·00000000·................ |
| Max diff block lines reached; 0/110202 bytes (0.00%) of diff not shown. | |||
| Offset 1, 6 lines modified | Offset 1, 6 lines modified | ||
| 1 | Hex·dump·of·section·'.init_array': | 1 | Hex·dump·of·section·'.init_array': |
| 2 | ··0x0009 | 2 | ··0x0009bc20·50950100·60910100·a0910100·e0910100·P...`........... |
| 3 | ··0x0009 | 3 | ··0x0009bc30·80920100·30930100·70930100·b0930100·....0...p....... |
| 4 | ··0x0009 | 4 | ··0x0009bc40·f0930100····························.... |
| Offset 1, 4 lines modified | Offset 1, 4 lines modified | ||
| 1 | Hex·dump·of·section·'.fini_array': | 1 | Hex·dump·of·section·'.fini_array': |
| 2 | ··0x0009 | 2 | ··0x0009bc44·00950100····························.... |
| Offset 1, 36 lines modified | Offset 1, 36 lines modified | ||
| 1 | Hex·dump·of·section·'.data.rel.ro': | 1 | Hex·dump·of·section·'.data.rel.ro': |
| 2 | ··0x0009 | 2 | ··0x0009bc48·08000000·0c250800·08000000·20250800·.....%......·%.. |
| 3 | ··0x0009 | 3 | ··0x0009bc58·08000000·60250800·00000000·08000000·....`%.......... |
| 4 | ··0x0009 | 4 | ··0x0009bc68·80250800·00000000·08000000·a0250800·.%...........%.. |
| 5 | ··0x0009 | 5 | ··0x0009bc78·00000000·03000000·50bc0900·02000000·........P....... |
| 6 | ··0x0009 | 6 | ··0x0009bc88·00000000·02040000·48bc0900·020c0000·........H....... |
| 7 | ··0x0009 | 7 | ··0x0009bc98·08000000·e0250800·00000000·03000000·.....%.......... |
| 8 | ··0x0009 | 8 | ··0x0009bca8·50bc0900·02000000·00000000·02040000·P............... |
| 9 | ··0x0009 | 9 | ··0x0009bcb8·48bc0900·020c0000·08000000·20260800·H...........·&.. |
| 10 | ··0x0009 | 10 | ··0x0009bcc8·00000000·03000000·50bc0900·02000000·........P....... |
| 11 | ··0x0009 | 11 | ··0x0009bcd8·64bc0900·02040000·48bc0900·020c0000·d.......H....... |
| 12 | ··0x0009 | 12 | ··0x0009bce8·08000000·60260800·00000000·03000000·....`&.......... |
| 13 | ··0x0009 | 13 | ··0x0009bcf8·50bc0900·02000000·58bc0900·02040000·P.......X....... |
| 14 | ··0x0009 | 14 | ··0x0009bd08·48bc0900·020c0000·00000000·48bc0900·H...........H... |
| 15 | ··0x0009 | 15 | ··0x0009bd18·00000000·00000000·00000000·50bc0900·............P... |
| 16 | ··0x0009 | 16 | ··0x0009bd28·00000000·00000000·00000000·00000000·................ |
| 17 | ··0x0009 | 17 | ··0x0009bd38·00000000·58bc0900·90f50400·c0f50400·....X........... |
| 18 | ··0x0009 | 18 | ··0x0009bd48·00000000·00000000·64bc0900·20f50400·........d...·... |
| 19 | ··0x0009 | 19 | ··0x0009bd58·50f50400·00000000·00000000·70bc0900·P...........p... |
| 20 | ··0x0009 | 20 | ··0x0009bd68·50120500·e64e0100·80f70400·40fc0400·P....N......@... |
| 21 | ··0x0009 | 21 | ··0x0009bd78·fcffffff·70bc0900·20f70400·b0fc0400·....p...·....... |
| 22 | ··0x0009 | 22 | ··0x0009bd88·00000000·f4ffffff·70bc0900·e0f70400·........p....... |
| 23 | ··0x0009 | 23 | ··0x0009bd98·20fd0400·00000000·98bc0900·40110500··...........@... |
| 24 | ··0x0009 | 24 | ··0x0009bda8·f84d0100·60f60400·f0fe0400·fcffffff·.M..`........... |
| 25 | ··0x0009 | 25 | ··0x0009bdb8·98bc0900·c0f60400·60ff0400·00000000·........`....... |
| 26 | ··0x0009 | 26 | ··0x0009bdc8·f4ffffff·98bc0900·00f60400·d0ff0400·................ |
| 27 | ··0x0009 | 27 | ··0x0009bdd8·00000000·c0bc0900·20100500·d44f0100·........·....O.. |
| 28 | ··0x0009 | 28 | ··0x0009bde8·70fa0400·e0fa0400·fcffffff·c0bc0900·p............... |
| 29 | ··0x0009 | 29 | ··0x0009bdf8·90f90400·d0fb0400·00000000·f4ffffff·................ |
| 30 | ··0x0009 | 30 | ··0x0009be08·c0bc0900·00fa0400·50fb0400·00000000·........P....... |
| 31 | ··0x0009 | 31 | ··0x0009be18·e8bc0900·000f0500·c8500100·20f90400·.........P..·... |
| 32 | ··0x0009 | 32 | ··0x0009be28·90fd0400·fcffffff·e8bc0900·b0f80400·................ |
| 33 | ··0x0009 | 33 | ··0x0009be38·00fe0400·00000000·f4ffffff·e8bc0900·................ |
| 34 | ··0x0009 | 34 | ··0x0009be48·40f80400·70fe0400···················@...p... |
| Offset 1, 11 lines modified | Offset 1, 11 lines modified | ||
| 1 | Hex·dump·of·section·'.got': | 1 | Hex·dump·of·section·'.got': |
| 2 | ··0x0009 | 2 | ··0x0009bf80·00000000·00000000·00000000·00000000·................ |
| 3 | ··0x0009 | 3 | ··0x0009bf90·00000000·708f0100·00000000·00000000·....p........... |
| 4 | ··0x0009 | 4 | ··0x0009bfa0·00000000·00000000·00000000·00000000·................ |
| 5 | ··0x0009 | 5 | ··0x0009bfb0·14c30900·00000000·00000000·00000000·................ |
| 6 | ··0x0009 | 6 | ··0x0009bfc0·00000000·00000000·00000000·00000000·................ |
| 7 | ··0x0009 | 7 | ··0x0009bfd0·00000000·00000000·00000000·00000000·................ |
| 8 | ··0x0009 | 8 | ··0x0009bfe0·00000000·00000000·00000000·00000000·................ |
| 9 | ··0x0009 | 9 | ··0x0009bff0·00000000····························.... |
| Offset 1, 53 lines modified | Offset 1, 53 lines modified | ||
| 1 | Hex·dump·of·section·'.got.plt': | 1 | Hex·dump·of·section·'.got.plt': |
| 2 | ·NOTE:·This·section·has·relocations·against·it,·but·these·have·NOT·been·applied·to·this·dump. | 2 | ·NOTE:·This·section·has·relocations·against·it,·but·these·have·NOT·been·applied·to·this·dump. |
| 3 | ··0x0009 | 3 | ··0x0009bff4·50be0900·00000000·00000000·36300100·P...........60.. |
| 4 | ··0x0009 | 4 | ··0x0009c004·46300100·56300100·66300100·76300100·F0..V0..f0..v0.. |
| 5 | ··0x0009 | 5 | ··0x0009c014·86300100·96300100·a6300100·b6300100·.0...0...0...0.. |
| 6 | ··0x0009 | 6 | ··0x0009c024·c6300100·d6300100·e6300100·f6300100·.0...0...0...0.. |
| 7 | ··0x0009 | 7 | ··0x0009c034·06310100·16310100·26310100·36310100·.1...1..&1..61.. |
| 8 | ··0x0009 | 8 | ··0x0009c044·46310100·56310100·66310100·76310100·F1..V1..f1..v1.. |
| 9 | ··0x0009 | 9 | ··0x0009c054·86310100·96310100·a6310100·b6310100·.1...1...1...1.. |
| 10 | ··0x0009 | 10 | ··0x0009c064·c6310100·d6310100·e6310100·f6310100·.1...1...1...1.. |
| 11 | ··0x0009 | 11 | ··0x0009c074·06320100·16320100·26320100·36320100·.2...2..&2..62.. |
| 12 | ··0x0009 | 12 | ··0x0009c084·46320100·56320100·66320100·76320100·F2..V2..f2..v2.. |
| 13 | ··0x0009 | 13 | ··0x0009c094·86320100·96320100·a6320100·b6320100·.2...2...2...2.. |
| 14 | ··0x0009 | 14 | ··0x0009c0a4·c6320100·d6320100·e6320100·f6320100·.2...2...2...2.. |
| 15 | ··0x0009 | 15 | ··0x0009c0b4·06330100·16330100·26330100·36330100·.3...3..&3..63.. |
| 16 | ··0x0009 | 16 | ··0x0009c0c4·46330100·56330100·66330100·76330100·F3..V3..f3..v3.. |
| 17 | ··0x0009 | 17 | ··0x0009c0d4·86330100·96330100·a6330100·b6330100·.3...3...3...3.. |
| 18 | ··0x0009 | 18 | ··0x0009c0e4·c6330100·d6330100·e6330100·f6330100·.3...3...3...3.. |
| 19 | ··0x0009 | 19 | ··0x0009c0f4·06340100·16340100·26340100·36340100·.4...4..&4..64.. |
| 20 | ··0x0009 | 20 | ··0x0009c104·46340100·56340100·66340100·76340100·F4..V4..f4..v4.. |
| 21 | ··0x0009 | 21 | ··0x0009c114·86340100·96340100·a6340100·b6340100·.4...4...4...4.. |
| 22 | ··0x0009 | 22 | ··0x0009c124·c6340100·d6340100·e6340100·f6340100·.4...4...4...4.. |
| 23 | ··0x0009 | 23 | ··0x0009c134·06350100·16350100·26350100·36350100·.5...5..&5..65.. |
| 24 | ··0x0009 | 24 | ··0x0009c144·46350100·56350100·66350100·76350100·F5..V5..f5..v5.. |
| 25 | ··0x0009 | 25 | ··0x0009c154·86350100·96350100·a6350100·b6350100·.5...5...5...5.. |
| 26 | ··0x0009 | 26 | ··0x0009c164·c6350100·d6350100·e6350100·f6350100·.5...5...5...5.. |
| 27 | ··0x0009 | 27 | ··0x0009c174·06360100·16360100·26360100·36360100·.6...6..&6..66.. |
| 28 | ··0x0009 | 28 | ··0x0009c184·46360100·56360100·66360100·76360100·F6..V6..f6..v6.. |
| 29 | ··0x0009 | 29 | ··0x0009c194·86360100·96360100·a6360100·b6360100·.6...6...6...6.. |
| 30 | ··0x0009 | 30 | ··0x0009c1a4·c6360100·d6360100·e6360100·f6360100·.6...6...6...6.. |
| 31 | ··0x0009 | 31 | ··0x0009c1b4·06370100·16370100·26370100·36370100·.7...7..&7..67.. |
| 32 | ··0x0009 | 32 | ··0x0009c1c4·46370100·56370100·66370100·76370100·F7..V7..f7..v7.. |
| 33 | ··0x0009 | 33 | ··0x0009c1d4·86370100·96370100·a6370100·b6370100·.7...7...7...7.. |
| 34 | ··0x0009 | 34 | ··0x0009c1e4·c6370100·d6370100·e6370100·f6370100·.7...7...7...7.. |
| 35 | ··0x0009 | 35 | ··0x0009c1f4·06380100·16380100·26380100·36380100·.8...8..&8..68.. |
| 36 | ··0x0009 | 36 | ··0x0009c204·46380100·56380100·66380100·76380100·F8..V8..f8..v8.. |
| 37 | ··0x0009 | 37 | ··0x0009c214·86380100·96380100·a6380100·b6380100·.8...8...8...8.. |
| 38 | ··0x0009 | 38 | ··0x0009c224·c6380100·d6380100·e6380100·f6380100·.8...8...8...8.. |
| 39 | ··0x0009 | 39 | ··0x0009c234·06390100·16390100·26390100·36390100·.9...9..&9..69.. |
| 40 | ··0x0009 | 40 | ··0x0009c244·46390100·56390100·66390100·76390100·F9..V9..f9..v9.. |
| 41 | ··0x0009 | 41 | ··0x0009c254·86390100·96390100·a6390100·b6390100·.9...9...9...9.. |
| 42 | ··0x0009 | 42 | ··0x0009c264·c6390100·d6390100·e6390100·f6390100·.9...9...9...9.. |
| 43 | ··0x0009 | 43 | ··0x0009c274·063a0100·163a0100·263a0100·363a0100·.:...:..&:..6:.. |
| 44 | ··0x0009 | 44 | ··0x0009c284·463a0100·563a0100·663a0100·763a0100·F:..V:..f:..v:.. |
| 45 | ··0x0009 | 45 | ··0x0009c294·863a0100·963a0100·a63a0100·b63a0100·.:...:...:...:.. |
| 46 | ··0x0009 | 46 | ··0x0009c2a4·c63a0100·d63a0100·e63a0100·f63a0100·.:...:...:...:.. |
| 47 | ··0x0009 | 47 | ··0x0009c2b4·063b0100·163b0100·263b0100·363b0100·.;...;..&;..6;.. |
| 48 | ··0x0009 | 48 | ··0x0009c2c4·463b0100·563b0100·663b0100·763b0100·F;..V;..f;..v;.. |
| 49 | ··0x0009 | 49 | ··0x0009c2d4·863b0100·963b0100·a63b0100·b63b0100·.;...;...;...;.. |
| 50 | ··0x0009 | 50 | ··0x0009c2e4·c63b0100·d63b0100·e63b0100·f63b0100·.;...;...;...;.. |
| 51 | ··0x0009 | 51 | ··0x0009c2f4·063c0100·163c0100···················.<...<.. |
| Offset 1, 14 lines modified | Offset 1, 14 lines modified | ||
| 1 | Hex·dump·of·section·'.data': | 1 | Hex·dump·of·section·'.data': |
| 2 | ··0x0009 | 2 | ··0x0009c2fc·00000000·00c30900·00000000·a4190800·................ |
| 3 | ··0x0009 | 3 | ··0x0009c30c·a8100800·b50f0800·02000000·01000000·................ |
| 4 | ··0x0009 | 4 | ··0x0009c31c·02000000·00000000·23000000·00000000·........#....... |
| 5 | ··0x0009 | 5 | ··0x0009c32c·01000000·03000000·04000000·00000000·................ |
| 6 | ··0x0009 | 6 | ··0x0009c33c·40000000·00000000·00000100·0f000000·@............... |
| 7 | ··0x0009 | 7 | ··0x0009c34c·11000000·12000000·23000000·00000000·........#....... |
| 8 | ··0x0009 | 8 | ··0x0009c35c·00000100·01000000·02000000·03000000·................ |
| 9 | ··0x0009 | 9 | ··0x0009c36c·23000000·00000000·00000000·01000000·#............... |
| 10 | ··0x0009 | 10 | ··0x0009c37c·04000000·05000000·23000000·00000000·........#....... |
| 11 | ··0x0009 | 11 | ··0x0009c38c·1f8b0804·00000000·00ff0600·42430200·............BC.. |
| 12 | ··0x0009 | 12 | ··0x0009c39c·1b000300·00000000·00000000··········............ |
| Offset 1, 8 lines modified | Offset 1, 8 lines modified | ||
| 1 | Hex·dump·of·section·'.gnu_debugaltlink': | 1 | Hex·dump·of·section·'.gnu_debugaltlink': |
| 2 | ··0x00000000·2f757372·2f6c6962·2f646562·75672f2e·/usr/lib/debug/. | 2 | ··0x00000000·2f757372·2f6c6962·2f646562·75672f2e·/usr/lib/debug/. |
| 3 | ··0x00000010·64777a2f·69333836·2d6c696e·75782d67·dwz/i386-linux-g | 3 | ··0x00000010·64777a2f·69333836·2d6c696e·75782d67·dwz/i386-linux-g |
| 4 | ··0x00000020·6e752f74·76632e64·65627567·00 | 4 | ··0x00000020·6e752f74·76632e64·65627567·00baab79·nu/tvc.debug...y |
| 5 | ··0x00000030· | 5 | ··0x00000030·896f6c2f·e012d0a5·f1bd009f·e4175a15·.ol/..........Z. |
| 6 | ··0x00000040· | 6 | ··0x00000040·a6··································. |
| Offset 1, 7 lines modified | Offset 1, 7 lines modified | ||
| 1 | Hex·dump·of·section·'.gnu_debuglink': | 1 | Hex·dump·of·section·'.gnu_debuglink': |
| 2 | ··0x00000000·32343131·34306430·39633662·37613266·241140d09c6b7a2f | ||
| 3 | ··0x000000 | 2 | ··0x00000000·63333561·32653539·33613139·63373630·c35a2e593a19c760 |
| 3 | ··0x00000010·35396330·36616638·33373463·63613264·59c06af8374cca2d | ||
| 4 | ··0x00000020·6 | 4 | ··0x00000020·63353362·36302e64·65627567·00000000·c53b60.debug.... |
| 5 | ··0x00000030· | 5 | ··0x00000030·ffe792f4····························.... |
| Offset 1, 3 lines modified | Offset 1, 3 lines modified | ||
| 1 | -rw-r--r--···0········0········0········4·2022-09-05·17:20:03.000000·debian-binary | 1 | -rw-r--r--···0········0········0········4·2022-09-05·17:20:03.000000·debian-binary |
| 2 | -rw-r--r--···0········0········0······70 | 2 | -rw-r--r--···0········0········0······708·2022-09-05·17:20:03.000000·control.tar.xz |
| 3 | -rw-r--r--···0········0········0·11 | 3 | -rw-r--r--···0········0········0·11471588·2022-09-05·17:20:03.000000·data.tar.xz |
| Offset 1, 12 lines modified | Offset 1, 12 lines modified | ||
| 1 | Package:·tvc-dbgsym | 1 | Package:·tvc-dbgsym |
| 2 | Source:·tvc | 2 | Source:·tvc |
| 3 | Version:·5.0.3+git20151221.80e144e+dfsg-5 | 3 | Version:·5.0.3+git20151221.80e144e+dfsg-5 |
| 4 | Auto-Built-Package:·debug-symbols | 4 | Auto-Built-Package:·debug-symbols |
| 5 | Architecture:·i386 | 5 | Architecture:·i386 |
| 6 | Maintainer:·Debian·Med·Packaging·Team·<debian-med-packaging@lists.alioth.debian.org> | 6 | Maintainer:·Debian·Med·Packaging·Team·<debian-med-packaging@lists.alioth.debian.org> |
| 7 | Installed-Size:·11 | 7 | Installed-Size:·11508 |
| 8 | Depends:·tvc·(=·5.0.3+git20151221.80e144e+dfsg-5) | 8 | Depends:·tvc·(=·5.0.3+git20151221.80e144e+dfsg-5) |
| 9 | Section:·debug | 9 | Section:·debug |
| 10 | Priority:·optional | 10 | Priority:·optional |
| 11 | Description:·debug·symbols·for·tvc | 11 | Description:·debug·symbols·for·tvc |
| 12 | Build-Ids:· | 12 | Build-Ids:·75c35a2e593a19c76059c06af8374cca2dc53b60·7f881d3d0ddd19d7d9be275b50257cc1b12b65cc·94b56f66fe5cec5e6f031245f840bcf70e13ee39 |
| Offset 1, 4 lines modified | Offset 1, 4 lines modified | ||
| 1 | usr/lib/debug/.build-id/95/241140d09c6b7a2f83cc09d3eec4dab4e1079d.debug | ||
| 2 | usr/lib/debug/.build-id/ea/5d6d95ebf52f3ee79e4df76b44ac39c7f46021.debug | ||
| 3 | usr/lib/debug/.build-id/ | 1 | usr/lib/debug/.build-id/75/c35a2e593a19c76059c06af8374cca2dc53b60.debug |
| 2 | usr/lib/debug/.build-id/7f/881d3d0ddd19d7d9be275b50257cc1b12b65cc.debug | ||
| 3 | usr/lib/debug/.build-id/94/b56f66fe5cec5e6f031245f840bcf70e13ee39.debug | ||
| 4 | usr/lib/debug/.dwz/i386-linux-gnu/tvc.debug | 4 | usr/lib/debug/.dwz/i386-linux-gnu/tvc.debug |
| Offset 1, 16 lines modified | Offset 1, 17 lines modified | ||
| 1 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./ | 1 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./ |
| 2 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/ | 2 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/ |
| 3 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/lib/ | 3 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/lib/ |
| 4 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/lib/debug/ | 4 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/lib/debug/ |
| 5 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/lib/debug/.build-id/ | 5 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/lib/debug/.build-id/ |
| 6 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/lib/debug/.build-id/ | 6 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/lib/debug/.build-id/75/ |
| 7 | -rw-r--r--···0·root·········(0)·root·········(0)··2 | 7 | -rw-r--r--···0·root·········(0)·root·········(0)··2393476·2022-09-05·17:20:03.000000·./usr/lib/debug/.build-id/75/c35a2e593a19c76059c06af8374cca2dc53b60.debug |
| 8 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/lib/debug/.build-id/ | 8 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/lib/debug/.build-id/7f/ |
| 9 | -rw-r--r--···0·root·········(0)·root·········(0)···835008·2022-09-05·17:20:03.000000·./usr/lib/debug/.build-id/7f/881d3d0ddd19d7d9be275b50257cc1b12b65cc.debug | ||
| 10 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/lib/debug/.build-id/94/ | ||
| 9 | -rw-r--r--···0·root·········(0)·root·········(0)·· | 11 | -rw-r--r--···0·root·········(0)·root·········(0)··8068744·2022-09-05·17:20:03.000000·./usr/lib/debug/.build-id/94/b56f66fe5cec5e6f031245f840bcf70e13ee39.debug |
| 10 | -rw-r--r--···0·root·········(0)·root·········(0)···842024·2022-09-05·17:20:03.000000·./usr/lib/debug/.build-id/ea/eebfa475cf9af8c59d9de78ebf1046ae8f155f.debug | ||
| 11 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/lib/debug/.dwz/ | 12 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/lib/debug/.dwz/ |
| 12 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/lib/debug/.dwz/i386-linux-gnu/ | 13 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/lib/debug/.dwz/i386-linux-gnu/ |
| 13 | -rw-r--r--···0·root·········(0)·root·········(0)···470 | 14 | -rw-r--r--···0·root·········(0)·root·········(0)···470984·2022-09-05·17:20:03.000000·./usr/lib/debug/.dwz/i386-linux-gnu/tvc.debug |
| 14 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/share/ | 15 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/share/ |
| 15 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/share/doc/ | 16 | drwxr-xr-x···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/share/doc/ |
| 16 | lrwxrwxrwx···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/share/doc/tvc-dbgsym·->·tvc | 17 | lrwxrwxrwx···0·root·········(0)·root·········(0)········0·2022-09-05·17:20:03.000000·./usr/share/doc/tvc-dbgsym·->·tvc |
| Offset 6, 15 lines modified | Offset 6, 15 lines modified | ||
| 6 | ··OS/ABI:····························UNIX·-·GNU | 6 | ··OS/ABI:····························UNIX·-·GNU |
| 7 | ··ABI·Version:·······················0 | 7 | ··ABI·Version:·······················0 |
| 8 | ··Type:······························REL·(Relocatable·file) | 8 | ··Type:······························REL·(Relocatable·file) |
| 9 | ··Machine:···························Intel·80386 | 9 | ··Machine:···························Intel·80386 |
| 10 | ··Version:···························0x1 | 10 | ··Version:···························0x1 |
| 11 | ··Entry·point·address:···············0x0 | 11 | ··Entry·point·address:···············0x0 |
| 12 | ··Start·of·program·headers:··········0·(bytes·into·file) | 12 | ··Start·of·program·headers:··········0·(bytes·into·file) |
| 13 | ··Start·of·section·headers:··········470 | 13 | ··Start·of·section·headers:··········470704·(bytes·into·file) |
| 14 | ··Flags:·····························0x0 | 14 | ··Flags:·····························0x0 |
| 15 | ··Size·of·this·header:···············52·(bytes) | 15 | ··Size·of·this·header:···············52·(bytes) |
| 16 | ··Size·of·program·headers:···········0·(bytes) | 16 | ··Size·of·program·headers:···········0·(bytes) |
| 17 | ··Number·of·program·headers:·········0 | 17 | ··Number·of·program·headers:·········0 |
| 18 | ··Size·of·section·headers:···········40·(bytes) | 18 | ··Size·of·section·headers:···········40·(bytes) |
| 19 | ··Number·of·section·headers:·········7 | 19 | ··Number·of·section·headers:·········7 |
| 20 | ··Section·header·string·table·index:·6 | 20 | ··Section·header·string·table·index:·6 |
| Offset 1, 16 lines modified | Offset 1, 16 lines modified | ||
| 1 | There·are·7·section·headers,·starting·at·offset·0x72 | 1 | There·are·7·section·headers,·starting·at·offset·0x72eb0: |
| 2 | Section·Headers: | 2 | Section·Headers: |
| 3 | ··[Nr]·Name··············Type············Addr·····Off····Size···ES·Flg·Lk·Inf·Al | 3 | ··[Nr]·Name··············Type············Addr·····Off····Size···ES·Flg·Lk·Inf·Al |
| 4 | ··[·0]···················NULL············00000000·000000·000000·00······0···0··0 | 4 | ··[·0]···················NULL············00000000·000000·000000·00······0···0··0 |
| 5 | ··[·1]·.note.gnu.build-id·NOTE············00000000·000034·000024·00······0···0··4 | 5 | ··[·1]·.note.gnu.build-id·NOTE············00000000·000034·000024·00······0···0··4 |
| 6 | ··[·2]·.debug_info·······PROGBITS········00000000·000058·056a | 6 | ··[·2]·.debug_info·······PROGBITS········00000000·000058·056ae8·00···C··0···0··4 |
| 7 | ··[·3]·.debug_abbrev·····PROGBITS········00000000·056 | 7 | ··[·3]·.debug_abbrev·····PROGBITS········00000000·056b40·002236·00···C··0···0··4 |
| 8 | ··[·4]·.debug_line·······PROGBITS········00000000·058 | 8 | ··[·4]·.debug_line·······PROGBITS········00000000·058d78·0004b7·00···C··0···0··4 |
| 9 | ··[·5]·.debug_str········PROGBITS········00000000·059 | 9 | ··[·5]·.debug_str········PROGBITS········00000000·059230·019c30·01·MSC··0···0··4 |
| 10 | ··[·6]·.shstrtab·········STRTAB··········00000000·072 | 10 | ··[·6]·.shstrtab·········STRTAB··········00000000·072e60·00004f·00······0···0··1 |
| 11 | Key·to·Flags: | 11 | Key·to·Flags: |
| 12 | ··W·(write),·A·(alloc),·X·(execute),·M·(merge),·S·(strings),·I·(info), | 12 | ··W·(write),·A·(alloc),·X·(execute),·M·(merge),·S·(strings),·I·(info), |
| 13 | ··L·(link·order),·O·(extra·OS·processing·required),·G·(group),·T·(TLS), | 13 | ··L·(link·order),·O·(extra·OS·processing·required),·G·(group),·T·(TLS), |
| 14 | ··C·(compressed),·x·(unknown),·o·(OS·specific),·E·(exclude), | 14 | ··C·(compressed),·x·(unknown),·o·(OS·specific),·E·(exclude), |
| 15 | ··R·(retain),·D·(mbind),·p·(processor·specific) | 15 | ··R·(retain),·D·(mbind),·p·(processor·specific) |
| Offset 1, 4 lines modified | Offset 1, 4 lines modified | ||
| 1 | Displaying·notes·found·in:·.note.gnu.build-id | 1 | Displaying·notes·found·in:·.note.gnu.build-id |
| 2 | ··Owner················Data·size·» Description | 2 | ··Owner················Data·size·» Description |
| 3 | ··GNU··················0x00000014» NT_GNU_BUILD_ID·(unique·build·ID·bitstring)» ····Build·ID:· | 3 | ··GNU··················0x00000014» NT_GNU_BUILD_ID·(unique·build·ID·bitstring)» ····Build·ID:·baab79896f6c2fe012d0a5f1bd009fe4175a15a6 |
| Offset 1, 15 lines modified | Offset 1, 15 lines modified | ||
| 1 | Raw·dump·of·debug·contents·of·section·.debug_line: | 1 | Raw·dump·of·debug·contents·of·section·.debug_line: |
| 2 | ··Offset:······················0 | 2 | ··Offset:······················0 |
| 3 | ··Length:······················27 | 3 | ··Length:······················2753 |
| 4 | ··DWARF·Version:···············5 | 4 | ··DWARF·Version:···············5 |
| 5 | ··Address·size·(bytes):········4 | 5 | ··Address·size·(bytes):········4 |
| 6 | ··Segment·selector·(bytes):····0 | 6 | ··Segment·selector·(bytes):····0 |
| 7 | ··Prologue·Length:·············27 | 7 | ··Prologue·Length:·············2745 |
| 8 | ··Minimum·Instruction·Length:··1 | 8 | ··Minimum·Instruction·Length:··1 |
| 9 | ··Maximum·Ops·per·Instruction:·1 | 9 | ··Maximum·Ops·per·Instruction:·1 |
| 10 | ··Initial·value·of·'is_stmt':··1 | 10 | ··Initial·value·of·'is_stmt':··1 |
| 11 | ··Line·Base:···················0 | 11 | ··Line·Base:···················0 |
| 12 | ··Line·Range:··················1 | 12 | ··Line·Range:··················1 |
| 13 | ··Opcode·Base:·················1 | 13 | ··Opcode·Base:·················1 |
| Offset 34, 15 lines modified | Offset 34, 15 lines modified | ||
| 34 | ··14» (string)» ./external/vcflib | 34 | ··14» (string)» ./external/vcflib |
| 35 | ··15» (string)» /usr/include/jsoncpp/json | 35 | ··15» (string)» /usr/include/jsoncpp/json |
| 36 | ··16» (string)» ./obj-i686-linux-gnu | 36 | ··16» (string)» ./obj-i686-linux-gnu |
| 37 | ··17» (string)» /usr/include/i386-linux-gnu/sys | 37 | ··17» (string)» /usr/include/i386-linux-gnu/sys |
| 38 | ··18» (string)» ./Util | 38 | ··18» (string)» ./Util |
| 39 | ··19» (string)» . | 39 | ··19» (string)» . |
| 40 | ·The·File·Name·Table·(offset·0x1ee,·lines·17 | 40 | ·The·File·Name·Table·(offset·0x1ee,·lines·175,·columns·2): |
| 41 | ··Entry» Dir» Name | 41 | ··Entry» Dir» Name |
| 42 | ··0» (udata)» 0» (string)» <dwz> | 42 | ··0» (udata)» 0» (string)» <dwz> |
| 43 | ··1» (udata)» 1» (string)» stddef.h | 43 | ··1» (udata)» 1» (string)» stddef.h |
| 44 | ··2» (udata)» 2» (string)» struct_FILE.h | 44 | ··2» (udata)» 2» (string)» struct_FILE.h |
| 45 | ··3» (udata)» 2» (string)» FILE.h | 45 | ··3» (udata)» 2» (string)» FILE.h |
| 46 | ··4» (udata)» 3» (string)» types.h | 46 | ··4» (udata)» 3» (string)» types.h |
| 47 | ··5» (udata)» 3» (string)» stdint-uintn.h | 47 | ··5» (udata)» 3» (string)» stdint-uintn.h |
| Offset 74, 145 lines modified | Offset 74, 146 lines modified | ||
| 74 | ··31» (udata)» 6» (string)» wctype.h | 74 | ··31» (udata)» 6» (string)» wctype.h |
| 75 | ··32» (udata)» 4» (string)» type_traits | 75 | ··32» (udata)» 4» (string)» type_traits |
| 76 | ··33» (udata)» 4» (string)» new | 76 | ··33» (udata)» 4» (string)» new |
| 77 | ··34» (udata)» 7» (string)» stl_iterator_base_types.h | 77 | ··34» (udata)» 7» (string)» stl_iterator_base_types.h |
| 78 | ··35» (udata)» 4» (string)» cstring | 78 | ··35» (udata)» 4» (string)» cstring |
| 79 | ··36» (udata)» 6» (string)» string.h | 79 | ··36» (udata)» 6» (string)» string.h |
| 80 | ··37» (udata)» 7» (string)» std_abs.h | 80 | ··37» (udata)» 7» (string)» std_abs.h |
| 81 | ··38» (udata)» 4» (string)» cstddef | ||
| 81 | ··3 | 82 | ··39» (udata)» 4» (string)» stdlib.h |
| 82 | ·· | 83 | ··40» (udata)» 7» (string)» functexcept.h |
| 83 | ··4 | 84 | ··41» (udata)» 8» (string)» BamConstants.h |
| 84 | ··4 | 85 | ··42» (udata)» 7» (string)» stl_algobase.h |
| 85 | ··4 | 86 | ··43» (udata)» 8» (string)» BamAux.h |
| 86 | ··4 | 87 | ··44» (udata)» 9» (string)» execution_defs.h |
| 87 | ··4 | 88 | ··45» (udata)» 4» (string)» initializer_list |
| 88 | ··4 | 89 | ··46» (udata)» 7» (string)» new_allocator.h |
| 89 | ··4 | 90 | ··47» (udata)» 7» (string)» allocator.h |
| 90 | ··4 | 91 | ··48» (udata)» 7» (string)» char_traits.h |
| 91 | ··4 | 92 | ··49» (udata)» 7» (string)» ptr_traits.h |
| 92 | ·· | 93 | ··50» (udata)» 7» (string)» stl_tree.h |
| 93 | ··5 | 94 | ··51» (udata)» 7» (string)» stl_pair.h |
| 94 | ··5 | 95 | ··52» (udata)» 7» (string)» stl_iterator_base_funcs.h |
| 95 | ··5 | 96 | ··53» (udata)» 2» (string)» struct_timespec.h |
| 96 | ··5 | 97 | ··54» (udata)» 3» (string)» struct_stat.h |
| 97 | ··5 | 98 | ··55» (udata)» 10» (string)» BAMWalkerEngine.h |
| 98 | ··5 | 99 | ··56» (udata)» 7» (string)» alloc_traits.h |
| 99 | ··5 | 100 | ··57» (udata)» 11» (string)» alloc_traits.h |
| 100 | ··5 | 101 | ··58» (udata)» 7» (string)» stl_list.h |
| 101 | ··5 | 102 | ··59» (udata)» 10» (string)» TargetsManager.h |
| 102 | ·· | 103 | ··60» (udata)» 7» (string)» stl_construct.h |
| 103 | ··6 | 104 | ··61» (udata)» 3» (string)» thread-shared-types.h |
| 104 | ··6 | 105 | ··62» (udata)» 3» (string)» struct_mutex.h |
| 105 | ··6 | 106 | ··63» (udata)» 3» (string)» pthreadtypes.h |
| 106 | ··6 | 107 | ··64» (udata)» 6» (string)» time.h |
| 107 | ··6 | 108 | ··65» (udata)» 1» (string)» stdarg.h |
| 108 | ··6 | 109 | ··66» (udata)» 7» (string)» exception_ptr.h |
| 109 | ··6 | 110 | ··67» (udata)» 7» (string)» stl_vector.h |
| 110 | ··6 | 111 | ··68» (udata)» 7» (string)» uses_allocator.h |
| 111 | ··6 | 112 | ··69» (udata)» 4» (string)» tuple |
| 112 | ·· | 113 | ··70» (udata)» 7» (string)» utility.h |
| 113 | ··7 | 114 | ··71» (udata)» 7» (string)» postypes.h |
| 114 | ··7 | 115 | ··72» (udata)» 7» (string)» ios_base.h |
| 115 | ··7 | 116 | ··73» (udata)» 5» (string)» atomic_word.h |
| 116 | ··7 | 117 | ··74» (udata)» 7» (string)» locale_facets.h |
| 117 | ··7 | 118 | ··75» (udata)» 7» (string)» basic_ios.h |
| 118 | ··7 | 119 | ··76» (udata)» 7» (string)» vector.tcc |
| 119 | ··7 | 120 | ··77» (udata)» 3» (string)» stdio2-decl.h |
| 120 | ··7 | 121 | ··78» (udata)» 7» (string)» shared_ptr_base.h |
| 121 | ··7 | 122 | ··79» (udata)» 11» (string)» concurrence.h |
| 122 | ·· | 123 | ··80» (udata)» 12» (string)» Mosaik.h |
| 123 | ··8 | 124 | ··81» (udata)» 13» (string)» bgzf.h |
| 124 | ··8 | 125 | ··82» (udata)» 13» (string)» tabix.h |
| 125 | ··8 | 126 | ··83» (udata)» 14» (string)» Variant.h |
| 126 | ··8 | 127 | ··84» (udata)» 7» (string)» unique_ptr.h |
| 127 | ··8 | 128 | ··85» (udata)» 15» (string)» value.h |
| 128 | ··8 | 129 | ··86» (udata)» 15» (string)» config.h |
| 129 | ··8 | 130 | ··87» (udata)» 15» (string)» forwards.h |
| 130 | ··8 | 131 | ··88» (udata)» 4» (string)» cmath |
| 131 | ··8 | 132 | ··89» (udata)» 6» (string)» math.h |
| 132 | ·· | 133 | ··90» (udata)» 4» (string)» math.h |
| 133 | ··9 | 134 | ··91» (udata)» 4» (string)» ctime |
| 134 | ··9 | 135 | ··92» (udata)» 2» (string)» clock_t.h |
| 135 | ··9 | 136 | ··93» (udata)» 5» (string)» c++io.h |
| 136 | ··9 | 137 | ··94» (udata)» 4» (string)» iostream |
| 137 | ··9 | 138 | ··95» (udata)» 7» (string)» stl_algo.h |
| 138 | ··9 | 139 | ··96» (udata)» 4» (string)» string_view |
| 139 | ··9 | 140 | ··97» (udata)» 3» (string)» string_fortified.h |
| 140 | ··9 | 141 | ··98» (udata)» 7» (string)» ostream.tcc |
| 141 | ··9 | 142 | ··99» (udata)» 4» (string)» ostream |
| 142 | ·· | 143 | ··100» (udata)» 4» (string)» iosfwd |
| 143 | ··10 | 144 | ··101» (udata)» 7» (string)» ostream_insert.h |
| 144 | ··10 | 145 | ··102» (udata)» 6» (string)» assert.h |
| 145 | ··10 | 146 | ··103» (udata)» 4» (string)» istream |
| 146 | ··10 | 147 | ··104» (udata)» 7» (string)» stl_uninitialized.h |
| 147 | ··10 | 148 | ··105» (udata)» 7» (string)» cpp_type_traits.h |
| 148 | ··10 | 149 | ··106» (udata)» 7» (string)» move.h |
| 149 | ··10 | 150 | ··107» (udata)» 13» (string)» khash.h |
| 150 | ··10 | 151 | ··108» (udata)» 16» (string)» <built-in> |
| 151 | ··10 | 152 | ··109» (udata)» 17» (string)» stat.h |
| 152 | ··1 | 153 | ··110» (udata)» 3» (string)» fcntl2.h |
| 153 | ··11 | 154 | ··111» (udata)» 6» (string)» unistd.h |
| 154 | ··11 | 155 | ··112» (udata)» 17» (string)» mman.h |
| 155 | ··11 | 156 | ··113» (udata)» 7» (string)» stl_deque.h |
| 156 | ··11 | 157 | ··114» (udata)» 7» (string)» basic_string.h |
| 157 | ··11 | 158 | ··115» (udata)» 7» (string)» basic_string.tcc |
| 158 | ··11 | 159 | ··116» (udata)» 7» (string)» stringfwd.h |
| 159 | ··11 | 160 | ··117» (udata)» 7» (string)» stl_function.h |
| 160 | ··11 | 161 | ··118» (udata)» 7» (string)» stl_map.h |
| 161 | ··11 | 162 | ··119» (udata)» 7» (string)» basic_ios.tcc |
| 162 | ··1 | 163 | ··120» (udata)» 7» (string)» stl_iterator.h |
| 163 | ··12 | 164 | ··121» (udata)» 11» (string)» aligned_buffer.h |
| 164 | ··12 | 165 | ··122» (udata)» 8» (string)» SamProgram.h |
| 165 | ··12 | 166 | ··123» (udata)» 8» (string)» SamProgramChain.h |
| 166 | ··12 | 167 | ··124» (udata)» 8» (string)» SamReadGroup.h |
| 167 | ··12 | 168 | ··125» (udata)» 8» (string)» SamReadGroupDictionary.h |
| Max diff block lines reached; 29/11873 bytes (0.24%) of diff not shown. | |||
| Offset 1, 530 lines modified | Offset 1, 530 lines modified | ||
| 1 | Contents·of·the·.debug_info·section: | 1 | Contents·of·the·.debug_info·section: |
| 2 | ··Compilation·Unit·@·offset·0: | 2 | ··Compilation·Unit·@·offset·0: |
| 3 | ···Length:········0x211·(32-bit) | 3 | ···Length:········0x211·(32-bit) |
| 4 | ···Version:·······5 | 4 | ···Version:·······5 |
| 5 | ···Unit·Type:·····DW_UT_partial·(3) | 5 | ···Unit·Type:·····DW_UT_partial·(3) |
| 6 | ···Abbrev·Offset:·0 | 6 | ···Abbrev·Offset:·0 |
| 7 | ···Pointer·Size:··4 | 7 | ···Pointer·Size:··4 |
| 8 | ·<0><c>:·Abbrev·Number:·1·(DW_TAG_partial_unit) | 8 | ·<0><c>:·Abbrev·Number:·1·(DW_TAG_partial_unit) |
| 9 | ····<d>···DW_AT_stmt_list···:·(sec_offset)·0 | 9 | ····<d>···DW_AT_stmt_list···:·(sec_offset)·0 |
| 10 | ·<1><11>:·Abbrev·Number:· | 10 | ·<1><11>:·Abbrev·Number:·2·(DW_TAG_typedef) |
| 11 | ····<12>···DW_AT_name········:·(strp)·(offset:·0xe3c8 | 11 | ····<12>···DW_AT_name········:·(strp)·(offset:·0xe3c88):·size_t |
| 12 | ····<16>···DW_AT_decl_file···:·(data1)·1 | 12 | ····<16>···DW_AT_decl_file···:·(data1)·1 |
| 13 | ····<17>···DW_AT_decl_line···:·(data1)·214 | 13 | ····<17>···DW_AT_decl_line···:·(data1)·214 |
| 14 | ····<18>···DW_AT_decl_column·:·(data1)·23 | 14 | ····<18>···DW_AT_decl_column·:·(data1)·23 |
| 15 | ····<19>···DW_AT_type········:·(ref_udata)·<0x1a>,·unsigned·int | 15 | ····<19>···DW_AT_type········:·(ref_udata)·<0x1a>,·unsigned·int |
| 16 | ·<1><1a>:·Abbrev·Number:· | 16 | ·<1><1a>:·Abbrev·Number:·64·(DW_TAG_base_type) |
| 17 | ····<1b>···DW_AT_byte_size···:·(data1)·4 | 17 | ····<1b>···DW_AT_byte_size···:·(data1)·4 |
| 18 | ····<1c>···DW_AT_encoding····:·(data1)·7» (unsigned) | 18 | ····<1c>···DW_AT_encoding····:·(data1)·7» (unsigned) |
| 19 | ····<1d>···DW_AT_name········:·(strp)·(offset:·0xe457 | 19 | ····<1d>···DW_AT_name········:·(strp)·(offset:·0xe457b):·unsigned·int |
| 20 | ·<1><21>:·Abbrev·Number:· | 20 | ·<1><21>:·Abbrev·Number:·64·(DW_TAG_base_type) |
| 21 | ····<22>···DW_AT_byte_size···:·(data1)·1 | 21 | ····<22>···DW_AT_byte_size···:·(data1)·1 |
| 22 | ····<23>···DW_AT_encoding····:·(data1)·6» (signed·char) | 22 | ····<23>···DW_AT_encoding····:·(data1)·6» (signed·char) |
| 23 | ····<24>···DW_AT_name········:·(strp)·(offset:·0xe2541):·char | 23 | ····<24>···DW_AT_name········:·(strp)·(offset:·0xe2541):·char |
| 24 | ·<1><28>:·Abbrev·Number:· | 24 | ·<1><28>:·Abbrev·Number:·34·(DW_TAG_const_type) |
| 25 | ····<29>···DW_AT_type········:·(ref_udata)·<0x21>,·char | 25 | ····<29>···DW_AT_type········:·(ref_udata)·<0x21>,·char |
| 26 | ·<1><2a>:·Abbrev·Number:· | 26 | ·<1><2a>:·Abbrev·Number:·68·(DW_TAG_base_type) |
| 27 | ····<2b>···DW_AT_byte_size···:·(data1)·4 | 27 | ····<2b>···DW_AT_byte_size···:·(data1)·4 |
| 28 | ····<2c>···DW_AT_encoding····:·(data1)·5» (signed) | 28 | ····<2c>···DW_AT_encoding····:·(data1)·5» (signed) |
| 29 | ····<2d>···DW_AT_name········:·(string)·int | 29 | ····<2d>···DW_AT_name········:·(string)·int |
| 30 | ·<1><31>:·Abbrev·Number:· | 30 | ·<1><31>:·Abbrev·Number:·60·(DW_TAG_structure_type) |
| 31 | ····<32>···DW_AT_name········:·(strp)·(offset:·0x4ae08):·_IO_FILE | 31 | ····<32>···DW_AT_name········:·(strp)·(offset:·0x4ae08):·_IO_FILE |
| 32 | ····<36>···DW_AT_byte_size···:·(data1)·148 | 32 | ····<36>···DW_AT_byte_size···:·(data1)·148 |
| 33 | ····<37>···DW_AT_decl_file···:·(data1)·2 | 33 | ····<37>···DW_AT_decl_file···:·(data1)·2 |
| 34 | ····<38>···DW_AT_decl_line···:·(data1)·49 | 34 | ····<38>···DW_AT_decl_line···:·(data1)·49 |
| 35 | ····<39>···DW_AT_decl_column·:·(data1)·8 | 35 | ····<39>···DW_AT_decl_column·:·(data1)·8 |
| 36 | ····<3a>···DW_AT_sibling·····:·(ref_udata)·<0x177> | 36 | ····<3a>···DW_AT_sibling·····:·(ref_udata)·<0x177> |
| 37 | ·<2><3c>:·Abbrev·Number:· | 37 | ·<2><3c>:·Abbrev·Number:·65·(DW_TAG_member) |
| 38 | ····<3d>···DW_AT_name········:·(strp)·(offset:·0xe353 | 38 | ····<3d>···DW_AT_name········:·(strp)·(offset:·0xe353e):·_flags |
| 39 | ····<41>···DW_AT_decl_file···:·(data1)·2 | 39 | ····<41>···DW_AT_decl_file···:·(data1)·2 |
| 40 | ····<42>···DW_AT_decl_line···:·(data1)·51 | 40 | ····<42>···DW_AT_decl_line···:·(data1)·51 |
| 41 | ····<43>···DW_AT_decl_column·:·(data1)·7 | 41 | ····<43>···DW_AT_decl_column·:·(data1)·7 |
| 42 | ····<44>···DW_AT_type········:·(ref_udata)·<0x2a>,·int | 42 | ····<44>···DW_AT_type········:·(ref_udata)·<0x2a>,·int |
| 43 | ····<45>···DW_AT_data_member_location:·(data1)·0 | 43 | ····<45>···DW_AT_data_member_location:·(data1)·0 |
| 44 | ·<2><46>:·Abbrev·Number:· | 44 | ·<2><46>:·Abbrev·Number:·65·(DW_TAG_member) |
| 45 | ····<47>···DW_AT_name········:·(strp)·(offset:·0xe2e6e):·_IO_read_ptr | 45 | ····<47>···DW_AT_name········:·(strp)·(offset:·0xe2e6e):·_IO_read_ptr |
| 46 | ····<4b>···DW_AT_decl_file···:·(data1)·2 | 46 | ····<4b>···DW_AT_decl_file···:·(data1)·2 |
| 47 | ····<4c>···DW_AT_decl_line···:·(data1)·54 | 47 | ····<4c>···DW_AT_decl_line···:·(data1)·54 |
| 48 | ····<4d>···DW_AT_decl_column·:·(data1)·9 | 48 | ····<4d>···DW_AT_decl_column·:·(data1)·9 |
| 49 | ····<4e>···DW_AT_type········:·(ref_udata)·<0x189> | 49 | ····<4e>···DW_AT_type········:·(ref_udata)·<0x189> |
| 50 | ····<50>···DW_AT_data_member_location:·(data1)·4 | 50 | ····<50>···DW_AT_data_member_location:·(data1)·4 |
| 51 | ·<2><51>:·Abbrev·Number:· | 51 | ·<2><51>:·Abbrev·Number:·65·(DW_TAG_member) |
| 52 | ····<52>···DW_AT_name········:·(strp)·(offset:·0xc24fb):·_IO_read_end | 52 | ····<52>···DW_AT_name········:·(strp)·(offset:·0xc24fb):·_IO_read_end |
| 53 | ····<56>···DW_AT_decl_file···:·(data1)·2 | 53 | ····<56>···DW_AT_decl_file···:·(data1)·2 |
| 54 | ····<57>···DW_AT_decl_line···:·(data1)·55 | 54 | ····<57>···DW_AT_decl_line···:·(data1)·55 |
| 55 | ····<58>···DW_AT_decl_column·:·(data1)·9 | 55 | ····<58>···DW_AT_decl_column·:·(data1)·9 |
| 56 | ····<59>···DW_AT_type········:·(ref_udata)·<0x189> | 56 | ····<59>···DW_AT_type········:·(ref_udata)·<0x189> |
| 57 | ····<5b>···DW_AT_data_member_location:·(data1)·8 | 57 | ····<5b>···DW_AT_data_member_location:·(data1)·8 |
| 58 | ·<2><5c>:·Abbrev·Number:· | 58 | ·<2><5c>:·Abbrev·Number:·65·(DW_TAG_member) |
| 59 | ····<5d>···DW_AT_name········:·(strp)·(offset:·0xc3f98):·_IO_read_base | 59 | ····<5d>···DW_AT_name········:·(strp)·(offset:·0xc3f98):·_IO_read_base |
| 60 | ····<61>···DW_AT_decl_file···:·(data1)·2 | 60 | ····<61>···DW_AT_decl_file···:·(data1)·2 |
| 61 | ····<62>···DW_AT_decl_line···:·(data1)·56 | 61 | ····<62>···DW_AT_decl_line···:·(data1)·56 |
| 62 | ····<63>···DW_AT_decl_column·:·(data1)·9 | 62 | ····<63>···DW_AT_decl_column·:·(data1)·9 |
| 63 | ····<64>···DW_AT_type········:·(ref_udata)·<0x189> | 63 | ····<64>···DW_AT_type········:·(ref_udata)·<0x189> |
| 64 | ····<66>···DW_AT_data_member_location:·(data1)·12 | 64 | ····<66>···DW_AT_data_member_location:·(data1)·12 |
| 65 | ·<2><67>:·Abbrev·Number:· | 65 | ·<2><67>:·Abbrev·Number:·65·(DW_TAG_member) |
| 66 | ····<68>···DW_AT_name········:·(strp)·(offset:·0xcae2f):·_IO_write_base | 66 | ····<68>···DW_AT_name········:·(strp)·(offset:·0xcae2f):·_IO_write_base |
| 67 | ····<6c>···DW_AT_decl_file···:·(data1)·2 | 67 | ····<6c>···DW_AT_decl_file···:·(data1)·2 |
| 68 | ····<6d>···DW_AT_decl_line···:·(data1)·57 | 68 | ····<6d>···DW_AT_decl_line···:·(data1)·57 |
| 69 | ····<6e>···DW_AT_decl_column·:·(data1)·9 | 69 | ····<6e>···DW_AT_decl_column·:·(data1)·9 |
| 70 | ····<6f>···DW_AT_type········:·(ref_udata)·<0x189> | 70 | ····<6f>···DW_AT_type········:·(ref_udata)·<0x189> |
| 71 | ····<71>···DW_AT_data_member_location:·(data1)·16 | 71 | ····<71>···DW_AT_data_member_location:·(data1)·16 |
| 72 | ·<2><72>:·Abbrev·Number:· | 72 | ·<2><72>:·Abbrev·Number:·65·(DW_TAG_member) |
| 73 | ····<73>···DW_AT_name········:·(strp)·(offset:·0xe2e9c):·_IO_write_ptr | 73 | ····<73>···DW_AT_name········:·(strp)·(offset:·0xe2e9c):·_IO_write_ptr |
| 74 | ····<77>···DW_AT_decl_file···:·(data1)·2 | 74 | ····<77>···DW_AT_decl_file···:·(data1)·2 |
| 75 | ····<78>···DW_AT_decl_line···:·(data1)·58 | 75 | ····<78>···DW_AT_decl_line···:·(data1)·58 |
| 76 | ····<79>···DW_AT_decl_column·:·(data1)·9 | 76 | ····<79>···DW_AT_decl_column·:·(data1)·9 |
| 77 | ····<7a>···DW_AT_type········:·(ref_udata)·<0x189> | 77 | ····<7a>···DW_AT_type········:·(ref_udata)·<0x189> |
| 78 | ····<7c>···DW_AT_data_member_location:·(data1)·20 | 78 | ····<7c>···DW_AT_data_member_location:·(data1)·20 |
| 79 | ·<2><7d>:·Abbrev·Number:· | 79 | ·<2><7d>:·Abbrev·Number:·65·(DW_TAG_member) |
| 80 | ····<7e>···DW_AT_name········:·(strp)·(offset:·0xc252f):·_IO_write_end | 80 | ····<7e>···DW_AT_name········:·(strp)·(offset:·0xc252f):·_IO_write_end |
| 81 | ····<82>···DW_AT_decl_file···:·(data1)·2 | 81 | ····<82>···DW_AT_decl_file···:·(data1)·2 |
| 82 | ····<83>···DW_AT_decl_line···:·(data1)·59 | 82 | ····<83>···DW_AT_decl_line···:·(data1)·59 |
| 83 | ····<84>···DW_AT_decl_column·:·(data1)·9 | 83 | ····<84>···DW_AT_decl_column·:·(data1)·9 |
| 84 | ····<85>···DW_AT_type········:·(ref_udata)·<0x189> | 84 | ····<85>···DW_AT_type········:·(ref_udata)·<0x189> |
| 85 | ····<87>···DW_AT_data_member_location:·(data1)·24 | 85 | ····<87>···DW_AT_data_member_location:·(data1)·24 |
| 86 | ·<2><88>:·Abbrev·Number:· | 86 | ·<2><88>:·Abbrev·Number:·65·(DW_TAG_member) |
| 87 | ····<89>···DW_AT_name········:·(strp)·(offset:·0xcae59):·_IO_buf_base | 87 | ····<89>···DW_AT_name········:·(strp)·(offset:·0xcae59):·_IO_buf_base |
| 88 | ····<8d>···DW_AT_decl_file···:·(data1)·2 | 88 | ····<8d>···DW_AT_decl_file···:·(data1)·2 |
| 89 | ····<8e>···DW_AT_decl_line···:·(data1)·60 | 89 | ····<8e>···DW_AT_decl_line···:·(data1)·60 |
| 90 | ····<8f>···DW_AT_decl_column·:·(data1)·9 | 90 | ····<8f>···DW_AT_decl_column·:·(data1)·9 |
| 91 | ····<90>···DW_AT_type········:·(ref_udata)·<0x189> | 91 | ····<90>···DW_AT_type········:·(ref_udata)·<0x189> |
| 92 | ····<92>···DW_AT_data_member_location:·(data1)·28 | 92 | ····<92>···DW_AT_data_member_location:·(data1)·28 |
| 93 | ·<2><93>:·Abbrev·Number:· | 93 | ·<2><93>:·Abbrev·Number:·65·(DW_TAG_member) |
| 94 | ····<94>···DW_AT_name········:·(strp)·(offset:·0xc254a):·_IO_buf_end | 94 | ····<94>···DW_AT_name········:·(strp)·(offset:·0xc254a):·_IO_buf_end |
| 95 | ····<98>···DW_AT_decl_file···:·(data1)·2 | 95 | ····<98>···DW_AT_decl_file···:·(data1)·2 |
| 96 | ····<99>···DW_AT_decl_line···:·(data1)·61 | 96 | ····<99>···DW_AT_decl_line···:·(data1)·61 |
| 97 | ····<9a>···DW_AT_decl_column·:·(data1)·9 | 97 | ····<9a>···DW_AT_decl_column·:·(data1)·9 |
| 98 | ····<9b>···DW_AT_type········:·(ref_udata)·<0x189> | 98 | ····<9b>···DW_AT_type········:·(ref_udata)·<0x189> |
| 99 | ····<9d>···DW_AT_data_member_location:·(data1)·32 | 99 | ····<9d>···DW_AT_data_member_location:·(data1)·32 |
| 100 | ·<2><9e>:·Abbrev·Number:· | 100 | ·<2><9e>:·Abbrev·Number:·65·(DW_TAG_member) |
| 101 | ····<9f>···DW_AT_name········:·(strp)·(offset:·0xcae4b):·_IO_save_base | 101 | ····<9f>···DW_AT_name········:·(strp)·(offset:·0xcae4b):·_IO_save_base |
| 102 | ····<a3>···DW_AT_decl_file···:·(data1)·2 | 102 | ····<a3>···DW_AT_decl_file···:·(data1)·2 |
| 103 | ····<a4>···DW_AT_decl_line···:·(data1)·64 | 103 | ····<a4>···DW_AT_decl_line···:·(data1)·64 |
| 104 | ····<a5>···DW_AT_decl_column·:·(data1)·9 | 104 | ····<a5>···DW_AT_decl_column·:·(data1)·9 |
| 105 | ····<a6>···DW_AT_type········:·(ref_udata)·<0x189> | 105 | ····<a6>···DW_AT_type········:·(ref_udata)·<0x189> |
| 106 | ····<a8>···DW_AT_data_member_location:·(data1)·36 | 106 | ····<a8>···DW_AT_data_member_location:·(data1)·36 |
| 107 | ·<2><a9>:·Abbrev·Number:· | 107 | ·<2><a9>:·Abbrev·Number:·65·(DW_TAG_member) |
| 108 | ····<aa>···DW_AT_name········:·(strp)·(offset:·0xcae66):·_IO_backup_base | 108 | ····<aa>···DW_AT_name········:·(strp)·(offset:·0xcae66):·_IO_backup_base |
| 109 | ····<ae>···DW_AT_decl_file···:·(data1)·2 | 109 | ····<ae>···DW_AT_decl_file···:·(data1)·2 |
| 110 | ····<af>···DW_AT_decl_line···:·(data1)·65 | 110 | ····<af>···DW_AT_decl_line···:·(data1)·65 |
| 111 | ····<b0>···DW_AT_decl_column·:·(data1)·9 | 111 | ····<b0>···DW_AT_decl_column·:·(data1)·9 |
| 112 | ····<b1>···DW_AT_type········:·(ref_udata)·<0x189> | 112 | ····<b1>···DW_AT_type········:·(ref_udata)·<0x189> |
| 113 | ····<b3>···DW_AT_data_member_location:·(data1)·40 | 113 | ····<b3>···DW_AT_data_member_location:·(data1)·40 |
| 114 | ·<2><b4>:·Abbrev·Number:· | 114 | ·<2><b4>:·Abbrev·Number:·65·(DW_TAG_member) |
| 115 | ····<b5>···DW_AT_name········:·(strp)·(offset:·0xc253d):·_IO_save_end | 115 | ····<b5>···DW_AT_name········:·(strp)·(offset:·0xc253d):·_IO_save_end |
| 116 | ····<b9>···DW_AT_decl_file···:·(data1)·2 | 116 | ····<b9>···DW_AT_decl_file···:·(data1)·2 |
| 117 | ····<ba>···DW_AT_decl_line···:·(data1)·66 | 117 | ····<ba>···DW_AT_decl_line···:·(data1)·66 |
| 118 | ····<bb>···DW_AT_decl_column·:·(data1)·9 | 118 | ····<bb>···DW_AT_decl_column·:·(data1)·9 |
| 119 | ····<bc>···DW_AT_type········:·(ref_udata)·<0x189> | 119 | ····<bc>···DW_AT_type········:·(ref_udata)·<0x189> |
| 120 | ····<be>···DW_AT_data_member_location:·(data1)·44 | 120 | ····<be>···DW_AT_data_member_location:·(data1)·44 |
| 121 | ·<2><bf>:·Abbrev·Number:· | 121 | ·<2><bf>:·Abbrev·Number:·65·(DW_TAG_member) |
| 122 | ····<c0>···DW_AT_name········:·(strp)·(offset:·0xe38 | 122 | ····<c0>···DW_AT_name········:·(strp)·(offset:·0xe38b6):·_markers |
| 123 | ····<c4>···DW_AT_decl_file···:·(data1)·2 | 123 | ····<c4>···DW_AT_decl_file···:·(data1)·2 |
| 124 | ····<c5>···DW_AT_decl_line···:·(data1)·68 | 124 | ····<c5>···DW_AT_decl_line···:·(data1)·68 |
| 125 | ····<c6>···DW_AT_decl_column·:·(data1)·22 | 125 | ····<c6>···DW_AT_decl_column·:·(data1)·22 |
| 126 | ····<c7>···DW_AT_type········:·(ref_udata)·<0x1e9> | 126 | ····<c7>···DW_AT_type········:·(ref_udata)·<0x1e9> |
| Max diff block lines reached; 48747254/48754605 bytes (99.98%) of diff not shown. | |||
| Offset 1, 1004 lines modified | Offset 1, 977 lines modified | ||
| 1 | Contents·of·the·.debug_abbrev·section: | 1 | Contents·of·the·.debug_abbrev·section: |
| 2 | ··Number·TAG·(0) | 2 | ··Number·TAG·(0) |
| 3 | ···1······DW_TAG_partial_unit····[has·children] | 3 | ···1······DW_TAG_partial_unit····[has·children] |
| 4 | ····DW_AT_stmt_list····DW_FORM_sec_offset | 4 | ····DW_AT_stmt_list····DW_FORM_sec_offset |
| 5 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 5 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 6 | ···2······DW_TAG_ | 6 | ···2······DW_TAG_typedef····[no·children] |
| 7 | ····DW_AT_external·····DW_FORM_flag_present | ||
| 8 | ····DW_AT_name·········DW_FORM_strp | 7 | ····DW_AT_name·········DW_FORM_strp |
| 9 | ····DW_AT_decl_file····DW_FORM_data1 | 8 | ····DW_AT_decl_file····DW_FORM_data1 |
| 10 | ····DW_AT_decl_line····DW_FORM_data | 9 | ····DW_AT_decl_line····DW_FORM_data1 |
| 11 | ····DW_AT_decl_column··DW_FORM_data1 | 10 | ····DW_AT_decl_column··DW_FORM_data1 |
| 12 | ····DW_AT_linkage_name·DW_FORM_strp | ||
| 13 | ····DW_AT_accessibility·DW_FORM_data1 | ||
| 14 | ····DW_AT_declaration··DW_FORM_flag_present | ||
| 15 | ····DW_AT_object_pointer·DW_FORM_ref_udata | ||
| 16 | ····DW_AT_sibling······DW_FORM_ref_udata | ||
| 17 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| 18 | ···3······DW_TAG_inheritance····[no·children] | ||
| 19 | ····DW_AT_type·········DW_FORM_ref_udata | 11 | ····DW_AT_type·········DW_FORM_ref_udata |
| 20 | ····DW_AT_data_member_location·DW_FORM_data1 | ||
| 21 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 12 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 22 | ··· | 13 | ···3······DW_TAG_subprogram····[has·children] |
| 23 | ····DW_AT_external·····DW_FORM_flag_present | 14 | ····DW_AT_external·····DW_FORM_flag_present |
| 24 | ····DW_AT_name·········DW_FORM_strp | 15 | ····DW_AT_name·········DW_FORM_strp |
| 25 | ····DW_AT_decl_file····DW_FORM_data1 | 16 | ····DW_AT_decl_file····DW_FORM_data1 |
| 26 | ····DW_AT_decl_line····DW_FORM_data2 | 17 | ····DW_AT_decl_line····DW_FORM_data2 |
| 27 | ····DW_AT_decl_column··DW_FORM_data1 | 18 | ····DW_AT_decl_column··DW_FORM_data1 |
| 28 | ····DW_AT_linkage_name·DW_FORM_strp | 19 | ····DW_AT_linkage_name·DW_FORM_strp |
| 29 | ····DW_AT_type·········DW_FORM_ref_addr | 20 | ····DW_AT_type·········DW_FORM_ref_addr |
| 30 | ····DW_AT_declaration··DW_FORM_flag_present | 21 | ····DW_AT_declaration··DW_FORM_flag_present |
| 31 | ····DW_AT_sibling······DW_FORM_ref_udata | 22 | ····DW_AT_sibling······DW_FORM_ref_udata |
| 32 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 23 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 33 | ··· | 24 | ···4······DW_TAG_subprogram····[has·children] |
| 34 | ····DW_AT_external·····DW_FORM_flag_present | 25 | ····DW_AT_external·····DW_FORM_flag_present |
| 35 | ····DW_AT_name·········DW_FORM_strp | 26 | ····DW_AT_name·········DW_FORM_strp |
| 36 | ····DW_AT_decl_file····DW_FORM_data1 | 27 | ····DW_AT_decl_file····DW_FORM_data1 |
| 37 | ····DW_AT_decl_line····DW_FORM_data | 28 | ····DW_AT_decl_line····DW_FORM_data2 |
| 38 | ····DW_AT_decl_column··DW_FORM_data1 | 29 | ····DW_AT_decl_column··DW_FORM_data1 |
| 39 | ····DW_AT_ | 30 | ····DW_AT_type·········DW_FORM_ref_addr |
| 40 | ····DW_AT_declaration··DW_FORM_flag_present | 31 | ····DW_AT_declaration··DW_FORM_flag_present |
| 41 | ····DW_AT_object_pointer·DW_FORM_ref_udata | ||
| 42 | ····DW_AT_sibling······DW_FORM_ref_udata | 32 | ····DW_AT_sibling······DW_FORM_ref_udata |
| 43 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 33 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 44 | ··· | 34 | ···5······DW_TAG_formal_parameter····[no·children] |
| 45 | ····DW_AT_ | 35 | ····DW_AT_type·········DW_FORM_ref_udata |
| 36 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| 37 | ···6······DW_TAG_subroutine_type····[has·children] | ||
| 46 | ····DW_AT_type·········DW_FORM_ref_addr | 38 | ····DW_AT_type·········DW_FORM_ref_addr |
| 39 | ····DW_AT_sibling······DW_FORM_ref_udata | ||
| 47 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 40 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 48 | ···7······DW_TAG_subprogram····[has·children] | 41 | ···7······DW_TAG_subprogram····[has·children] |
| 49 | ····DW_AT_external·····DW_FORM_flag_present | 42 | ····DW_AT_external·····DW_FORM_flag_present |
| 50 | ····DW_AT_name·········DW_FORM_strp | 43 | ····DW_AT_name·········DW_FORM_strp |
| 51 | ····DW_AT_decl_file····DW_FORM_ | 44 | ····DW_AT_decl_file····DW_FORM_data1 |
| 52 | ····DW_AT_decl_line····DW_FORM_data | 45 | ····DW_AT_decl_line····DW_FORM_data1 |
| 53 | ····DW_AT_decl_column··DW_FORM_ | 46 | ····DW_AT_decl_column··DW_FORM_data1 |
| 54 | ····DW_AT_linkage_name·DW_FORM_strp | ||
| 55 | ····DW_AT_type·········DW_FORM_ref_ | 47 | ····DW_AT_type·········DW_FORM_ref_addr |
| 56 | ····DW_AT_declaration··DW_FORM_flag_present | 48 | ····DW_AT_declaration··DW_FORM_flag_present |
| 57 | ····DW_AT_deleted······DW_FORM_flag_present | ||
| 58 | ····DW_AT_object_pointer·DW_FORM_ref_udata | ||
| 59 | ····DW_AT_sibling······DW_FORM_ref_udata | 49 | ····DW_AT_sibling······DW_FORM_ref_udata |
| 60 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 50 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 61 | ···8······DW_TAG_ | 51 | ···8······DW_TAG_imported_declaration····[no·children] |
| 62 | ····DW_AT_type·········DW_FORM_ref_udata | ||
| 63 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| 64 | ···9······DW_TAG_subprogram····[has·children] | ||
| 65 | ····DW_AT_external·····DW_FORM_flag_present | ||
| 66 | ····DW_AT_name·········DW_FORM_strp | ||
| 67 | ····DW_AT_decl_file····DW_FORM_data1 | 52 | ····DW_AT_decl_file····DW_FORM_data1 |
| 68 | ····DW_AT_decl_line····DW_FORM_data2 | 53 | ····DW_AT_decl_line····DW_FORM_data2 |
| 69 | ····DW_AT_decl_column··DW_FORM_data1 | 54 | ····DW_AT_decl_column··DW_FORM_data1 |
| 70 | ····DW_AT_linkage_name·DW_FORM_strp | ||
| 71 | ····DW_AT_ | 55 | ····DW_AT_import·······DW_FORM_ref_udata |
| 72 | ····DW_AT_declaration··DW_FORM_flag_present | ||
| 73 | ····DW_AT_sibling······DW_FORM_ref_udata | ||
| 74 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 56 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 75 | ··· | 57 | ···9······DW_TAG_pointer_type····[no·children] |
| 58 | ····DW_AT_byte_size····DW_FORM_implicit_const:·4 | ||
| 59 | ····DW_AT_name·········DW_FORM_strp | ||
| 76 | ····DW_AT_type·········DW_FORM_ref_udata | 60 | ····DW_AT_type·········DW_FORM_ref_udata |
| 77 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 61 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 78 | ···1 | 62 | ···10······DW_TAG_unspecified_parameters····[no·children] |
| 79 | ····DW_AT_name·········DW_FORM_strp | ||
| 80 | ····DW_AT_type·········DW_FORM_ref_addr | ||
| 81 | ····DW_AT_const_value··DW_FORM_data1 | ||
| 82 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 63 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 83 | ···1 | 64 | ···11······DW_TAG_pointer_type····[no·children] |
| 84 | ····DW_AT_byte_size····DW_FORM_implicit_const:·4 | 65 | ····DW_AT_byte_size····DW_FORM_implicit_const:·4 |
| 85 | ····DW_AT_type·········DW_FORM_ref_udata | 66 | ····DW_AT_type·········DW_FORM_ref_udata |
| 86 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 67 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 87 | ···13······DW_TAG_subprogram····[has·children] | ||
| 88 | ····DW_A | 68 | ···12······DW_TAG_pointer_type····[no·children] |
| 69 | ····DW_AT_byte_size····DW_FORM_implicit_const:·4 | ||
| 89 | ····DW_AT_name·········DW_FORM_strp | 70 | ····DW_AT_name·········DW_FORM_strp |
| 71 | ····DW_AT_type·········DW_FORM_ref_addr | ||
| 72 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| 73 | ···13······DW_TAG_namespace····[has·children] | ||
| 74 | ····DW_AT_name·········DW_FORM_string | ||
| 75 | ····DW_AT_sibling······DW_FORM_ref_udata | ||
| 76 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| 77 | ···14······DW_TAG_imported_declaration····[no·children] | ||
| 90 | ····DW_AT_decl_file····DW_FORM_data1 | 78 | ····DW_AT_decl_file····DW_FORM_data1 |
| 91 | ····DW_AT_decl_line····DW_FORM_data | 79 | ····DW_AT_decl_line····DW_FORM_data1 |
| 92 | ····DW_AT_decl_column··DW_FORM_data1 | 80 | ····DW_AT_decl_column··DW_FORM_data1 |
| 93 | ····DW_AT_linkage_name·DW_FORM_strp | ||
| 94 | ····DW_AT_declaration··DW_FORM_flag_present | ||
| 95 | ····DW_AT_defaulted····DW_FORM_implicit_const:·1 | ||
| 96 | ····DW_AT_object_pointer·DW_FORM_ref_udata | ||
| 97 | ····DW_AT_ | 81 | ····DW_AT_import·······DW_FORM_ref_udata |
| 98 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 82 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 99 | ···1 | 83 | ···15······DW_TAG_formal_parameter····[no·children] |
| 100 | ····DW_AT_type·········DW_FORM_ref_ | 84 | ····DW_AT_type·········DW_FORM_ref_addr |
| 101 | ····DW_AT_data_member_location·DW_FORM_implicit_const:·0 | ||
| 102 | ····DW_AT_accessibility·DW_FORM_data1 | ||
| 103 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 85 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 104 | ···1 | 86 | ···16······DW_TAG_formal_parameter····[no·children] |
| 105 | ····DW_AT_name·········DW_FORM_strp | 87 | ····DW_AT_name·········DW_FORM_strp |
| 106 | ····DW_AT_decl_file····DW_FORM_data1 | 88 | ····DW_AT_decl_file····DW_FORM_data1 |
| 107 | ····DW_AT_decl_line····DW_FORM_data | 89 | ····DW_AT_decl_line····DW_FORM_data1 |
| 108 | ····DW_AT_decl_column··DW_FORM_data1 | 90 | ····DW_AT_decl_column··DW_FORM_data1 |
| 109 | ····DW_AT_type·········DW_FORM_ref_ | 91 | ····DW_AT_type·········DW_FORM_ref_addr |
| 110 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 92 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 111 | ···1 | 93 | ···17······DW_TAG_template_type_param····[no·children] |
| 112 | ····DW_AT_name·········DW_FORM_strp | 94 | ····DW_AT_name·········DW_FORM_strp |
| 113 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| Max diff block lines reached; 434369/441135 bytes (98.47%) of diff not shown. | |||
| Offset 1, 75 lines modified | Offset 1, 109 lines modified | ||
| 1 | rn;$Z1")w | ||
| 2 | FOm36R4?*J | ||
| 3 | O1O1'ZI#e%Vc | ||
| 4 | ,`-nqD&~ | ||
| 5 | ~}_"uFR] | ||
| 6 | 9B<}L·+x | ||
| 7 | c;Db;Db;$ | ||
| 8 | 5a,/gCY^ | ||
| 9 | hWPA=m^@3W9 | ||
| 10 | HHD8EZwZ | ||
| 11 | :c8|}d:|E^ | ||
| 12 | rICf^C;D | ||
| 13 | oBYWtn=@? | ||
| 14 | $|`L9&yO | ||
| 15 | ~1O7vib' | ||
| 16 | \:0+22r< | ||
| 17 | ]Cd@uI}» | ||
| 18 | <(bgI8/E | ||
| 19 | 1 | NpAeNb{NT% | |
| 2 | \N*">>v0 | ||
| 3 | &c{gUN+L | ||
| 4 | {C*vPU@+ | ||
| 5 | nO<-@>/~ | ||
| 6 | H+(j>2^pL | ||
| 7 | ,oY:4]ao | ||
| 8 | \3|3|"W3 | ||
| 9 | bD|koF|C | ||
| 10 | 7FE3U{o: | ||
| 11 | CG5=u)eG | ||
| 12 | mIk-[-Zk | ||
| 13 | rII6z/K~o|$ | ||
| 14 | S_s5zv» C | ||
| 15 | R)L}Rr5z | ||
| 16 | pq$c+s+6 | ||
| 17 | Y» 0Vv_'h | ||
| 18 | "W}>S}DV | ||
| 19 | s(,J3&*5c | ||
| 20 | L/%._8)9 | ||
| 21 | \:(#,,l" | ||
| 22 | m@|» c}T{ | ||
| 23 | {Z8-qIqf | ||
| 24 | jPyjW>$X@ | ||
| 25 | |aO~`/MIOad/ | ||
| 26 | J;2jGf<~ | ||
| 27 | o» bs`4EX | ||
| 20 | 28 | CT[jl|;Q | |
| 21 | Y_)s'W?\0` | ||
| 22 | m[qRC·bx | ||
| 23 | 9"Ra#G|82 | ||
| 24 | <e5;$vk!4k6 | ||
| 25 | _*,J5dx. | ||
| 26 | Fb:lO7,h~lO | ||
| 27 | %pVSO1U_ | ||
| 28 | hl7,t2fB% | ||
| 29 | s[og46Wy | ||
| 30 | ni7o@n44 | ||
| 31 | zIr^aKvlp | ||
| 32 | r)|;lB<: | ||
| 33 | (I)Lq.)eS}Ab | ||
| 34 | sQN!i-$F)x | ||
| 35 | ^7@Z%}8] | ||
| 36 | BKH\» QY! | ||
| 37 | PH5\Un*rG | ||
| 38 | jc-6QMaN | ||
| 39 | A1Q8A",> | ||
| 40 | REOprtGFr | ||
| 41 | .!&sp@.+ | ||
| 42 | sEk@\N-. | ||
| 43 | k\[eCcP8 | ||
| 44 | XBR9"UTk | ||
| 45 | G8%015j?E | ||
| 46 | ^v%~i`=90 | ||
| 47 | SiAp=]\OM» U | ||
| 48 | ·{*tw{\V | ||
| 49 | 9Zdq9,Lk·Zl | ||
| 50 | m7taG?N56 | ||
| 51 | Tjh/84g-T | ||
| 52 | b,\)f-,7 | ||
| 53 | Yg%;rbec | ||
| 54 | -yG*J$Bk" | ||
| 55 | ^T&<PaYN | ||
| 56 | =Uq>-r:9 | ||
| 57 | .&\k7fm7W | ||
| 58 | <» fpE}[M*y | ||
| 59 | /]F4ag4q( | ||
| 60 | [)83ta@v» | ||
| 61 | =LPo?7?· | ||
| 62 | mkG./}k& | ||
| 63 | Umy8i@,w | ||
| 64 | \qh'a0^W | ||
| 65 | ·~lvh<0DL | ||
| 66 | zsyY\\v'.{ | ||
| 67 | Mro}-k_+M | ||
| 68 | 29 | _u&=}:&| | |
| 30 | QRK"W-O! | ||
| 31 | ~]O?pP}@ | ||
| 32 | ++m~MZ/{ | ||
| 33 | 7aeZKw)` | ||
| 34 | ey/AA==o | ||
| 35 | 1#ZP<P\* | ||
| 36 | X1@_}'$j | ||
| 37 | m;rqvaI» | ||
| 38 | ^c<Mb/1~ | ||
| 39 | RaVZ!>;[ | ||
| 40 | wCmw-+/s', | ||
| 41 | Utpxp?>$ | ||
| 42 | 9+I3iV2&, | ||
| 43 | 4[.f*{5tu6 | ||
| 44 | ,!F~» Y[" | ||
| 45 | v^}Tx9ZANI/Z | ||
| 46 | o!a-6\» v&: | ||
| 47 | K;Ix'G-M | ||
| 48 | WtRk)v~y. | ||
| 49 | _i):wi-E | ||
| 50 | XoqN» <gqN) | ||
| 51 | ^s» Eia4O$+[rL7 | ||
| 52 | » -#Qefs4 | ||
| 53 | X8=Lf?aAq | ||
| 54 | =E}=Sd@a | ||
| 55 | o·0ZBO(1 | ||
| 56 | +p!`{U,M | ||
| 57 | azJY#8oD77 | ||
| 58 | j{CFgsI/ | ||
| 59 | +9%015jOM | ||
| 60 | u|A*FU+i | ||
| 61 | zOl<Z%ccI9 | ||
| 62 | ?G#D&:`D | ||
| Max diff block lines reached; 437/2279 bytes (19.18%) of diff not shown. | |||
| Offset 11141, 5333 lines modified | Offset 11141, 5334 lines modified | ||
| 11141 | ··[·e311f]··_M_caches | 11141 | ··[·e311f]··_M_caches |
| 11142 | ··[·e3129]··HasSpecies | 11142 | ··[·e3129]··HasSpecies |
| 11143 | ··[·e3134]··__vacancies | 11143 | ··[·e3134]··__vacancies |
| 11144 | ··[·e3140]··ploidies | 11144 | ··[·e3140]··ploidies |
| 11145 | ··[·e3149]··_M_replace_categories | 11145 | ··[·e3149]··_M_replace_categories |
| 11146 | ··[·e315f]··Qualities | 11146 | ··[·e315f]··Qualities | Diff chunk too large, falling back to line-by-line diff (5326 lines added, 5325 lines removed) |
| 11147 | ··[·e3169]··variables | 11147 | ··[·e3169]··variables |
| 11148 | ··[·e3173]··GNU·C | 11148 | ··[·e3173]··GNU·C17·12.2.0·-mtune=generic·-march=i686·-g·-O2·-fstack-protector-strong·-fasynchronous-unwind-tables |
| 11149 | ··[·e31d | 11149 | ··[·e31da]··GNU·C++17·12.2.0·-msse3·-mtune=generic·-march=i686·-g·-O2·-fstack-protector-strong·-fasynchronous-unwind-tables |
| 11150 | ··[·e324 | 11150 | ··[·e324a]··variantAlleles |
| 11151 | ··[·e325 | 11151 | ··[·e3259]··printAlleles |
| 11152 | ··[·e32 | 11152 | ··[·e3266]··alleles |
| 11153 | ··[·e326 | 11153 | ··[·e326e]··parseSamples |
| 11154 | ··[·e327 | 11154 | ··[·e327b]··updateSamples |
| 11155 | ··[·e328 | 11155 | ··[·e3289]··getNumSamples |
| 11156 | ··[·e329 | 11156 | ··[·e3297]··newSamples |
| 11157 | ··[·e32 | 11157 | ··[·e32a2]··num_samples |
| 11158 | ··[·e32a | 11158 | ··[·e32ae]··samples |
| 11159 | ··[·e32 | 11159 | ··[·e32b6]··rules |
| 11160 | ··[·e32b | 11160 | ··[·e32bc]··setOutputSampleNames |
| 11161 | ··[·e32 | 11161 | ··[·e32d1]··outputSampleNames |
| 11162 | ··[·e32 | 11162 | ··[·e32e3]··sampleNames |
| 11163 | ··[·e32e | 11163 | ··[·e32ef]··GetTagNames |
| 11164 | ··[·e32f | 11164 | ··[·e32fb]··getMemberNames |
| 11165 | ··[·e330 | 11165 | ··[·e330a]··_M_names |
| 11166 | ··[·e33 | 11166 | ··[·e3313]··Filenames |
| 11167 | ··[·e331 | 11167 | ··[·e331d]··newcolnames |
| 11168 | ··[·e332 | 11168 | ··[·e3329]··unionInfoHeaderLines |
| 11169 | ··[·e333 | 11169 | ··[·e333e]··headerLines |
| 11170 | ··[·e334 | 11170 | ··[·e334a]··_TrivialValueTypes |
| 11171 | ··[·e335 | 11171 | ··[·e335d]··infoTypes |
| 11172 | ··[·e336 | 11172 | ··[·e3367]··formatTypes |
| 11173 | ··[·e33 | 11173 | ··[·e3373]··newOrderedGenotypes |
| 11174 | ··[·e338 | 11174 | ··[·e3387]··orderedGenotypes |
| 11175 | ··[·e339 | 11175 | ··[·e3398]··removeFilteredGenotypes |
| 11176 | ··[·e33 | 11176 | ··[·e33b0]··getNumValidGenotypes |
| 11177 | ··[·e33 | 11177 | ··[·e33c5]··valid_genotypes |
| 11178 | ··[·e33 | 11178 | ··[·e33d5]··genotypes |
| 11179 | ··[·e33d | 11179 | ··[·e33df]··__res |
| 11180 | ··[·e33 | 11180 | ··[·e33e5]··_Requires |
| 11181 | ··[·e33e | 11181 | ··[·e33ef]··mQueryGapScores |
| 11182 | ··[·e33f | 11182 | ··[·e33ff]··mBestScores |
| 11183 | ··[·e340 | 11183 | ··[·e340b]··long_name_underscores |
| 11184 | ··[·e34 | 11184 | ··[·e3421]··AlignedBases |
| 11185 | ··[·e342 | 11185 | ··[·e342e]··QueryBases |
| 11186 | ··[·e343 | 11186 | ··[·e3439]··read_bases |
| 11187 | ··[·e34 | 11187 | ··[·e3444]··bases |
| 11188 | ··[·e344 | 11188 | ··[·e344a]··passes |
| 11189 | ··[·e34 | 11189 | ··[·e3451]··extendedAlternates |
| 11190 | ··[·e34 | 11190 | ··[·e3464]··parsedAlternates |
| 11191 | ··[·e34 | 11191 | ··[·e3475]··states |
| 11192 | ··[·e347 | 11192 | ··[·e347c]··NumBytes |
| 11193 | ··[·e34 | 11193 | ··[·e3485]··_MoveValues |
| 11194 | ··[·e34 | 11194 | ··[·e3491]··mValues |
| 11195 | ··[·e349 | 11195 | ··[·e3499]··ObjectValues |
| 11196 | ··[·e34 | 11196 | ··[·e34a6]··values |
| 11197 | ··[·e34a | 11197 | ··[·e34ad]··_Indexes |
| 11198 | ··[·e34 | 11198 | ··[·e34b6]··updateAlleleIndexes |
| 11199 | ··[·e34c | 11199 | ··[·e34ca]··altAlleleIndexes |
| 11200 | ··[·e34d | 11200 | ··[·e34db]··genotypeIndexes |
| 11201 | ··[·e34e | 11201 | ··[·e34eb]··LocateIndexes |
| 11202 | ··[·e34f | 11202 | ··[·e34f9]··CreateIndexes |
| 11203 | ··[·e350 | 11203 | ··[·e3507]··OpenIndexes |
| 11204 | ··[·e35 | 11204 | ··[·e3513]··HasIndexes |
| 11205 | ··[·e351 | 11205 | ··[·e351e]··indexes |
| 11206 | ··[·e35 | 11206 | ··[·e3526]··CustomTags |
| 11207 | ··[·e35 | 11207 | ··[·e3531]··infoFlags |
| 11208 | ··[·e353 | 11208 | ··[·e353b]··new_flags |
| 11209 | ··[·e35 | 11209 | ··[·e3545]··flags |
| 11210 | ··[·e354 | 11210 | ··[·e354b]··tags |
| 11211 | ··[·e35 | 11211 | ··[·e3550]··strings |
| 11212 | ··[·e355 | 11212 | ··[·e3558]··_Args |
| 11213 | ··[·e355 | 11213 | ··[·e355e]··~OptArgs |
| 11214 | ··[·e356 | 11214 | ··[·e3567]··__open_too_many_args |
| 11215 | ··[·e357 | 11215 | ··[·e357c]··__lhs |
| 11216 | ··[·e35 | 11216 | ··[·e3582]··__rhs |
| 11217 | ··[·e358 | 11217 | ··[·e3588]··__use_rhs |
| 11218 | ··[·e35 | 11218 | ··[·e3592]··__is |
| 11219 | ··[·e359 | 11219 | ··[·e3597]··_M_this |
| 11220 | ··[·e359 | 11220 | ··[·e359f]··isLeftParenthesis |
| 11221 | ··[·e35 | 11221 | ··[·e35b1]··isRightParenthesis |
| 11222 | ··[·e35 | 11222 | ··[·e35c4]··st_blocks |
| 11223 | ··[·e35c | 11223 | ··[·e35ce]··merge_chunks |
| 11224 | ··[·e35d | 11224 | ··[·e35db]··chrono_literals |
| 11225 | ··[·e35e | 11225 | ··[·e35eb]··vals |
| 11226 | ··[·e35 | 11226 | ··[·e35f0]··includePreviousBaseForIndels |
| 11227 | ··[·e360 | 11227 | ··[·e360d]··newgls |
| 11228 | ··[·e36 | 11228 | ··[·e3614]··__swappable_details |
| 11229 | ··[·e362 | 11229 | ··[·e3628]··__swappable_with_details |
| 11230 | ··[·e36 | 11230 | ··[·e3641]··ncols |
| 11231 | ··[·e364 | 11231 | ··[·e3647]··BamTools |
| 11232 | ··[·e36 | 11232 | ··[·e3650]··bams |
| 11233 | ··[·e36 | 11233 | ··[·e3655]··phase_params |
| 11234 | ··[·e36 | 11234 | ··[·e3662]··HasPrograms |
| 11235 | ··[·e366 | 11235 | ··[·e366e]··__new_elems |
| 11236 | ··[·e367 | 11236 | ··[·e367a]··delims |
| 11237 | ··[·e36 | 11237 | ··[·e3681]··towctrans |
| 11238 | ··[·e368 | 11238 | ··[·e368b]··long_name_hyphens |
| 11239 | ··[·e369 | 11239 | ··[·e369d]··prefixtokens |
| 11240 | ··[·e36a | 11240 | ··[·e36aa]··Contains |
| 11241 | ··[·e36 | 11241 | ··[·e36b3]··reg2bins |
| 11242 | ··[·e36b | 11242 | ··[·e36bc]··n_bins |
| 11243 | ··[·e36 | 11243 | ··[·e36c3]··__espins |
| 11244 | ··[·e36c | 11244 | ··[·e36cc]··NumCigarOperations |
| 11245 | ··[·e36d | 11245 | ··[·e36df]··GetUncheckedOptions |
| 11246 | ··[·e36 | 11246 | ··[·e36f3]··PrintOptions |
| 11247 | ··[·e3 | 11247 | ··[·e3700]··referencePos |
| 11248 | ··[·e370 | 11248 | ··[·e370d]··equalPos |
| 11249 | ··[·e37 | 11249 | ··[·e3716]··lastPos |
| 11250 | ··[·e371 | 11250 | ··[·e371e]··__os |
| 11251 | ··[·e37 | 11251 | ··[·e3723]··acos |
| 11252 | ··[·e372 | 11252 | ··[·e3728]··~basic_ios |
| 11253 | ··[·e37 | 11253 | ··[·e3733]··__pos |
| 11254 | ··[·e373 | 11254 | ··[·e3739]··read_pos |
| 11255 | ··[·e37 | 11255 | ··[·e3742]··ref_line_pos |
| 11256 | ··[·e374 | 11256 | ··[·e374f]··_M_get_insert_hint_unique_pos |
| 11257 | ··[·e376 | 11257 | ··[·e376d]··_M_get_insert_unique_pos |
| 11258 | ··[·e37 | 11258 | ··[·e3786]··_M_resize_pos |
| 11259 | ··[·e37 | 11259 | ··[·e3794]··ref_pos |
| 11260 | ··[·e379 | 11260 | ··[·e379c]··_M_get_insert_hint_equal_pos |
| 11261 | ··[·e37b | 11261 | ··[·e37b9]··_M_get_insert_equal_pos |
| 11262 | ··[·e37 | 11262 | ··[·e37d1]··refpos |
| 11263 | ··[·e37d | 11263 | ··[·e37d8]··seekpos |
| 11264 | ··[·e37 | 11264 | ··[·e37e0]··streampos |
| 11265 | ··[·e37e | 11265 | ··[·e37ea]··npos |
| 11266 | ··[·e37e | 11266 | ··[·e37ef]··fgetpos |
| Max diff block lines reached; 0/866994 bytes (0.00%) of diff not shown. | |||
| Offset 4, 17 lines modified | Offset 4, 17 lines modified | ||
| 4 | ··Data:······························2's·complement,·little·endian | 4 | ··Data:······························2's·complement,·little·endian |
| 5 | ··Version:···························1·(current) | 5 | ··Version:···························1·(current) |
| 6 | ··OS/ABI:····························UNIX·-·GNU | 6 | ··OS/ABI:····························UNIX·-·GNU |
| 7 | ··ABI·Version:·······················0 | 7 | ··ABI·Version:·······················0 |
| 8 | ··Type:······························DYN·(Shared·object·file) | 8 | ··Type:······························DYN·(Shared·object·file) |
| 9 | ··Machine:···························Intel·80386 | 9 | ··Machine:···························Intel·80386 |
| 10 | ··Version:···························0x1 | 10 | ··Version:···························0x1 |
| 11 | ··Entry·point·address:···············0x194 | 11 | ··Entry·point·address:···············0x19430 |
| 12 | ··Start·of·program·headers:··········52·(bytes·into·file) | 12 | ··Start·of·program·headers:··········52·(bytes·into·file) |
| 13 | ··Start·of·section·headers:··········2 | 13 | ··Start·of·section·headers:··········2391836·(bytes·into·file) |
| 14 | ··Flags:·····························0x0 | 14 | ··Flags:·····························0x0 |
| 15 | ··Size·of·this·header:···············52·(bytes) | 15 | ··Size·of·this·header:···············52·(bytes) |
| 16 | ··Size·of·program·headers:···········32·(bytes) | 16 | ··Size·of·program·headers:···········32·(bytes) |
| 17 | ··Number·of·program·headers:·········11 | 17 | ··Number·of·program·headers:·········11 |
| 18 | ··Size·of·section·headers:···········40·(bytes) | 18 | ··Size·of·section·headers:···········40·(bytes) |
| 19 | ··Number·of·section·headers:·········41 | 19 | ··Number·of·section·headers:·········41 |
| 20 | ··Section·header·string·table·index:·40 | 20 | ··Section·header·string·table·index:·40 |
| Offset 1, 25 lines modified | Offset 1, 25 lines modified | ||
| 1 | Elf·file·type·is·DYN·(Shared·object·file) | 1 | Elf·file·type·is·DYN·(Shared·object·file) |
| 2 | Entry·point·0x194 | 2 | Entry·point·0x19430 |
| 3 | There·are·11·program·headers,·starting·at·offset·52 | 3 | There·are·11·program·headers,·starting·at·offset·52 |
| 4 | Program·Headers: | 4 | Program·Headers: |
| 5 | ··Type···········Offset···VirtAddr···PhysAddr···FileSiz·MemSiz··Flg·Align | 5 | ··Type···········Offset···VirtAddr···PhysAddr···FileSiz·MemSiz··Flg·Align |
| 6 | ··PHDR···········0x000034·0x00000034·0x00000034·0x00160·0x00160·R···0x4 | 6 | ··PHDR···········0x000034·0x00000034·0x00000034·0x00160·0x00160·R···0x4 |
| 7 | ··INTERP·········0x000194·0x00000194·0x00000194·0x00000·0x00013·R···0x1 | 7 | ··INTERP·········0x000194·0x00000194·0x00000194·0x00000·0x00013·R···0x1 |
| 8 | ··LOAD···········0x000000·0x00000000·0x00000000·0x001ec·0x12 | 8 | ··LOAD···········0x000000·0x00000000·0x00000000·0x001ec·0x129a4·R···0x1000 |
| 9 | ··LOAD···········0x000000·0x00013000·0x00013000·0x00000·0x6 | 9 | ··LOAD···········0x000000·0x00013000·0x00013000·0x00000·0x6b5d8·R·E·0x1000 |
| 10 | ··LOAD···········0x000000·0x000 | 10 | ··LOAD···········0x000000·0x0007f000·0x0007f000·0x00000·0x1bcfc·R···0x1000 |
| 11 | ··LOAD···········0x000c20·0x0009 | 11 | ··LOAD···········0x000c20·0x0009bc20·0x0009bc20·0x00000·0x007a4·RW··0x1000 |
| 12 | ··DYNAMIC········0x000c20·0x0009 | 12 | ··DYNAMIC········0x000c20·0x0009be50·0x0009be50·0x00000·0x00130·RW··0x4 |
| 13 | ··NOTE···········0x0001a8·0x000001a8·0x000001a8·0x00044·0x00044·R···0x4 | 13 | ··NOTE···········0x0001a8·0x000001a8·0x000001a8·0x00044·0x00044·R···0x4 |
| 14 | ··GNU_EH_FRAME···0x001000·0x0008 | 14 | ··GNU_EH_FRAME···0x001000·0x0008406c·0x0008406c·0x00000·0x0194c·R···0x4 |
| 15 | ··GNU_STACK······0x000000·0x00000000·0x00000000·0x00000·0x00000·RW··0x10 | 15 | ··GNU_STACK······0x000000·0x00000000·0x00000000·0x00000·0x00000·RW··0x10 |
| 16 | ··GNU_RELRO······0x000c20·0x0009 | 16 | ··GNU_RELRO······0x000c20·0x0009bc20·0x0009bc20·0x00000·0x003e0·R···0x1 |
| 17 | ·Section·to·Segment·mapping: | 17 | ·Section·to·Segment·mapping: |
| 18 | ··Segment·Sections... | 18 | ··Segment·Sections... |
| 19 | ···00····· | 19 | ···00····· |
| 20 | ···01·····.interp· | 20 | ···01·····.interp· |
| 21 | ···02·····.interp·.note.gnu.build-id·.note.ABI-tag·.gnu.hash·.dynsym·.dynstr·.gnu.version·.gnu.version_r·.rel.dyn·.rel.plt· | 21 | ···02·····.interp·.note.gnu.build-id·.note.ABI-tag·.gnu.hash·.dynsym·.dynstr·.gnu.version·.gnu.version_r·.rel.dyn·.rel.plt· |
| 22 | ···03·····.init·.plt·.plt.got·.text·.fini· | 22 | ···03·····.init·.plt·.plt.got·.text·.fini· |
| Offset 1, 50 lines modified | Offset 1, 50 lines modified | ||
| 1 | There·are·41·section·headers,·starting·at·offset·0x24 | 1 | There·are·41·section·headers,·starting·at·offset·0x247f1c: |
| 2 | Section·Headers: | 2 | Section·Headers: |
| 3 | ··[Nr]·Name··············Type············Addr·····Off····Size···ES·Flg·Lk·Inf·Al | 3 | ··[Nr]·Name··············Type············Addr·····Off····Size···ES·Flg·Lk·Inf·Al |
| 4 | ··[·0]···················NULL············00000000·000000·000000·00······0···0··0 | 4 | ··[·0]···················NULL············00000000·000000·000000·00······0···0··0 |
| 5 | ··[·1]·.interp···········NOBITS··········00000194·000194·000013·00···A··0···0··1 | 5 | ··[·1]·.interp···········NOBITS··········00000194·000194·000013·00···A··0···0··1 |
| 6 | ··[·2]·.note.gnu.build-id·NOTE············000001a8·0001a8·000024·00···A··0···0··4 | 6 | ··[·2]·.note.gnu.build-id·NOTE············000001a8·0001a8·000024·00···A··0···0··4 |
| 7 | ··[·3]·.note.ABI-tag·····NOTE············000001cc·0001cc·000020·00···A··0···0··4 | 7 | ··[·3]·.note.ABI-tag·····NOTE············000001cc·0001cc·000020·00···A··0···0··4 |
| 8 | ··[·4]·.gnu.hash·········NOBITS··········000001ec·0001ec·001410·04···A··5···0··4 | 8 | ··[·4]·.gnu.hash·········NOBITS··········000001ec·0001ec·001410·04···A··5···0··4 |
| 9 | ··[·5]·.dynsym···········NOBITS··········000015fc·0001ec·0035c0·10···A··6···1··4 | 9 | ··[·5]·.dynsym···········NOBITS··········000015fc·0001ec·0035c0·10···A··6···1··4 |
| 10 | ··[·6]·.dynstr···········NOBITS··········00004bbc·0001ec·00c | 10 | ··[·6]·.dynstr···········NOBITS··········00004bbc·0001ec·00cb48·00···A··0···0··1 |
| 11 | ··[·7]·.gnu.version······NOBITS··········00011 | 11 | ··[·7]·.gnu.version······NOBITS··········00011704·0001ec·0006b8·02···A··5···0··2 |
| 12 | ··[·8]·.gnu.version_r····NOBITS··········00011 | 12 | ··[·8]·.gnu.version_r····NOBITS··········00011dbc·0001ec·0001b0·00···A··6···4··4 |
| 13 | ··[·9]·.rel.dyn··········NOBITS··········0001 | 13 | ··[·9]·.rel.dyn··········NOBITS··········00011f6c·0001ec·000440·08···A··5···0··4 |
| 14 | ··[10]·.rel.plt··········NOBITS··········00012 | 14 | ··[10]·.rel.plt··········NOBITS··········000123ac·0001ec·0005f8·08···A··5··25··4 |
| 15 | ··[11]·.init·············NOBITS··········00013000·001000·000020·00··AX··0···0··4 | 15 | ··[11]·.init·············NOBITS··········00013000·001000·000020·00··AX··0···0··4 |
| 16 | ··[12]·.plt··············NOBITS··········00013020·001000·000c00·04··AX··0···0·16 | 16 | ··[12]·.plt··············NOBITS··········00013020·001000·000c00·04··AX··0···0·16 |
| 17 | ··[13]·.plt.got··········NOBITS··········00013c20·001000·000008·08··AX··0···0··8 | 17 | ··[13]·.plt.got··········NOBITS··········00013c20·001000·000008·08··AX··0···0··8 |
| 18 | ··[14]·.text·············NOBITS··········00013c30·001000·06 | 18 | ··[14]·.text·············NOBITS··········00013c30·001000·06a994·00··AX··0···0·16 |
| 19 | ··[15]·.fini·············NOBITS··········000 | 19 | ··[15]·.fini·············NOBITS··········0007e5c4·001000·000014·00··AX··0···0··4 |
| 20 | ··[16]·.rodata···········NOBITS··········000 | 20 | ··[16]·.rodata···········NOBITS··········0007f000·001000·00506c·00···A··0···0·32 |
| 21 | ··[17]·.eh_frame_hdr·····NOBITS··········0008 | 21 | ··[17]·.eh_frame_hdr·····NOBITS··········0008406c·001000·00194c·00···A··0···0··4 |
| 22 | ··[18]·.eh_frame·········NOBITS··········0008 | 22 | ··[18]·.eh_frame·········NOBITS··········000859b8·001000·012020·00···A··0···0··4 |
| 23 | ··[19]·.gcc_except_table·NOBITS··········0009 | 23 | ··[19]·.gcc_except_table·NOBITS··········000979d8·001000·003324·00···A··0···0··4 |
| 24 | ··[20]·.init_array·······NOBITS··········0009 | 24 | ··[20]·.init_array·······NOBITS··········0009bc20·000c20·000024·04··WA··0···0··4 |
| 25 | ··[21]·.fini_array·······NOBITS··········0009 | 25 | ··[21]·.fini_array·······NOBITS··········0009bc44·000c20·000004·04··WA··0···0··4 |
| 26 | ··[22]·.data.rel.ro······NOBITS··········0009 | 26 | ··[22]·.data.rel.ro······NOBITS··········0009bc48·000c20·000208·00··WA··0···0··4 |
| 27 | ··[23]·.dynamic··········NOBITS··········0009 | 27 | ··[23]·.dynamic··········NOBITS··········0009be50·000c20·000130·08··WA··6···0··4 |
| 28 | ··[24]·.got··············NOBITS··········0009 | 28 | ··[24]·.got··············NOBITS··········0009bf80·000c20·000074·04··WA··0···0··4 |
| 29 | ··[25]·.got.plt··········NOBITS··········0009 | 29 | ··[25]·.got.plt··········NOBITS··········0009bff4·000c20·000308·04··WA··0···0··4 |
| 30 | ··[26]·.data·············NOBITS··········0009 | 30 | ··[26]·.data·············NOBITS··········0009c2fc·000c20·0000ac·00··WA··0···0··4 |
| 31 | ··[27]·.bss··············NOBITS··········0009 | 31 | ··[27]·.bss··············NOBITS··········0009c3a8·000c20·00001c·00··WA··0···0··8 |
| 32 | ··[28]·.comment··········PROGBITS········00000000·0001ec·00001f·01··MS··0···0··1 | 32 | ··[28]·.comment··········PROGBITS········00000000·0001ec·00001f·01··MS··0···0··1 |
| 33 | ··[29]·.debug_aranges····PROGBITS········00000000·00020c·000 | 33 | ··[29]·.debug_aranges····PROGBITS········00000000·00020c·0006e3·00···C··0···0··4 |
| 34 | ··[30]·.debug_info·······PROGBITS········00000000·000 | 34 | ··[30]·.debug_info·······PROGBITS········00000000·0008f0·16d0b6·00···C··0···0··4 |
| 35 | ··[31]·.debug_abbrev·····PROGBITS········00000000·1 | 35 | ··[31]·.debug_abbrev·····PROGBITS········00000000·16d9a8·00384d·00···C··0···0··4 |
| 36 | ··[32]·.debug_line·······PROGBITS········00000000·17 | 36 | ··[32]·.debug_line·······PROGBITS········00000000·1711f8·033b44·00···C··0···0··4 |
| 37 | ··[33]·.debug_str········PROGBITS········00000000·1a | 37 | ··[33]·.debug_str········PROGBITS········00000000·1a4d3c·00a161·01·MSC··0···0··4 |
| 38 | ··[34]·.debug_line_str···PROGBITS········00000000·1 | 38 | ··[34]·.debug_line_str···PROGBITS········00000000·1aeea0·0006b3·01·MSC··0···0··4 |
| 39 | ··[35]·.debug_loclists···PROGBITS········00000000·1 | 39 | ··[35]·.debug_loclists···PROGBITS········00000000·1af554·065db7·00···C··0···0··4 |
| 40 | ··[36]·.debug_rnglists···PROGBITS········00000000·21 | 40 | ··[36]·.debug_rnglists···PROGBITS········00000000·21530c·01a9a1·00···C··0···0··4 |
| 41 | ··[37]·.gnu_debugaltlink·PROGBITS········00000000·2 | 41 | ··[37]·.gnu_debugaltlink·PROGBITS········00000000·22fcad·000041·00······0···0··1 |
| 42 | ··[38]·.symtab···········SYMTAB··········00000000·2 | 42 | ··[38]·.symtab···········SYMTAB··········00000000·22fcf0·004b80·10·····39·349··4 |
| 43 | ··[39]·.strtab···········STRTAB··········00000000·23 | 43 | ··[39]·.strtab···········STRTAB··········00000000·234870·013505·00······0···0··1 |
| 44 | ··[40]·.shstrtab·········STRTAB··········00000000·24 | 44 | ··[40]·.shstrtab·········STRTAB··········00000000·247d75·0001a6·00······0···0··1 |
| 45 | Key·to·Flags: | 45 | Key·to·Flags: |
| 46 | ··W·(write),·A·(alloc),·X·(execute),·M·(merge),·S·(strings),·I·(info), | 46 | ··W·(write),·A·(alloc),·X·(execute),·M·(merge),·S·(strings),·I·(info), |
| 47 | ··L·(link·order),·O·(extra·OS·processing·required),·G·(group),·T·(TLS), | 47 | ··L·(link·order),·O·(extra·OS·processing·required),·G·(group),·T·(TLS), |
| 48 | ··C·(compressed),·x·(unknown),·o·(OS·specific),·E·(exclude), | 48 | ··C·(compressed),·x·(unknown),·o·(OS·specific),·E·(exclude), |
| 49 | ··R·(retain),·D·(mbind),·p·(processor·specific) | 49 | ··R·(retain),·D·(mbind),·p·(processor·specific) |
| Offset 1, 1216 lines modified | Offset 1, 1211 lines modified | ||
| 1 | Symbol·table·'.symtab'·contains·12 | 1 | Symbol·table·'.symtab'·contains·1208·entries: |
| 2 | ···Num:····Value··Size·Type····Bind···Vis······Ndx·Name | 2 | ···Num:····Value··Size·Type····Bind···Vis······Ndx·Name |
| 3 | ·····0:·00000000·····0·NOTYPE··LOCAL··DEFAULT··UND· | 3 | ·····0:·00000000·····0·NOTYPE··LOCAL··DEFAULT··UND· |
| 4 | ·····1:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·Scrt1.o | 4 | ·····1:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·Scrt1.o |
| 5 | ·····2:·000001cc····32·OBJECT··LOCAL··DEFAULT····3·__abi_tag | 5 | ·····2:·000001cc····32·OBJECT··LOCAL··DEFAULT····3·__abi_tag |
| 6 | ·····3:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·tvcutils.cpp | 6 | ·····3:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·tvcutils.cpp |
| 7 | ·····4:·00013c30····53·FUNC····LOCAL··DEFAULT···14·_Z12TVCUtilsHelpv.cold | 7 | ·····4:·00013c30····53·FUNC····LOCAL··DEFAULT···14·_Z12TVCUtilsHelpv.cold |
| 8 | ·····5:·00013c65····25·FUNC····LOCAL··DEFAULT···14·main.cold | 8 | ·····5:·00013c65····25·FUNC····LOCAL··DEFAULT···14·main.cold |
| 9 | ·····6:·000191 | 9 | ·····6:·00019160····56·FUNC····LOCAL··DEFAULT···14·_GLOBAL__sub_I__Z12TVCUtilsHelpv |
| 10 | ·····7:·0009 | 10 | ·····7:·0009c3a9·····1·OBJECT··LOCAL··DEFAULT···27·_ZStL8__ioinit |
| 11 | ·····8:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·prepare_hotspots.cpp | 11 | ·····8:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·prepare_hotspots.cpp |
| 12 | ·····9:·000196 | 12 | ·····9:·000196d0···129·FUNC····LOCAL··DEFAULT···14·_ZNSt15_Deque_iteratorI6AlleleRS0_PS0_EpLEi.isra.0 |
| 13 | ····10:·00019760···167·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12_M_constructIPcEEvT_S7_St20forward_iterator_tag.isra.0 | ||
| 13 | ····1 | 14 | ····11:·00019810····49·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE6assignEPKc.isra.0 |
| 14 | ····1 | 15 | ····12:·00019850····57·FUNC····LOCAL··DEFAULT···14·_ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE7compareERKS4_.isra.0 |
| 15 | ····12:·00019840···167·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12_M_constructIPKcEEvT_S8_St20forward_iterator_tag.isra.0 | ||
| 16 | ····13:·000198 | 16 | ····13:·00019890····61·FUNC····LOCAL··DEFAULT···14·_ZNSt15_Deque_iteratorI6AlleleRS0_PS0_EppEv.isra.0 |
| 17 | ····14:·00019 | 17 | ····14:·000198d0···181·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEaSEOS4_.isra.0 |
| 18 | ····15:·000199 | 18 | ····15:·00019990···167·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12_M_constructIPKcEEvT_S8_St20forward_iterator_tag.isra.0 |
| 19 | ····16:·00019a | 19 | ····16:·00019a40···216·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEC2IS3_EEPKcRKS3_.constprop.0 |
| 20 | ····17:·00019b | 20 | ····17:·00019b20···113·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_S5_ESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE8_M_eraseEPSt13_Rb_tree_nodeIS8_E.isra.0 |
| 21 | ····18:·00022 | 21 | ····18:·00022c50···473·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_S5_ESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE7_M_copyILb0ENSE_11_Alloc_nodeEEEPSt13_Rb_tree_nodeIS8_ESJ_PSt18_Rb_tree_node_baseRT0_.isra.0 |
| 22 | ····19:·00019b | 22 | ····19:·00019ba0···216·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_St3mapIS5_S5_St4lessIS5_ESaIS6_IS7_S5_EEEESt10_Select1stISE_ESA_SaISE_EE8_M_eraseEPSt13_Rb_tree_nodeISE_E.isra.0 |
| 23 | ····20:·00019c | 23 | ····20:·00019c80···716·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_iESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE8_M_eraseEPSt13_Rb_tree_nodeIS8_E.isra.0 |
| 24 | ····21:·00019f | 24 | ····21:·00019f50···385·FUNC····LOCAL··DEFAULT···14·_ZN6AlleleaSEOS_.isra.0 |
| 25 | ····22:·0001a | 25 | ····22:·0001a0e0···352·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_11OptArgumentESt10_Select1stIS9_ESt4lessIS5_ESaIS9_EE8_M_eraseEPSt13_Rb_tree_nodeIS9_E.isra.0 |
| 26 | ····23:·0001a2 | 26 | ····23:·0001a240···716·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES5_St9_IdentityIS5_ESt4lessIS5_ESaIS5_EE8_M_eraseEPSt13_Rb_tree_nodeIS5_E.isra.0 |
| 27 | ····24:·0001a5 | 27 | ····24:·0001a510···187·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_St3setIS5_St4lessIS5_ESaIS5_EEESt10_Select1stISD_ESA_SaISD_EE8_M_eraseEPSt13_Rb_tree_nodeISD_E.isra.0 |
| 28 | ····25:·0001a | 28 | ····25:·0001a5d0···449·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES5_St9_IdentityIS5_ESt4lessIS5_ESaIS5_EE16_M_insert_uniqueIRKS5_EESt4pairISt17_Rb_tree_iteratorIS5_EbEOT_.isra.0 |
| 29 | ····26:·00013c7e····51·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES5_St9_IdentityIS5_ESt4lessIS5_ESaIS5_EE16_M_insert_uniqueIRKS5_EESt4pairISt17_Rb_tree_iteratorIS5_EbEOT_.isra.0.cold | 29 | ····26:·00013c7e····51·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES5_St9_IdentityIS5_ESt4lessIS5_ESaIS5_EE16_M_insert_uniqueIRKS5_EESt4pairISt17_Rb_tree_iteratorIS5_EbEOT_.isra.0.cold |
| 30 | ····27:·00013cb1····53·FUNC····LOCAL··DEFAULT···14·_Z19PrepareHotspotsHelpv.cold | 30 | ····27:·00013cb1····53·FUNC····LOCAL··DEFAULT···14·_Z19PrepareHotspotsHelpv.cold |
| 31 | ····28:·0001a9 | 31 | ····28:·0001a9d0···326·FUNC····LOCAL··DEFAULT···14·_ZNSt5dequeI10LineStatusSaIS0_EE12emplace_backIJS0_EEERS0_DpOT_.isra.0 |
| 32 | ····29:·0001a | 32 | ····29:·0001ab20··9175·FUNC····LOCAL··DEFAULT···14·_ZNSt3_V28__rotateISt15_Deque_iteratorI6AlleleRS2_PS2_EEET_S6_S6_S6_St26random_access_iterator_tag.isra.0 |
| 33 | ····30:·0001c | 33 | ····30:·0001cf00···689·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_St3mapIS5_S5_St4lessIS5_ESaIS6_IS7_S5_EEEESt10_Select1stISE_ESA_SaISE_EE22_M_emplace_hint_uniqueIJRKSt21piecewise_construct_tSt5tupleIJRS7_EESN_IJEEEEESt17_Rb_tree_iteratorISE_ESt23_Rb_tree_const_iteratorISE_EDpOT_.isra.0 |
| 34 | ····31:·00013ce6····51·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_St3mapIS5_S5_St4lessIS5_ESaIS6_IS7_S5_EEEESt10_Select1stISE_ESA_SaISE_EE22_M_emplace_hint_uniqueIJRKSt21piecewise_construct_tSt5tupleIJRS7_EESN_IJEEEEESt17_Rb_tree_iteratorISE_ESt23_Rb_tree_const_iteratorISE_EDpOT_.isra.0.cold | 34 | ····31:·00013ce6····51·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_St3mapIS5_S5_St4lessIS5_ESaIS6_IS7_S5_EEEESt10_Select1stISE_ESA_SaISE_EE22_M_emplace_hint_uniqueIJRKSt21piecewise_construct_tSt5tupleIJRS7_EESN_IJEEEEESt17_Rb_tree_iteratorISE_ESt23_Rb_tree_const_iteratorISE_EDpOT_.isra.0.cold |
| 35 | ····32:·00013d19··1 | 35 | ····32:·00013d19··1733·FUNC····LOCAL··DEFAULT···14·_Z15PrepareHotspotsiPPKc.cold |
| 36 | ····33:·000191 | 36 | ····33:·000191a0····56·FUNC····LOCAL··DEFAULT···14·_GLOBAL__sub_I__Z19PrepareHotspotsHelpv |
| 37 | ····34:·0009 | 37 | ····34:·0009c3aa·····1·OBJECT··LOCAL··DEFAULT···27·_ZStL8__ioinit | Diff chunk too large, falling back to line-by-line diff (1172 lines added, 1177 lines removed) |
| 38 | ····35:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·validate_bed.cpp | 38 | ····35:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·validate_bed.cpp |
| 39 | ····36:·0002c | 39 | ····36:·0002c4f0···154·FUNC····LOCAL··DEFAULT···14·_ZNSt15_Deque_iteratorI10LogMessageRS0_PS0_EpLEi.isra.0 |
| 40 | ····37:·0002c | 40 | ····37:·0002c590····85·FUNC····LOCAL··DEFAULT···14·_ZNSt15_Deque_iteratorI7BedLineRS0_PS0_EpLEi.isra.0 |
| 41 | ····38:·0002c | 41 | ····38:·0002c5f0····93·FUNC····LOCAL··DEFAULT···14·_ZNSt15_Deque_iteratorIbRbPbEpLEi.isra.0 |
| 42 | ····39:·0002c | 42 | ····39:·0002c650···151·FUNC····LOCAL··DEFAULT···14·_ZNSt15_Deque_iteratorINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERS5_PS5_EpLEi.isra.0 |
| 43 | ····40:·0002c | 43 | ····40:·0002c6f0····57·FUNC····LOCAL··DEFAULT···14·_ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE7compareERKS4_.isra.0 |
| 44 | ····41:·0002c | 44 | ····41:·0002c730···167·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12_M_constructIPcEEvT_S7_St20forward_iterator_tag.isra.0 |
| 45 | ····42:·0002c | 45 | ····42:·0002c7e0····49·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE6assignEPKc.isra.0 |
| 46 | ····43:·00036 | 46 | ····43:·00036150···117·FUNC····LOCAL··DEFAULT···14·_ZSt4endlIcSt11char_traitsIcEERSt13basic_ostreamIT_T0_ES6_.isra.0 |
| 47 | ····44:·0002c | 47 | ····44:·0002c820···181·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEaSEOS4_.isra.0 |
| 48 | ····45:·0002c | 48 | ····45:·0002c8e0···167·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12_M_constructIPKcEEvT_S8_St20forward_iterator_tag.isra.0 |
| 49 | ····46:·0002c | 49 | ····46:·0002c990···216·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEC2IS3_EEPKcRKS3_.constprop.0 |
| 50 | ····47:·000 | 50 | ····47:·000361d0···285·FUNC····LOCAL··DEFAULT···14·_ZSt22__uninitialized_move_aISt15_Deque_iteratorINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERS6_PS6_ES9_SaIS6_EET0_T_SC_SB_RT1_.isra.0 |
| 51 | ····48:·0002c | 51 | ····48:·0002ca70···291·FUNC····LOCAL··DEFAULT···14·_ZNSt5dequeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS5_EE19_M_destroy_data_auxESt15_Deque_iteratorIS5_RS5_PS5_ESB_.isra.0 |
| 52 | ····49:·000 | 52 | ····49:·0002cba0···757·FUNC····LOCAL··DEFAULT···14·_ZN7BedLineaSEOS_.isra.0 |
| 53 | ····50:·0002c | 53 | ····50:·0002cea0···352·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_11OptArgumentESt10_Select1stIS9_ESt4lessIS5_ESaIS9_EE8_M_eraseEPSt13_Rb_tree_nodeIS9_E.isra.0 |
| 54 | ····51:·0002 | 54 | ····51:·0002d000···933·FUNC····LOCAL··DEFAULT···14·_ZNSt5dequeI10LogMessageSaIS0_EE12emplace_backIJS0_EEERS0_DpOT_.isra.0 |
| 55 | ····52:·0002d | 55 | ····52:·0002d3b0···534·FUNC····LOCAL··DEFAULT···14·_ZN7BedFile10log_columnE10ErrorLevel13SuppressGroupiiP7BedLinePKcS5_.isra.0 |
| 56 | ····53:·00014 | 56 | ····53:·000143de····36·FUNC····LOCAL··DEFAULT···14·_ZN7BedFile10log_columnE10ErrorLevel13SuppressGroupiiP7BedLinePKcS5_.isra.0.cold |
| 57 | ····54:·0002d | 57 | ····54:·0002d5d0···502·FUNC····LOCAL··DEFAULT···14·_ZN7BedFile8log_lineE10ErrorLevel13SuppressGroupiP7BedLinePKcS5_.isra.0 |
| 58 | ····55:·000144 | 58 | ····55:·00014402····36·FUNC····LOCAL··DEFAULT···14·_ZN7BedFile8log_lineE10ErrorLevel13SuppressGroupiP7BedLinePKcS5_.isra.0.cold |
| 59 | ····56:·0002d | 59 | ····56:·0002d7d0···716·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_iESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE8_M_eraseEPSt13_Rb_tree_nodeIS8_E.isra.0 |
| 60 | ····57:·000144 | 60 | ····57:·00014426····53·FUNC····LOCAL··DEFAULT···14·_Z15ValidateBedHelpv.cold |
| 61 | ····58:·000144 | 61 | ····58:·0001445b····20·FUNC····LOCAL··DEFAULT···14·_Z13validate_nameB5cxx11PciiP7BedLineR7BedFile.cold |
| 62 | ····59:·0002d | 62 | ····59:·0002de10···645·FUNC····LOCAL··DEFAULT···14·_ZNSt5dequeI7BedLineSaIS0_EE19_M_destroy_data_auxESt15_Deque_iteratorIS0_RS0_PS0_ES6_.isra.0 |
| 63 | ····60:·0002e | 63 | ····60:·0002eb10···785·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_iESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE22_M_emplace_hint_uniqueIJRKSt21piecewise_construct_tSt5tupleIJRS7_EESJ_IJEEEEESt17_Rb_tree_iteratorIS8_ESt23_Rb_tree_const_iteratorIS8_EDpOT_.isra.0 |
| 64 | ····61:·000144 | 64 | ····61:·00014470····51·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_iESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE22_M_emplace_hint_uniqueIJRKSt21piecewise_construct_tSt5tupleIJRS7_EESJ_IJEEEEESt17_Rb_tree_iteratorIS8_ESt23_Rb_tree_const_iteratorIS8_EDpOT_.isra.0.cold |
| 65 | ····62:·0002e | 65 | ····62:·0002ee30···466·FUNC····LOCAL··DEFAULT···14·_ZNSt5dequeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS5_EE12emplace_backIJS5_EEERS5_DpOT_.isra.0 |
| 66 | ····63:·000144 | 66 | ····63:·000144a3···364·FUNC····LOCAL··DEFAULT···14·_Z24parse_bed_detail_targetsPcS_iiP7BedLineR7BedFile.cold |
| 67 | ····64:·000146 | 67 | ····64:·0001460f····21·FUNC····LOCAL··DEFAULT···14·_Z25merge_overlapping_regionsR15ReferenceReaderR7BedFile.cold |
| 68 | ····65:·000146 | 68 | ····65:·00014624····93·FUNC····LOCAL··DEFAULT···14·_Z25parse_bed_detail_hotspotsPKcPciiP7BedLineR7BedFileR15ReferenceReader.cold |
| 69 | ····66:·00031 | 69 | ····66:·00031a00···236·FUNC····LOCAL··DEFAULT···14·_ZNSt5dequeIbSaIbEE12emplace_backIJbEEERbDpOT_.isra.0 |
| 70 | ····67:·000146 | 70 | ····67:·00014681····66·FUNC····LOCAL··DEFAULT···14·_Z16parse_track_linePciR7BedFile.cold |
| 71 | ····68:·00014 | 71 | ····68:·000146c3···259·FUNC····LOCAL··DEFAULT···14·_Z21load_and_validate_bedRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEER15ReferenceReaderR7BedFileRN4Json5ValueEb.cold |
| 72 | ····69:·00033 | 72 | ····69:·00033910···372·FUNC····LOCAL··DEFAULT···14·_ZSt22__uninitialized_copy_aISt15_Deque_iteratorINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERKS6_PS7_ES0_IS6_RS6_PS6_ES6_ET0_T_SF_SE_RSaIT1_E.isra.0 |
| 73 | ····70:·00014 | 73 | ····70:·000147c6····73·FUNC····LOCAL··DEFAULT···14·_ZSt22__uninitialized_copy_aISt15_Deque_iteratorINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERKS6_PS7_ES0_IS6_RS6_PS6_ES6_ET0_T_SF_SE_RSaIT1_E.isra.0.cold |
| 74 | ····71:·0003 | 74 | ····71:·0003a9d0···288·FUNC····LOCAL··DEFAULT···14·_ZSt22__uninitialized_move_aISt15_Deque_iteratorI7BedLineRS1_PS1_ES4_SaIS1_EET0_T_S7_S6_RT1_.isra.0 |
| 75 | ····72:·0003 | 75 | ····72:·00033a90··1425·FUNC····LOCAL··DEFAULT···14·_ZNSt5dequeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS5_EEaSERKS7_.isra.0 |
| 76 | ····73:·000 | 76 | ····73:·00014810···196·FUNC····LOCAL··DEFAULT···14·_ZNSt5dequeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS5_EEaSERKS7_.isra.0.cold |
| 77 | ····74:·000 | 77 | ····74:·0003fd80····95·FUNC····LOCAL··DEFAULT···14·_ZSt22__uninitialized_move_aISt15_Deque_iteratorIbRbPbES3_SaIbEET0_T_S6_S5_RT1_.isra.0 |
| 78 | ····75:·00040 | 78 | ····75:·00034030···222·FUNC····LOCAL··DEFAULT···14·_ZSt22__uninitialized_copy_aISt15_Deque_iteratorI7BedLineRKS1_PS2_ES0_IS1_RS1_PS1_ES1_ET0_T_SA_S9_RSaIT1_E.isra.0 |
| 79 | ····76:·000 | 79 | ····76:·000148d4····71·FUNC····LOCAL··DEFAULT···14·_ZSt22__uninitialized_copy_aISt15_Deque_iteratorI7BedLineRKS1_PS2_ES0_IS1_RS1_PS1_ES1_ET0_T_SA_S9_RSaIT1_E.isra.0.cold |
| 80 | ····77:·000 | 80 | ····77:·0001491b··1244·FUNC····LOCAL··DEFAULT···14·_Z11ValidateBediPPKc.cold |
| 81 | ····78:·0001 | 81 | ····78:·000191e0····56·FUNC····LOCAL··DEFAULT···14·_GLOBAL__sub_I__Z15ValidateBedHelpv |
| 82 | ····79:·000 | 82 | ····79:·0009c3ab·····1·OBJECT··LOCAL··DEFAULT···27·_ZStL8__ioinit |
| 83 | ····80:·000 | 83 | ····80:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·unify_vcf.cpp |
| 84 | ····81:·000 | 84 | ····81:·00042f70··1482·FUNC····LOCAL··DEFAULT···14·_ZN5boost4math5tools6detail23evaluate_rational_c_impIeyeEET1_PKT_PKT0_RKS4_PKNS_17integral_constantIiLi17EEE.isra.0 |
| 85 | ····82:·000 | 85 | ····82:·00043540····57·FUNC····LOCAL··DEFAULT···14·_ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE7compareERKS4_.isra.0 |
| 86 | ····83:·000 | 86 | ····83:·00043580···167·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12_M_constructIPcEEvT_S7_St20forward_iterator_tag.isra.0 |
| 87 | ····84:·0004 | 87 | ····84:·00043630····62·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE6appendEPKcj.isra.0 |
| 88 | ····85:·0004 | 88 | ····85:·00043670····75·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE6appendEPKc.isra.0 |
| 89 | ····86:·0004 | 89 | ····86:·000436c0···117·FUNC····LOCAL··DEFAULT···14·_ZSt4endlIcSt11char_traitsIcEERSt13basic_ostreamIT_T0_ES6_.isra.0 |
| 90 | ····87:·0004 | 90 | ····87:·00043740···181·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEaSEOS4_.isra.0 |
| 91 | ····88:·0004 | 91 | ····88:·00043800···167·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12_M_constructIPKcEEvT_S8_St20forward_iterator_tag.isra.0 |
| 92 | ····89:·0004 | 92 | ····89:·000438b0···216·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEC2IS3_EEPKcRKS3_.constprop.0 |
| 93 | ····90:·0004 | 93 | ····90:·00043990····81·FUNC····LOCAL··DEFAULT···14·_Z27validate_filename_parameterNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES4_.part.0 |
| 94 | ····91:·0004 | 94 | ····91:·000439f0····84·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_iESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE8_M_eraseEPSt13_Rb_tree_nodeIS8_E.isra.0 |
| 95 | ····92:·0004 | 95 | ····92:·00043a50····84·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_N3vcf16VariantFieldTypeEESt10_Select1stISA_ESt4lessIS5_ESaISA_EE8_M_eraseEPSt13_Rb_tree_nodeISA_E.isra.0 |
| 96 | ····93:·0004 | 96 | ····93:·00043ab0···113·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_S5_ESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE8_M_eraseEPSt13_Rb_tree_nodeIS8_E.isra.0 |
| 97 | ····94:·0004 | 97 | ····94:·00043b30···188·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_St6vectorIS5_SaIS5_EEESt10_Select1stISB_ESt4lessIS5_ESaISB_EE8_M_eraseEPSt13_Rb_tree_nodeISB_E.isra.0 |
| 98 | ····95:·0004 | 98 | ····95:·00043bf0···716·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_bESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE8_M_eraseEPSt13_Rb_tree_nodeIS8_E.isra.0 |
| 99 | ····96:·0004 | 99 | ····96:·00043ec0···294·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_St3mapIS5_St6vectorIS5_SaIS5_EESt4lessIS5_ESaIS6_IS7_SB_EEEESt10_Select1stISH_ESD_SaISH_EE8_M_eraseEPSt13_Rb_tree_nodeISH_E.isra.0 |
| 100 | ····97:·0004 | 100 | ····97:·00043ff0···352·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_11OptArgumentESt10_Select1stIS9_ESt4lessIS5_ESaIS9_EE8_M_eraseEPSt13_Rb_tree_nodeIS9_E.isra.0 |
| 101 | ····98:·0004 | 101 | ····98:·00044150···483·FUNC····LOCAL··DEFAULT···14·_ZSt9__find_ifIN9__gnu_cxx17__normal_iteratorIPNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt6vectorIS7_SaIS7_EEEENS0_5__ops16_Iter_equals_valIKS7_EEET_SH_SH_T0_St26random_access_iterator_tag.isra.0 |
| 102 | ····99:·000 | 102 | ····99:·000151bc····53·FUNC····LOCAL··DEFAULT···14·_Z12UnifyVcfHelpv.cold |
| 103 | ···100:·000 | 103 | ···100:·000151f1···100·FUNC····LOCAL··DEFAULT···14·_Z13extend_headerRN3vcf15VariantCallFileE.cold |
| 104 | ···101:·000 | 104 | ···101:·00015256···327·FUNC····LOCAL··DEFAULT···14·_ZN17CoverageInfoEntry5parseEPKcRK15ReferenceReader.cold |
| 105 | ···102:·00015 | 105 | ···102:·0001539e····39·FUNC····LOCAL··DEFAULT···14·_ZN16VcfOrderedMerger14next_cov_entryEv.cold |
| 106 | ···103:·000 | 106 | ···103:·00044f80···614·FUNC····LOCAL··DEFAULT···14·_ZN11bgzf_streamlsIA2_KcEERS_RT_.isra.0 |
| 107 | ···104:·00015 | 107 | ···104:·000153c6····46·FUNC····LOCAL··DEFAULT···14·_ZN11bgzf_streamlsIA2_KcEERS_RT_.isra.0.cold |
| 108 | ···105:·000 | 108 | ···105:·000452f0···133·FUNC····LOCAL··DEFAULT···14·_ZSt11__push_heapIN9__gnu_cxx17__normal_iteratorIPP20ComparableVcfVariantSt6vectorIS3_SaIS3_EEEEiS3_NS0_5__ops14_Iter_comp_valI17VariantComparatorEEEvT_T0_SE_T1_RT2_.isra.0 |
| 109 | ···106:·0004 | 109 | ···106:·00045380···212·FUNC····LOCAL··DEFAULT···14·_ZSt13__adjust_heapIN9__gnu_cxx17__normal_iteratorIPP20ComparableVcfVariantSt6vectorIS3_SaIS3_EEEEiS3_NS0_5__ops15_Iter_comp_iterI17VariantComparatorEEEvT_T0_SE_T1_T2_.isra.0 |
| 110 | ···107:·000153 | 110 | ···107:·000153f4···134·FUNC····LOCAL··DEFAULT···14·_Z14check_on_writeNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES4_.cold |
| 111 | ···108:·000 | 111 | ···108:·0001547a···144·FUNC····LOCAL··DEFAULT···14·_Z13check_on_readNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES4_.cold |
| 112 | ···109:·000 | 112 | ···109:·0001550a···305·FUNC····LOCAL··DEFAULT···14·_Z26parse_parameters_from_jsonNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERN3vcf15VariantCallFileE.cold |
| 113 | ···110:·00015 | 113 | ···110:·0001563c····20·FUNC····LOCAL··DEFAULT···14·_ZN16VcfOrderedMerger12write_headerERN3vcf15VariantCallFileENSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE.cold |
| 114 | ···111:·000 | 114 | ···111:·00046120···166·FUNC····LOCAL··DEFAULT···14·_ZNSt6vectorINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS5_EE12emplace_backIJS5_EEERS5_DpOT_.isra.0 |
| 115 | ···112:·000 | 115 | ···112:·000461d0···647·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_iESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE22_M_emplace_hint_uniqueIJRKSt21piecewise_construct_tSt5tupleIJRS7_EESJ_IJEEEEESt17_Rb_tree_iter[·...·truncated·by·diffoscope;·len:·53,·SHA:·a41729324737abc319d373ed40fe0fcf681ffd067d77adaae61499500af6074a·...·] |
| 116 | ···113:·000156 | 116 | ···113:·00015650····51·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_iESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE22_M_emplace_hint_uniqueIJRKSt21piecewise_construct_tSt5tupleIJRS7_EESJ_IJEEEEESt17_Rb_tree_iterato[·...·truncated·by·diffoscope;·len:·50,·SHA:·045975e44531ce93fffcfcc249c4724a727301511b410c536fbfa7bc871f3803·...·].cold |
| 117 | ···114:·0004 | 117 | ···114:·00046460···337·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_St6vectorIS5_SaIS5_EEESt10_Select1stISB_ESt4lessIS5_ESaISB_EE22_M_emplace_hint_uniqueIJRKSt21piecewise_construct_tSt5tupleIJRS7_EESM_IJEEE[·...·truncated·by·diffoscope;·len:·60,·SHA:·46f0842c90f4490066bdb5d2ec5bff8a1340e074d1ea392ccf25213210e81795·...·]DpOT_.isra.0 |
| 118 | ···115:·000 | 118 | ···115:·00015684····51·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_St6vectorIS5_SaIS5_EEESt10_Select1stISB_ESt4lessIS5_ESaISB_EE22_M_emplace_hint_uniqueIJRKSt21piecewise_construct_tSt5tupleIJRS7_EESM_IJEE[·...·truncated·by·diffoscope;·len:·78,·SHA:·1247ad902674a1422b20c4f5563c9e9da4c9ef0d4b6ddbbe5e131b8f137540c1·...·] |
| 119 | ···116:·000 | 119 | ···116:·00046740···438·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_St6vectorIS5_SaIS5_EEESt10_Select1stISB_ESt4lessIS5_ESaISB_EE22_M_emplace_hint_uniqueIJRKSt21piecewise_construct_tSt5tupleIJOS5_EESM_IJEE[·...·truncated·by·diffoscope;·len:·73,·SHA:·51528622e83509b94b26e5cba3293730a28d4ad8c82bfa7d46fbd9f830834afe·...·] |
| 120 | ···117:·000 | 120 | ···117:·000156b8····37·FUNC····LOCAL··DEFAULT···14·_ZN13PriorityQueue16get_next_variantEPN3vcf7VariantE.cold |
| 121 | ···118:·000156 | 121 | ···118:·000156de····61·FUNC····LOCAL··DEFAULT···14·_ZN13PriorityQueue18left_align_variantEPN3vcf7VariantE.cold |
| 122 | ···119:·000 | 122 | ···119:·0001571c···140·FUNC····LOCAL··DEFAULT···14·_ZN16VcfOrderedMerger26generate_novel_annotationsEPN3vcf7VariantE.cold |
| 123 | ···120:·00015 | 123 | ···120:·000157a8····22·FUNC····LOCAL··DEFAULT···14·_ZN13PriorityQueue12trim_variantEPN3vcf7VariantE.cold |
| 124 | ···121:·000 | 124 | ···121:·00047a40···657·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_St3mapIS5_St6vectorIS5_SaIS5_EESt4lessIS5_ESaIS6_IS7_SB_EEEESt10_Select1stISH_ESD_SaISH_EE22_M_emplace_hint_uniqueIJRKSt21piecewise_const[·...·truncated·by·diffoscope;·len:·102,·SHA:·2d253f57647e79efaebb26d1fbdb0b0ce2fa2e4dd88808d6ac1f5b3c328a3cb0·...·] |
| Max diff block lines reached; -1/299168 bytes (-0.00%) of diff not shown. | |||
| Offset 1, 8 lines modified | Offset 1, 8 lines modified | ||
| 1 | Displaying·notes·found·in:·.note.gnu.build-id | 1 | Displaying·notes·found·in:·.note.gnu.build-id |
| 2 | ··Owner················Data·size·» Description | 2 | ··Owner················Data·size·» Description |
| 3 | ··GNU··················0x00000014» NT_GNU_BUILD_ID·(unique·build·ID·bitstring)» ····Build·ID:· | 3 | ··GNU··················0x00000014» NT_GNU_BUILD_ID·(unique·build·ID·bitstring)» ····Build·ID:·75c35a2e593a19c76059c06af8374cca2dc53b60 |
| 4 | Displaying·notes·found·in:·.note.ABI-tag | 4 | Displaying·notes·found·in:·.note.ABI-tag |
| 5 | ··Owner················Data·size·» Description | 5 | ··Owner················Data·size·» Description |
| 6 | ··GNU··················0x00000010» NT_GNU_ABI_TAG·(ABI·version·tag)» ····OS:·Linux,·ABI:·3.2.0 | 6 | ··GNU··················0x00000010» NT_GNU_ABI_TAG·(ABI·version·tag)» ····OS:·Linux,·ABI:·3.2.0 |
| Offset 108, 108 lines modified | Offset 108, 108 lines modified | ||
| 108 | ··60» (udata)» 2» (line_strp)» (offset:·0x3be):·stdio2-decl.h | 108 | ··60» (udata)» 2» (line_strp)» (offset:·0x3be):·stdio2-decl.h |
| 109 | ··61» (udata)» 1» (line_strp)» (offset:·0x3cc):·tvcutils.h | 109 | ··61» (udata)» 1» (line_strp)» (offset:·0x3cc):·tvcutils.h |
| 110 | ··62» (udata)» 4» (line_strp)» (offset:·0x3d7):·new | 110 | ··62» (udata)» 4» (line_strp)» (offset:·0x3d7):·new |
| 111 | ··63» (udata)» 4» (line_strp)» (offset:·0x3db):·system_error | 111 | ··63» (udata)» 4» (line_strp)» (offset:·0x3db):·system_error |
| 112 | ·Line·Number·Statements: | 112 | ·Line·Number·Statements: |
| 113 | ··[0x0000019c]··Set·column·to·1 | 113 | ··[0x0000019c]··Set·column·to·1 |
| 114 | ··[0x0000019e]··Extended·opcode·2:·set·Address·to·0x195 | 114 | ··[0x0000019e]··Extended·opcode·2:·set·Address·to·0x19560 |
| 115 | ··[0x000001a5]··Advance·Line·by·16·to·17 | 115 | ··[0x000001a5]··Advance·Line·by·16·to·17 |
| 116 | ··[0x000001a7]··Copy | 116 | ··[0x000001a7]··Copy |
| 117 | ··[0x000001a8]··Set·is_stmt·to·0 | 117 | ··[0x000001a8]··Set·is_stmt·to·0 |
| 118 | ··[0x000001a9]··Advance·PC·by·constant·17·to·0x195 | 118 | ··[0x000001a9]··Advance·PC·by·constant·17·to·0x19571 |
| 119 | ··[0x000001aa]··Special·opcode·47:·advance·Address·by·3·to·0x195 | 119 | ··[0x000001aa]··Special·opcode·47:·advance·Address·by·3·to·0x19574·and·Line·by·0·to·17 |
| 120 | ··[0x000001ab]··Set·column·to·3 | 120 | ··[0x000001ab]··Set·column·to·3 |
| 121 | ··[0x000001ad]··Set·is_stmt·to·1 | 121 | ··[0x000001ad]··Set·is_stmt·to·1 |
| 122 | ··[0x000001ae]··Special·opcode·160:·advance·Address·by·11·to·0x195 | 122 | ··[0x000001ae]··Special·opcode·160:·advance·Address·by·11·to·0x1957f·and·Line·by·1·to·18 |
| 123 | ··[0x000001af]··Set·File·Name·to·entry·2·in·the·File·Name·Table | 123 | ··[0x000001af]··Set·File·Name·to·entry·2·in·the·File·Name·Table |
| 124 | ··[0x000001b1]··Set·column·to·1 | 124 | ··[0x000001b1]··Set·column·to·1 |
| 125 | ··[0x000001b3]··Advance·Line·by·66·to·84 | 125 | ··[0x000001b3]··Advance·Line·by·66·to·84 |
| 126 | ··[0x000001b6]··Copy·(view·1) | 126 | ··[0x000001b6]··Copy·(view·1) |
| 127 | ··[0x000001b7]··Set·column·to·3 | 127 | ··[0x000001b7]··Set·column·to·3 |
| 128 | ··[0x000001b9]··Special·opcode·7:·advance·Address·by·0·to·0x195 | 128 | ··[0x000001b9]··Special·opcode·7:·advance·Address·by·0·to·0x1957f·and·Line·by·2·to·86·(view·2) |
| 129 | ··[0x000001ba]··Set·column·to·23 | 129 | ··[0x000001ba]··Set·column·to·23 |
| 130 | ··[0x000001bc]··Set·is_stmt·to·0 | 130 | ··[0x000001bc]··Set·is_stmt·to·0 |
| 131 | ··[0x000001bd]··Copy·(view·3) | 131 | ··[0x000001bd]··Copy·(view·3) |
| 132 | ··[0x000001be]··Special·opcode·131:·advance·Address·by·9·to·0x195 | 132 | ··[0x000001be]··Special·opcode·131:·advance·Address·by·9·to·0x19588·and·Line·by·0·to·86 |
| 133 | ··[0x000001bf]··Set·File·Name·to·entry·1·in·the·File·Name·Table | 133 | ··[0x000001bf]··Set·File·Name·to·entry·1·in·the·File·Name·Table |
| 134 | ··[0x000001c1]··Set·column·to·3 | 134 | ··[0x000001c1]··Set·column·to·3 |
| 135 | ··[0x000001c3]··Set·is_stmt·to·1 | 135 | ··[0x000001c3]··Set·is_stmt·to·1 |
| 136 | ··[0x000001c4]··Advance·Line·by·-67·to·19 | 136 | ··[0x000001c4]··Advance·Line·by·-67·to·19 |
| 137 | ··[0x000001c7]··Copy·(view·1) | 137 | ··[0x000001c7]··Copy·(view·1) |
| 138 | ··[0x000001c8]··Set·column·to·97 | 138 | ··[0x000001c8]··Set·column·to·97 |
| 139 | ··[0x000001ca]··Set·is_stmt·to·0 | 139 | ··[0x000001ca]··Set·is_stmt·to·0 |
| 140 | ··[0x000001cb]··Special·opcode·6:·advance·Address·by·0·to·0x195 | 140 | ··[0x000001cb]··Special·opcode·6:·advance·Address·by·0·to·0x19588·and·Line·by·1·to·20·(view·2) |
| 141 | ··[0x000001cc]··Set·File·Name·to·entry·3·in·the·File·Name·Table | 141 | ··[0x000001cc]··Set·File·Name·to·entry·3·in·the·File·Name·Table |
| 142 | ··[0x000001ce]··Set·column·to·7 | 142 | ··[0x000001ce]··Set·column·to·7 |
| 143 | ··[0x000001d0]··Set·is_stmt·to·1 | 143 | ··[0x000001d0]··Set·is_stmt·to·1 |
| 144 | ··[0x000001d1]··Advance·Line·by·2534·to·2554 | 144 | ··[0x000001d1]··Advance·Line·by·2534·to·2554 |
| 145 | ··[0x000001d4]··Special·opcode·201:·advance·Address·by·14·to·0x195 | 145 | ··[0x000001d4]··Special·opcode·201:·advance·Address·by·14·to·0x19596·and·Line·by·0·to·2554 |
| 146 | ··[0x000001d5]··Advance·Line·by·-2321·to·233 | 146 | ··[0x000001d5]··Advance·Line·by·-2321·to·233 |
| 147 | ··[0x000001d8]··Copy·(view·1) | 147 | ··[0x000001d8]··Copy·(view·1) |
| 148 | ··[0x000001d9]··Set·column·to·28 | 148 | ··[0x000001d9]··Set·column·to·28 |
| 149 | ··[0x000001db]··Set·is_stmt·to·0 | 149 | ··[0x000001db]··Set·is_stmt·to·0 |
| 150 | ··[0x000001dc]··Special·opcode·6:·advance·Address·by·0·to·0x195 | 150 | ··[0x000001dc]··Special·opcode·6:·advance·Address·by·0·to·0x19596·and·Line·by·1·to·234·(view·2) |
| 151 | ··[0x000001dd]··Set·File·Name·to·entry·1·in·the·File·Name·Table | 151 | ··[0x000001dd]··Set·File·Name·to·entry·1·in·the·File·Name·Table |
| 152 | ··[0x000001df]··Set·column·to·63 | 152 | ··[0x000001df]··Set·column·to·63 |
| 153 | ··[0x000001e1]··Advance·Line·by·-214·to·20 | 153 | ··[0x000001e1]··Advance·Line·by·-214·to·20 |
| 154 | ··[0x000001e4]··Special·opcode·89:·advance·Address·by·6·to·0x195 | 154 | ··[0x000001e4]··Special·opcode·89:·advance·Address·by·6·to·0x1959c·and·Line·by·0·to·20 |
| 155 | ··[0x000001e5]··Set·File·Name·to·entry·3·in·the·File·Name·Table | 155 | ··[0x000001e5]··Set·File·Name·to·entry·3·in·the·File·Name·Table |
| 156 | ··[0x000001e7]··Set·column·to·7 | 156 | ··[0x000001e7]··Set·column·to·7 |
| 157 | ··[0x000001e9]··Set·is_stmt·to·1 | 157 | ··[0x000001e9]··Set·is_stmt·to·1 |
| 158 | ··[0x000001ea]··Advance·Line·by·2534·to·2554 | 158 | ··[0x000001ea]··Advance·Line·by·2534·to·2554 |
| 159 | ··[0x000001ed]··Special·opcode·173:·advance·Address·by·12·to·0x195 | 159 | ··[0x000001ed]··Special·opcode·173:·advance·Address·by·12·to·0x195a8·and·Line·by·0·to·2554 |
| 160 | ··[0x000001ee]··Advance·Line·by·-2321·to·233 | 160 | ··[0x000001ee]··Advance·Line·by·-2321·to·233 |
| 161 | ··[0x000001f1]··Copy·(view·1) | 161 | ··[0x000001f1]··Copy·(view·1) |
| 162 | ··[0x000001f2]··Set·File·Name·to·entry·1·in·the·File·Name·Table | 162 | ··[0x000001f2]··Set·File·Name·to·entry·1·in·the·File·Name·Table |
| 163 | ··[0x000001f4]··Set·column·to·29 | 163 | ··[0x000001f4]··Set·column·to·29 |
| 164 | ··[0x000001f6]··Set·is_stmt·to·0 | 164 | ··[0x000001f6]··Set·is_stmt·to·0 |
| 165 | ··[0x000001f7]··Advance·Line·by·-213·to·20 | 165 | ··[0x000001f7]··Advance·Line·by·-213·to·20 |
| 166 | ··[0x000001fa]··Copy·(view·2) | 166 | ··[0x000001fa]··Copy·(view·2) |
| 167 | ··[0x000001fb]··Set·File·Name·to·entry·3·in·the·File·Name·Table | 167 | ··[0x000001fb]··Set·File·Name·to·entry·3·in·the·File·Name·Table |
| 168 | ··[0x000001fd]··Set·column·to·28 | 168 | ··[0x000001fd]··Set·column·to·28 |
| 169 | ··[0x000001ff]··Advance·Line·by·214·to·234 | 169 | ··[0x000001ff]··Advance·Line·by·214·to·234 |
| 170 | ··[0x00000202]··Special·opcode·47:·advance·Address·by·3·to·0x195 | 170 | ··[0x00000202]··Special·opcode·47:·advance·Address·by·3·to·0x195ab·and·Line·by·0·to·234 |
| 171 | ··[0x00000203]··Special·opcode·47:·advance·Address·by·3·to·0x195 | 171 | ··[0x00000203]··Special·opcode·47:·advance·Address·by·3·to·0x195ae·and·Line·by·0·to·234 |
| 172 | ··[0x00000204]··Set·File·Name·to·entry·1·in·the·File·Name·Table | 172 | ··[0x00000204]··Set·File·Name·to·entry·1·in·the·File·Name·Table |
| 173 | ··[0x00000206]··Set·column·to·29 | 173 | ··[0x00000206]··Set·column·to·29 |
| 174 | ··[0x00000208]··Advance·Line·by·-214·to·20 | 174 | ··[0x00000208]··Advance·Line·by·-214·to·20 |
| 175 | ··[0x0000020b]··Copy·(view·1) | 175 | ··[0x0000020b]··Copy·(view·1) |
| 176 | ··[0x0000020c]··Set·File·Name·to·entry·3·in·the·File·Name·Table | 176 | ··[0x0000020c]··Set·File·Name·to·entry·3·in·the·File·Name·Table |
| 177 | ··[0x0000020e]··Set·column·to·7 | 177 | ··[0x0000020e]··Set·column·to·7 |
| 178 | ··[0x00000210]··Set·is_stmt·to·1 | 178 | ··[0x00000210]··Set·is_stmt·to·1 |
| 179 | ··[0x00000211]··Advance·Line·by·2534·to·2554 | 179 | ··[0x00000211]··Advance·Line·by·2534·to·2554 |
| 180 | ··[0x00000214]··Special·opcode·131:·advance·Address·by·9·to·0x195 | 180 | ··[0x00000214]··Special·opcode·131:·advance·Address·by·9·to·0x195b7·and·Line·by·0·to·2554 |
| 181 | ··[0x00000215]··Advance·Line·by·-2321·to·233 | 181 | ··[0x00000215]··Advance·Line·by·-2321·to·233 |
| 182 | ··[0x00000218]··Copy·(view·1) | 182 | ··[0x00000218]··Copy·(view·1) |
| 183 | ··[0x00000219]··Set·is_stmt·to·0 | 183 | ··[0x00000219]··Set·is_stmt·to·0 |
| 184 | ··[0x0000021a]··Copy·(view·2) | 184 | ··[0x0000021a]··Copy·(view·2) |
| 185 | ··[0x0000021b]··Set·File·Name·to·entry·2·in·the·File·Name·Table | 185 | ··[0x0000021b]··Set·File·Name·to·entry·2·in·the·File·Name·Table |
| 186 | ··[0x0000021d]··Set·column·to·1 | 186 | ··[0x0000021d]··Set·column·to·1 |
| 187 | ··[0x0000021f]··Set·is_stmt·to·1 | 187 | ··[0x0000021f]··Set·is_stmt·to·1 |
| 188 | ··[0x00000220]··Advance·Line·by·-149·to·84 | 188 | ··[0x00000220]··Advance·Line·by·-149·to·84 |
| 189 | ··[0x00000223]··Copy·(view·3) | 189 | ··[0x00000223]··Copy·(view·3) |
| 190 | ··[0x00000224]··Set·column·to·3 | 190 | ··[0x00000224]··Set·column·to·3 |
| 191 | ··[0x00000226]··Special·opcode·7:·advance·Address·by·0·to·0x195 | 191 | ··[0x00000226]··Special·opcode·7:·advance·Address·by·0·to·0x195b7·and·Line·by·2·to·86·(view·4) |
| 192 | ··[0x00000227]··Set·column·to·23 | 192 | ··[0x00000227]··Set·column·to·23 |
| 193 | ··[0x00000229]··Set·is_stmt·to·0 | 193 | ··[0x00000229]··Set·is_stmt·to·0 |
| 194 | ··[0x0000022a]··Copy·(view·5) | 194 | ··[0x0000022a]··Copy·(view·5) |
| 195 | ··[0x0000022b]··Set·File·Name·to·entry·3·in·the·File·Name·Table | 195 | ··[0x0000022b]··Set·File·Name·to·entry·3·in·the·File·Name·Table |
| 196 | ··[0x0000022d]··Set·column·to·28 | 196 | ··[0x0000022d]··Set·column·to·28 |
| 197 | ··[0x0000022f]··Advance·Line·by·148·to·234 | 197 | ··[0x0000022f]··Advance·Line·by·148·to·234 |
| 198 | ··[0x00000232]··Advance·PC·by·constant·17·to·0x195 | 198 | ··[0x00000232]··Advance·PC·by·constant·17·to·0x195c8 |
| 199 | ··[0x00000233]··Special·opcode·61:·advance·Address·by·4·to·0x195 | 199 | ··[0x00000233]··Special·opcode·61:·advance·Address·by·4·to·0x195cc·and·Line·by·0·to·234 |
| 200 | ··[0x00000234]··Set·column·to·2 | 200 | ··[0x00000234]··Set·column·to·2 |
| 201 | ··[0x00000236]··Advance·Line·by·51·to·285 | 201 | ··[0x00000236]··Advance·Line·by·51·to·285 |
| 202 | ··[0x00000238]··Special·opcode·47:·advance·Address·by·3·to·0x195 | 202 | ··[0x00000238]··Special·opcode·47:·advance·Address·by·3·to·0x195cf·and·Line·by·0·to·285 |
| 203 | ··[0x00000239]··Set·File·Name·to·entry·2·in·the·File·Name·Table | 203 | ··[0x00000239]··Set·File·Name·to·entry·2·in·the·File·Name·Table |
| 204 | ··[0x0000023b]··Set·column·to·72 | 204 | ··[0x0000023b]··Set·column·to·72 |
| 205 | ··[0x0000023d]··Advance·Line·by·-199·to·86 | 205 | ··[0x0000023d]··Advance·Line·by·-199·to·86 |
| 206 | ··[0x00000240]··Special·opcode·47:·advance·Address·by·3·to·0x195 | 206 | ··[0x00000240]··Special·opcode·47:·advance·Address·by·3·to·0x195d2·and·Line·by·0·to·86 |
| 207 | ··[0x00000241]··Special·opcode·47:·advance·Address·by·3·to·0x195 | 207 | ··[0x00000241]··Special·opcode·47:·advance·Address·by·3·to·0x195d5·and·Line·by·0·to·86 |
| 208 | ··[0x00000242]··Set·File·Name·to·entry·3·in·the·File·Name·Table | 208 | ··[0x00000242]··Set·File·Name·to·entry·3·in·the·File·Name·Table |
| 209 | ··[0x00000244]··Set·column·to·7 | 209 | ··[0x00000244]··Set·column·to·7 |
| 210 | ··[0x00000246]··Set·is_stmt·to·1 | 210 | ··[0x00000246]··Set·is_stmt·to·1 |
| 211 | ··[0x00000247]··Advance·Line·by·708·to·794 | 211 | ··[0x00000247]··Advance·Line·by·708·to·794 |
| 212 | ··[0x0000024a]··Copy·(view·1) | 212 | ··[0x0000024a]··Copy·(view·1) |
| 213 | ··[0x0000024b]··Advance·Line·by·-511·to·283 | 213 | ··[0x0000024b]··Advance·Line·by·-511·to·283 |
| 214 | ··[0x0000024e]··Copy·(view·2) | 214 | ··[0x0000024e]··Copy·(view·2) |
| Offset 225, 44 lines modified | Offset 225, 44 lines modified | ||
| 225 | ··[0x0000025b]··Set·is_stmt·to·0 | 225 | ··[0x0000025b]··Set·is_stmt·to·0 |
| 226 | ··[0x0000025c]··Copy·(view·7) | 226 | ··[0x0000025c]··Copy·(view·7) |
| 227 | ··[0x0000025d]··Set·column·to·2 | 227 | ··[0x0000025d]··Set·column·to·2 |
| 228 | ··[0x0000025f]··Advance·Line·by·36·to·285 | 228 | ··[0x0000025f]··Advance·Line·by·36·to·285 |
| 229 | ··[0x00000261]··Copy·(view·8) | 229 | ··[0x00000261]··Copy·(view·8) |
| 230 | ··[0x00000262]··Set·column·to·7 | 230 | ··[0x00000262]··Set·column·to·7 |
| 231 | ··[0x00000264]··Set·is_stmt·to·1 | 231 | ··[0x00000264]··Set·is_stmt·to·1 |
| 232 | ··[0x00000265]··Special·opcode·67:·advance·Address·by·4·to·0x195 | 232 | ··[0x00000265]··Special·opcode·67:·advance·Address·by·4·to·0x195d9·and·Line·by·6·to·291 |
| 233 | ··[0x00000266]··Set·File·Name·to·entry·4·in·the·File·Name·Table | 233 | ··[0x00000266]··Set·File·Name·to·entry·4·in·the·File·Name·Table |
| 234 | ··[0x00000268]··Advance·Line·by·204·to·495 | 234 | ··[0x00000268]··Advance·Line·by·204·to·495 |
| 235 | ··[0x0000026b]··Copy·(view·1) | 235 | ··[0x0000026b]··Copy·(view·1) |
| 236 | ··[0x0000026c]··Set·File·Name·to·entry·5·in·the·File·Name·Table | 236 | ··[0x0000026c]··Set·File·Name·to·entry·5·in·the·File·Name·Table |
| 237 | ··[0x0000026e]··Advance·Line·by·-353·to·142 | 237 | ··[0x0000026e]··Advance·Line·by·-353·to·142 |
| 238 | ··[0x00000271]··Copy·(view·2) | 238 | ··[0x00000271]··Copy·(view·2) |
| 239 | ··[0x00000272]··Set·File·Name·to·entry·3·in·the·File·Name·Table | 239 | ··[0x00000272]··Set·File·Name·to·entry·3·in·the·File·Name·Table |
| 240 | ··[0x00000274]··Set·column·to·34 | 240 | ··[0x00000274]··Set·column·to·34 |
| 241 | ··[0x00000276]··Set·is_stmt·to·0 | 241 | ··[0x00000276]··Set·is_stmt·to·0 |
| 242 | ··[0x00000277]··Advance·Line·by·150·to·292 | 242 | ··[0x00000277]··Advance·Line·by·150·to·292 |
| Max diff block lines reached; 41321815/41329770 bytes (99.98%) of diff not shown. | |||
| Offset 1, 14 lines modified | Offset 1, 14 lines modified | ||
| 1 | Contents·of·the·.debug_info·section: | 1 | Contents·of·the·.debug_info·section: |
| 2 | ··Compilation·Unit·@·offset·0: | 2 | ··Compilation·Unit·@·offset·0: |
| 3 | ···Length:········0x2a·(32-bit) | 3 | ···Length:········0x2a·(32-bit) |
| 4 | ···Version:·······5 | 4 | ···Version:·······5 |
| 5 | ···Unit·Type:·····DW_UT_partial·(3) | 5 | ···Unit·Type:·····DW_UT_partial·(3) |
| 6 | ···Abbrev·Offset:·0xb2 | 6 | ···Abbrev·Offset:·0xb231 |
| 7 | ···Pointer·Size:··4 | 7 | ···Pointer·Size:··4 |
| 8 | ·<0><c>:·Abbrev·Number:·65·(DW_TAG_partial_unit) | 8 | ·<0><c>:·Abbrev·Number:·65·(DW_TAG_partial_unit) |
| 9 | ····<d>···DW_AT_stmt_list···:·(sec_offset)·0 | 9 | ····<d>···DW_AT_stmt_list···:·(sec_offset)·0 |
| 10 | ····<11>···DW_AT_comp_dir····:·(line_strp)·(offset:·0):·./obj-i686-linux-gnu | 10 | ····<11>···DW_AT_comp_dir····:·(line_strp)·(offset:·0):·./obj-i686-linux-gnu |
| 11 | ·<1><15>:·Abbrev·Number:·9·(DW_TAG_imported_unit) | 11 | ·<1><15>:·Abbrev·Number:·9·(DW_TAG_imported_unit) |
| 12 | ····<16>···DW_AT_import······:·(GNU_ref_alt)·<0x221> | 12 | ····<16>···DW_AT_import······:·(GNU_ref_alt)·<0x221> |
| 13 | ·<1><1a>:·Abbrev·Number:·9·(DW_TAG_imported_unit) | 13 | ·<1><1a>:·Abbrev·Number:·9·(DW_TAG_imported_unit) |
| Offset 21, 1290303 lines modified | Offset 21, 1281389 lines modified | ||
| 21 | ····<25>···DW_AT_linkage_name:·(GNU_strp_alt)·(offset:·0xe0cc7)· | 21 | ····<25>···DW_AT_linkage_name:·(GNU_strp_alt)·(offset:·0xe0cc7)· |
| 22 | ····<29>···DW_AT_name········:·(GNU_strp_alt)·(offset:·0xe0cc7)· | 22 | ····<29>···DW_AT_name········:·(GNU_strp_alt)·(offset:·0xe0cc7)· |
| 23 | ·<1><2d>:·Abbrev·Number:·0 | 23 | ·<1><2d>:·Abbrev·Number:·0 |
| 24 | ··Compilation·Unit·@·offset·0x2e: | 24 | ··Compilation·Unit·@·offset·0x2e: |
| 25 | ···Length:········0x1c·(32-bit) | 25 | ···Length:········0x1c·(32-bit) |
| 26 | ···Version:·······5 | 26 | ···Version:·······5 |
| 27 | ···Unit·Type:·····DW_UT_partial·(3) | 27 | ···Unit·Type:·····DW_UT_partial·(3) |
| 28 | ···Abbrev·Offset:·0xb2 | 28 | ···Abbrev·Offset:·0xb231 |
| 29 | ···Pointer·Size:··4 | 29 | ···Pointer·Size:··4 |
| 30 | ·<0><3a>:·Abbrev·Number:·65·(DW_TAG_partial_unit) | 30 | ·<0><3a>:·Abbrev·Number:·65·(DW_TAG_partial_unit) |
| 31 | ····<3b>···DW_AT_stmt_list···:·(sec_offset)·0 | 31 | ····<3b>···DW_AT_stmt_list···:·(sec_offset)·0 |
| 32 | ····<3f>···DW_AT_comp_dir····:·(line_strp)·(offset:·0):·./obj-i686-linux-gnu | 32 | ····<3f>···DW_AT_comp_dir····:·(line_strp)·(offset:·0):·./obj-i686-linux-gnu |
| 33 | ·<1><43>:·Abbrev·Number:·9·(DW_TAG_imported_unit) | 33 | ·<1><43>:·Abbrev·Number:·9·(DW_TAG_imported_unit) |
| 34 | ····<44>···DW_AT_import······:·(GNU_ref_alt)·<0x2cb> | 34 | ····<44>···DW_AT_import······:·(GNU_ref_alt)·<0x2cb> |
| 35 | ·<1><48>:·Abbrev·Number:·9·(DW_TAG_imported_unit) | 35 | ·<1><48>:·Abbrev·Number:·9·(DW_TAG_imported_unit) |
| 36 | ····<49>···DW_AT_import······:·(GNU_ref_alt)·<0xa | 36 | ····<49>···DW_AT_import······:·(GNU_ref_alt)·<0xa51d3> |
| 37 | ·<1><4d>:·Abbrev·Number:·0 | 37 | ·<1><4d>:·Abbrev·Number:·0 |
| 38 | ··Compilation·Unit·@·offset·0x4e: | 38 | ··Compilation·Unit·@·offset·0x4e: |
| 39 | ···Length:········0x | 39 | ···Length:········0x84·(32-bit) |
| 40 | ···Version:·······5 | 40 | ···Version:·······5 |
| 41 | ···Unit·Type:·····DW_UT_partial·(3) | 41 | ···Unit·Type:·····DW_UT_partial·(3) |
| 42 | ···Abbrev·Offset:·0xb2 | 42 | ···Abbrev·Offset:·0xb231 |
| 43 | ···Pointer·Size:··4 | 43 | ···Pointer·Size:··4 |
| 44 | ·<0><5a>:·Abbrev·Number:·65·(DW_TAG_partial_unit) | 44 | ·<0><5a>:·Abbrev·Number:·65·(DW_TAG_partial_unit) |
| 45 | ····<5b>···DW_AT_stmt_list···:·(sec_offset)·0 | 45 | ····<5b>···DW_AT_stmt_list···:·(sec_offset)·0 |
| 46 | ····<5f>···DW_AT_comp_dir····:·(line_strp)·(offset:·0):·./obj-i686-linux-gnu | 46 | ····<5f>···DW_AT_comp_dir····:·(line_strp)·(offset:·0):·./obj-i686-linux-gnu |
| 47 | ·<1><63>:·Abbrev·Number:·9·(DW_TAG_imported_unit) | 47 | ·<1><63>:·Abbrev·Number:·9·(DW_TAG_imported_unit) |
| 48 | ····<64>···DW_AT_import······:·(GNU_ref_alt)·<0x323> | 48 | ····<64>···DW_AT_import······:·(GNU_ref_alt)·<0x323> |
| 49 | ·<1><68>:·Abbrev·Number:·9·(DW_TAG_imported_unit) | 49 | ·<1><68>:·Abbrev·Number:·9·(DW_TAG_imported_unit) |
| 50 | ····<69>···DW_AT_import······:·(GNU_ref_alt)·<0x17dd> | 50 | ····<69>···DW_AT_import······:·(GNU_ref_alt)·<0x17dd> |
| 51 | ·<1><6d>:·Abbrev·Number:·9·(DW_TAG_imported_unit) | 51 | ·<1><6d>:·Abbrev·Number:·9·(DW_TAG_imported_unit) |
| 52 | ····<6e>···DW_AT_import······:·(GNU_ref_alt)·<0x181b> | 52 | ····<6e>···DW_AT_import······:·(GNU_ref_alt)·<0x181b> |
| 53 | ·<1><72>:·Abbrev·Number:·9·(DW_TAG_imported_unit) | 53 | ·<1><72>:·Abbrev·Number:·9·(DW_TAG_imported_unit) |
| 54 | ····<73>···DW_AT_import······:·(GNU_ref_alt)·<0x | 54 | ····<73>···DW_AT_import······:·(GNU_ref_alt)·<0x1891> |
| 55 | ·<1><77>:·Abbrev·Number:·9·(DW_TAG_imported_unit) | 55 | ·<1><77>:·Abbrev·Number:·9·(DW_TAG_imported_unit) |
| 56 | ····<78>···DW_AT_import······:·(GNU_ref_alt)·<0x3 | 56 | ····<78>···DW_AT_import······:·(GNU_ref_alt)·<0x32f5> |
| 57 | ·<1><7c>:·Abbrev·Number:·9·(DW_TAG_imported_unit) | 57 | ·<1><7c>:·Abbrev·Number:·9·(DW_TAG_imported_unit) |
| 58 | ····<7d>···DW_AT_import······:·(GNU_ref_alt)·<0x35 | 58 | ····<7d>···DW_AT_import······:·(GNU_ref_alt)·<0x358c> |
| 59 | ·<1><81>:·Abbrev·Number:·9·(DW_TAG_imported_unit) | 59 | ·<1><81>:·Abbrev·Number:·9·(DW_TAG_imported_unit) |
| 60 | ····<82>···DW_AT_import······:·(GNU_ref_alt)·<0x35ec> | ||
| 61 | ·<1><86>:·Abbrev·Number:·9·(DW_TAG_imported_unit) | ||
| 60 | ····<8 | 62 | ····<87>···DW_AT_import······:·(GNU_ref_alt)·<0xa51f7> |
| 61 | ·<1><8 | 63 | ·<1><8b>:·Abbrev·Number:·81·(DW_TAG_namespace) |
| 62 | ····<8 | 64 | ····<8c>···DW_AT_name········:·(string)·std |
| 63 | ····< | 65 | ····<90>···DW_AT_sibling·····:·(ref_udata)·<0xa9> |
| 64 | ·<2>< | 66 | ·<2><91>:·Abbrev·Number:·87·(DW_TAG_imported_declaration) |
| 65 | ····< | 67 | ····<92>···DW_AT_decl_file···:·(data1)·26 |
| 66 | ····< | 68 | ····<93>···DW_AT_decl_line···:·(data1)·140 |
| 67 | ····< | 69 | ····<94>···DW_AT_decl_column·:·(data1)·11 |
| 68 | ····<9 | 70 | ····<95>···DW_AT_import······:·(ref_udata)·<0xb0>» [Abbrev·Number:·84·(DW_TAG_subprogram)] |
| 69 | ·<2><9 | 71 | ·<2><96>:·Abbrev·Number:·86·(DW_TAG_subprogram) |
| 70 | ····<9 | 72 | ····<97>···DW_AT_external····:·(flag_present)·1 |
| 71 | ····<9 | 73 | ····<97>···DW_AT_name········:·(GNU_strp_alt)·(offset:·0xe2ac0)· |
| 72 | ····<9 | 74 | ····<9b>···DW_AT_decl_file···:·(data1)·35 |
| 73 | ····<9 | 75 | ····<9c>···DW_AT_decl_line···:·(data1)·66 |
| 74 | ····<9 | 76 | ····<9d>···DW_AT_decl_column·:·(data1)·3 |
| 75 | ····<9 | 77 | ····<9e>···DW_AT_linkage_name:·(GNU_strp_alt)·(offset:·0xc0f99)· |
| 76 | ····< | 78 | ····<a2>···DW_AT_noreturn····:·(flag_present)·1 |
| 77 | ····< | 79 | ····<a2>···DW_AT_declaration·:·(flag_present)·1 |
| 78 | ·<3>< | 80 | ·<3><a2>:·Abbrev·Number:·82·(DW_TAG_formal_parameter) |
| 79 | ····< | 81 | ····<a3>···DW_AT_type········:·(GNU_ref_alt)·<0x187> |
| 80 | ·<3><a | 82 | ·<3><a7>:·Abbrev·Number:·0 |
| 81 | ·<2><a | 83 | ·<2><a8>:·Abbrev·Number:·0 |
| 82 | ·<1><a | 84 | ·<1><a9>:·Abbrev·Number:·85·(DW_TAG_namespace) |
| 83 | ····<a | 85 | ····<aa>···DW_AT_name········:·(GNU_strp_alt)·(offset:·0x13bb03)· |
| 84 | ····<a | 86 | ····<ae>···DW_AT_sibling·····:·(ref_udata)·<0xb0> |
| 85 | ·<2><a | 87 | ·<2><af>:·Abbrev·Number:·0 |
| 86 | ·<1>< | 88 | ·<1><b0>:·Abbrev·Number:·84·(DW_TAG_subprogram) |
| 87 | ····< | 89 | ····<b1>···DW_AT_external····:·(flag_present)·1 |
| 88 | ····< | 90 | ····<b1>···DW_AT_name········:·(GNU_strp_alt)·(offset:·0xcbe05)· |
| 89 | ····<b | 91 | ····<b5>···DW_AT_decl_file···:·(data1)·49 |
| 90 | ····<b | 92 | ····<b6>···DW_AT_decl_line···:·(data1)·25 |
| 91 | ····<b | 93 | ····<b7>···DW_AT_decl_column·:·(data1)·1 |
| 92 | ····<b | 94 | ····<b8>···DW_AT_type········:·(GNU_ref_alt)·<0x226> |
| 93 | ····<b | 95 | ····<bc>···DW_AT_declaration·:·(flag_present)·1 |
| 94 | ····<b | 96 | ····<bc>···DW_AT_sibling·····:·(ref_udata)·<0xc3> |
| 95 | ·<2><b | 97 | ·<2><bd>:·Abbrev·Number:·82·(DW_TAG_formal_parameter) |
| 96 | ····<b | 98 | ····<be>···DW_AT_type········:·(GNU_ref_alt)·<0x187> |
| 97 | ·<2>< | 99 | ·<2><c2>:·Abbrev·Number:·0 |
| 98 | ·<1><be>:·Abbrev·Number:·79·(DW_TAG_subprogram) | ||
| 99 | ····<bf>···DW_AT_external····:·(flag_present)·1 | ||
| 100 | ····<bf>···DW_AT_declaration·:·(flag_present)·1 | ||
| 101 | ····<bf>···DW_AT_linkage_name:·(GNU_strp_alt)·(offset:·0x13bc64)· | ||
| 102 | ····<c3>···DW_AT_name········:·(GNU_strp_alt)·(offset:·0x13bc52)· | ||
| 103 | ·<1><c | 100 | ·<1><c3>:·Abbrev·Number:·79·(DW_TAG_subprogram) |
| 104 | ····<c | 101 | ····<c4>···DW_AT_external····:·(flag_present)·1 |
| 105 | ····<c | 102 | ····<c4>···DW_AT_declaration·:·(flag_present)·1 |
| 103 | ····<c4>···DW_AT_linkage_name:·(GNU_strp_alt)·(offset:·0x13bc70)· | ||
| 104 | ····<c8>···DW_AT_name········:·(GNU_strp_alt)·(offset:·0x13bc5e)· | ||
| 105 | ·<1><cc>:·Abbrev·Number:·79·(DW_TAG_subprogram) | ||
| 106 | ····<cd>···DW_AT_external····:·(flag_present)·1 | ||
| 107 | ····<cd>···DW_AT_declaration·:·(flag_present)·1 | ||
| 106 | ····<c | 108 | ····<cd>···DW_AT_linkage_name:·(GNU_strp_alt)·(offset:·0xc3864)· |
| 107 | ····< | 109 | ····<d1>···DW_AT_name········:·(GNU_strp_alt)·(offset:·0xc3873)· |
| 108 | ·<1><d | 110 | ·<1><d5>:·Abbrev·Number:·0 |
| 109 | ··Compilation·Unit·@·offset·0xd | 111 | ··Compilation·Unit·@·offset·0xd6: |
| 110 | ···Length:········0x35·(32-bit) | 112 | ···Length:········0x35·(32-bit) |
| 111 | ···Version:·······5 | 113 | ···Version:·······5 |
| 112 | ···Unit·Type:·····DW_UT_partial·(3) | 114 | ···Unit·Type:·····DW_UT_partial·(3) |
| 113 | ···Abbrev·Offset:·0xb2 | 115 | ···Abbrev·Offset:·0xb231 |
| 114 | ···Pointer·Size:··4 | 116 | ···Pointer·Size:··4 |
| 115 | ·<0>< | 117 | ·<0><e2>:·Abbrev·Number:·65·(DW_TAG_partial_unit) |
| 116 | ····< | 118 | ····<e3>···DW_AT_stmt_list···:·(sec_offset)·0 |
| 117 | ····<e | 119 | ····<e7>···DW_AT_comp_dir····:·(line_strp)·(offset:·0):·./obj-i686-linux-gnu |
| 118 | ·<1><e | 120 | ·<1><eb>:·Abbrev·Number:·9·(DW_TAG_imported_unit) |
| 119 | ····<e | 121 | ····<ec>···DW_AT_import······:·(GNU_ref_alt)·<0x313a> |
| 120 | ·<1>< | 122 | ·<1><f0>:·Abbrev·Number:·81·(DW_TAG_namespace) |
| 121 | ····< | 123 | ····<f1>···DW_AT_name········:·(string)·std |
| 122 | ····<f | 124 | ····<f5>···DW_AT_sibling·····:·(ref_udata)·<0x108> |
| 123 | ·<2><f | 125 | ·<2><f6>:·Abbrev·Number:·97·(DW_TAG_subprogram) |
| 124 | ····<f | 126 | ····<f7>···DW_AT_external····:·(flag_present)·1 |
| 125 | ····<f | 127 | ····<f7>···DW_AT_name········:·(GNU_strp_alt)·(offset:·0xc2314)· |
| Max diff block lines reached; 142462471/142472743 bytes (99.99%) of diff not shown. | |||
| Offset 1000, 22 lines modified | Offset 1000, 22 lines modified | ||
| 1000 | ····DW_AT_location·····DW_FORM_sec_offset | 1000 | ····DW_AT_location·····DW_FORM_sec_offset |
| 1001 | ····DW_AT_GNU_locviews·DW_FORM_sec_offset | 1001 | ····DW_AT_GNU_locviews·DW_FORM_sec_offset |
| 1002 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 1002 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 1003 | ···2······DW_TAG_formal_parameter····[no·children] | 1003 | ···2······DW_TAG_formal_parameter····[no·children] |
| 1004 | ····DW_AT_type·········DW_FORM_ref_udata | 1004 | ····DW_AT_type·········DW_FORM_ref_udata |
| 1005 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 1005 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 1006 | ···3······DW_TAG_formal_parameter····[no·children] | 1006 | ···3······DW_TAG_formal_parameter····[no·children] |
| 1007 | ····DW_AT_type·········DW_FORM_ref_udata | ||
| 1008 | ····DW_AT_artificial···DW_FORM_flag_present | ||
| 1009 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| 1010 | ···4······DW_TAG_formal_parameter····[no·children] | ||
| 1011 | ····DW_AT_abstract_origin·DW_FORM_GNU_ref_alt | 1007 | ····DW_AT_abstract_origin·DW_FORM_GNU_ref_alt |
| 1012 | ····DW_AT_location·····DW_FORM_sec_offset | 1008 | ····DW_AT_location·····DW_FORM_sec_offset |
| 1013 | ····DW_AT_GNU_locviews·DW_FORM_sec_offset | 1009 | ····DW_AT_GNU_locviews·DW_FORM_sec_offset |
| 1014 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 1010 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 1011 | ···4······DW_TAG_formal_parameter····[no·children] | ||
| 1012 | ····DW_AT_type·········DW_FORM_ref_udata | ||
| 1013 | ····DW_AT_artificial···DW_FORM_flag_present | ||
| 1014 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| 1015 | ···5······DW_TAG_formal_parameter····[no·children] | 1015 | ···5······DW_TAG_formal_parameter····[no·children] |
| 1016 | ····DW_AT_abstract_origin·DW_FORM_ref_udata | 1016 | ····DW_AT_abstract_origin·DW_FORM_ref_udata |
| 1017 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 1017 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 1018 | ···6······DW_TAG_inlined_subroutine····[has·children] | 1018 | ···6······DW_TAG_inlined_subroutine····[has·children] |
| 1019 | ····DW_AT_abstract_origin·DW_FORM_ref_udata | 1019 | ····DW_AT_abstract_origin·DW_FORM_ref_udata |
| 1020 | ····DW_AT_entry_pc·····DW_FORM_addr | 1020 | ····DW_AT_entry_pc·····DW_FORM_addr |
| 1021 | ····DW_AT_GNU_entry_view·DW_FORM_data2 | 1021 | ····DW_AT_GNU_entry_view·DW_FORM_data2 |
| Offset 1169, 27 lines modified | Offset 1169, 27 lines modified | ||
| 1169 | ····DW_AT_location·····DW_FORM_sec_offset | 1169 | ····DW_AT_location·····DW_FORM_sec_offset |
| 1170 | ····DW_AT_GNU_locviews·DW_FORM_sec_offset | 1170 | ····DW_AT_GNU_locviews·DW_FORM_sec_offset |
| 1171 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 1171 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 1172 | ···28······DW_TAG_pointer_type····[no·children] | 1172 | ···28······DW_TAG_pointer_type····[no·children] |
| 1173 | ····DW_AT_byte_size····DW_FORM_implicit_const:·4 | 1173 | ····DW_AT_byte_size····DW_FORM_implicit_const:·4 |
| 1174 | ····DW_AT_type·········DW_FORM_ref_udata | 1174 | ····DW_AT_type·········DW_FORM_ref_udata |
| 1175 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 1175 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 1176 | ···29······DW_TAG_call_site_parameter····[no·children] | ||
| 1177 | ····DW_AT_location·····DW_FORM_exprloc | ||
| 1178 | ····DW_AT_call_value···DW_FORM_exprloc | ||
| 1179 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| 1180 | ··· | 1176 | ···29······DW_TAG_call_site····[no·children] |
| 1181 | ····DW_AT_call_return_pc·DW_FORM_addr | 1177 | ····DW_AT_call_return_pc·DW_FORM_addr |
| 1182 | ····DW_AT_call_origin··DW_FORM_ref_addr | 1178 | ····DW_AT_call_origin··DW_FORM_ref_addr |
| 1183 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 1179 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 1184 | ···3 | 1180 | ···30······DW_TAG_subprogram····[has·children] |
| 1185 | ····DW_AT_specification·DW_FORM_ref_udata | 1181 | ····DW_AT_specification·DW_FORM_ref_udata |
| 1186 | ····DW_AT_inline·······DW_FORM_data1 | 1182 | ····DW_AT_inline·······DW_FORM_data1 |
| 1187 | ····DW_AT_sibling······DW_FORM_ref_udata | 1183 | ····DW_AT_sibling······DW_FORM_ref_udata |
| 1188 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 1184 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 1185 | ···31······DW_TAG_call_site_parameter····[no·children] | ||
| 1186 | ····DW_AT_location·····DW_FORM_exprloc | ||
| 1187 | ····DW_AT_call_value···DW_FORM_exprloc | ||
| 1188 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| 1189 | ···32······DW_TAG_inlined_subroutine····[has·children] | 1189 | ···32······DW_TAG_inlined_subroutine····[has·children] |
| 1190 | ····DW_AT_abstract_origin·DW_FORM_ref_udata | 1190 | ····DW_AT_abstract_origin·DW_FORM_ref_udata |
| 1191 | ····DW_AT_entry_pc·····DW_FORM_addr | 1191 | ····DW_AT_entry_pc·····DW_FORM_addr |
| 1192 | ····DW_AT_GNU_entry_view·DW_FORM_data2 | 1192 | ····DW_AT_GNU_entry_view·DW_FORM_data2 |
| 1193 | ····DW_AT_ranges·······DW_FORM_sec_offset | 1193 | ····DW_AT_ranges·······DW_FORM_sec_offset |
| 1194 | ····DW_AT_call_file····DW_FORM_data1 | 1194 | ····DW_AT_call_file····DW_FORM_data1 |
| 1195 | ····DW_AT_call_line····DW_FORM_data1 | 1195 | ····DW_AT_call_line····DW_FORM_data1 |
| Offset 1264, 63 lines modified | Offset 1264, 63 lines modified | ||
| 1264 | ···40······DW_TAG_GNU_template_parameter_pack····[has·children] | 1264 | ···40······DW_TAG_GNU_template_parameter_pack····[has·children] |
| 1265 | ····DW_AT_name·········DW_FORM_GNU_strp_alt | 1265 | ····DW_AT_name·········DW_FORM_GNU_strp_alt |
| 1266 | ····DW_AT_sibling······DW_FORM_ref_udata | 1266 | ····DW_AT_sibling······DW_FORM_ref_udata |
| 1267 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 1267 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 1268 | ···41······DW_TAG_template_type_param····[no·children] | 1268 | ···41······DW_TAG_template_type_param····[no·children] |
| 1269 | ····DW_AT_type·········DW_FORM_ref_udata | 1269 | ····DW_AT_type·········DW_FORM_ref_udata |
| 1270 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 1270 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 1271 | ···42······DW_TAG_variable····[no·children] | ||
| 1272 | ····DW_AT_abstract_origin·DW_FORM_ref_udata | ||
| 1273 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| 1271 | ···4 | 1274 | ···43······DW_TAG_inlined_subroutine····[has·children] |
| 1272 | ····DW_AT_abstract_origin·DW_FORM_ref_udata | 1275 | ····DW_AT_abstract_origin·DW_FORM_ref_udata |
| 1273 | ····DW_AT_entry_pc·····DW_FORM_addr | 1276 | ····DW_AT_entry_pc·····DW_FORM_addr |
| 1274 | ····DW_AT_GNU_entry_view·DW_FORM_data2 | 1277 | ····DW_AT_GNU_entry_view·DW_FORM_data2 |
| 1275 | ····DW_AT_low_pc·······DW_FORM_addr | 1278 | ····DW_AT_low_pc·······DW_FORM_addr |
| 1276 | ····DW_AT_high_pc······DW_FORM_udata | 1279 | ····DW_AT_high_pc······DW_FORM_udata |
| 1277 | ····DW_AT_call_file····DW_FORM_data1 | 1280 | ····DW_AT_call_file····DW_FORM_data1 |
| 1278 | ····DW_AT_call_line····DW_FORM_data1 | 1281 | ····DW_AT_call_line····DW_FORM_data1 |
| 1279 | ····DW_AT_call_column··DW_FORM_data1 | 1282 | ····DW_AT_call_column··DW_FORM_data1 |
| 1280 | ····DW_AT_sibling······DW_FORM_ref_udata | 1283 | ····DW_AT_sibling······DW_FORM_ref_udata |
| 1281 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 1284 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 1282 | ···4 | 1285 | ···44······DW_TAG_typedef····[no·children] |
| 1283 | ····DW_AT_name·········DW_FORM_GNU_strp_alt | 1286 | ····DW_AT_name·········DW_FORM_GNU_strp_alt |
| 1284 | ····DW_AT_decl_file····DW_FORM_data1 | 1287 | ····DW_AT_decl_file····DW_FORM_data1 |
| 1285 | ····DW_AT_decl_line····DW_FORM_data1 | 1288 | ····DW_AT_decl_line····DW_FORM_data1 |
| 1286 | ····DW_AT_decl_column··DW_FORM_data1 | 1289 | ····DW_AT_decl_column··DW_FORM_data1 |
| 1287 | ····DW_AT_type·········DW_FORM_ref_udata | 1290 | ····DW_AT_type·········DW_FORM_ref_udata |
| 1288 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 1291 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 1289 | ···44······DW_TAG_variable····[no·children] | ||
| 1290 | ····DW_AT_abstract_origin·DW_FORM_ref_udata | ||
| 1291 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| 1292 | ···45······DW_TAG_typedef····[no·children] | 1292 | ···45······DW_TAG_typedef····[no·children] |
| 1293 | ····DW_AT_name·········DW_FORM_GNU_strp_alt | 1293 | ····DW_AT_name·········DW_FORM_GNU_strp_alt |
| 1294 | ····DW_AT_decl_file····DW_FORM_data1 | 1294 | ····DW_AT_decl_file····DW_FORM_data1 |
| 1295 | ····DW_AT_decl_line····DW_FORM_data2 | 1295 | ····DW_AT_decl_line····DW_FORM_data2 |
| 1296 | ····DW_AT_decl_column··DW_FORM_data1 | 1296 | ····DW_AT_decl_column··DW_FORM_data1 |
| 1297 | ····DW_AT_type·········DW_FORM_ref_udata | 1297 | ····DW_AT_type·········DW_FORM_ref_udata |
| 1298 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 1298 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 1299 | ···46······DW_TAG_template_type_param····[no·children] | 1299 | ···46······DW_TAG_template_type_param····[no·children] |
| 1300 | ····DW_AT_type·········DW_FORM_GNU_ref_alt | 1300 | ····DW_AT_type·········DW_FORM_GNU_ref_alt |
| 1301 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 1301 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 1302 | ···47······DW_TAG_call_site····[has·children] | ||
| 1303 | ····DW_AT_call_return_pc·DW_FORM_addr | ||
| 1304 | ····DW_AT_call_origin··DW_FORM_ref_udata | ||
| 1305 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| 1306 | ···4 | 1302 | ···47······DW_TAG_subprogram····[has·children] |
| 1307 | ····DW_AT_abstract_origin·DW_FORM_ref_udata | 1303 | ····DW_AT_abstract_origin·DW_FORM_ref_udata |
| 1308 | ····DW_AT_linkage_name·DW_FORM_GNU_strp_alt | 1304 | ····DW_AT_linkage_name·DW_FORM_GNU_strp_alt |
| 1309 | ····DW_AT_object_pointer·DW_FORM_ref_udata | 1305 | ····DW_AT_object_pointer·DW_FORM_ref_udata |
| 1310 | ····DW_AT_sibling······DW_FORM_ref_udata | 1306 | ····DW_AT_sibling······DW_FORM_ref_udata |
| 1311 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 1307 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 1312 | ···4 | 1308 | ···48······DW_TAG_typedef····[no·children] |
| 1313 | ····DW_AT_name·········DW_FORM_GNU_strp_alt | 1309 | ····DW_AT_name·········DW_FORM_GNU_strp_alt |
| 1314 | ····DW_AT_decl_file····DW_FORM_data1 | 1310 | ····DW_AT_decl_file····DW_FORM_data1 |
| 1315 | ····DW_AT_decl_line····DW_FORM_data2 | 1311 | ····DW_AT_decl_line····DW_FORM_data2 |
| 1316 | ····DW_AT_decl_column··DW_FORM_data1 | 1312 | ····DW_AT_decl_column··DW_FORM_data1 |
| 1317 | ····DW_AT_type·········DW_FORM_ref_udata | 1313 | ····DW_AT_type·········DW_FORM_ref_udata |
| 1318 | ····DW_AT_accessibility·DW_FORM_data1 | 1314 | ····DW_AT_accessibility·DW_FORM_data1 |
| 1319 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 1315 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 1316 | ···49······DW_TAG_call_site····[has·children] | ||
| 1317 | ····DW_AT_call_return_pc·DW_FORM_addr | ||
| 1318 | ····DW_AT_call_origin··DW_FORM_ref_udata | ||
| 1319 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| 1320 | ···50······DW_TAG_rvalue_reference_type····[no·children] | 1320 | ···50······DW_TAG_rvalue_reference_type····[no·children] |
| 1321 | ····DW_AT_byte_size····DW_FORM_implicit_const:·4 | 1321 | ····DW_AT_byte_size····DW_FORM_implicit_const:·4 |
| 1322 | ····DW_AT_type·········DW_FORM_ref_udata | 1322 | ····DW_AT_type·········DW_FORM_ref_udata |
| 1323 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 1323 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 1324 | ···51······DW_TAG_subprogram····[has·children] | 1324 | ···51······DW_TAG_subprogram····[has·children] |
| Max diff block lines reached; 674425/680254 bytes (99.14%) of diff not shown. | |||
| Offset 1, 462 lines modified | Offset 1, 458 lines modified | ||
| 1 | Contents·of·the·.debug_aranges·section: | 1 | Contents·of·the·.debug_aranges·section: |
| 2 | ··Length:···················52 | 2 | ··Length:···················52 |
| 3 | ··Version:··················2 | 3 | ··Version:··················2 |
| 4 | ··Offset·into·.debug_info:··0x10 | 4 | ··Offset·into·.debug_info:··0x107d |
| 5 | ··Pointer·Size:·············4 | 5 | ··Pointer·Size:·············4 |
| 6 | ··Segment·Size:·············0 | 6 | ··Segment·Size:·············0 |
| 7 | ····Address····Length | 7 | ····Address····Length |
| 8 | ····000195 | 8 | ····00019560·00000165 |
| 9 | ····00013c30·0000004e | 9 | ····00013c30·0000004e |
| 10 | ····00018f | 10 | ····00018f70·000001e7 |
| 11 | ····000191 | 11 | ····00019160·00000038 |
| 12 | ····00000000·00000000 | 12 | ····00000000·00000000 |
| 13 | ··Length:···················468 | 13 | ··Length:···················468 |
| 14 | ··Version:··················2 | 14 | ··Version:··················2 |
| 15 | ··Offset·into·.debug_info:··0x40 | 15 | ··Offset·into·.debug_info:··0x40c6 |
| 16 | ··Pointer·Size:·············4 | 16 | ··Pointer·Size:·············4 |
| 17 | ··Segment·Size:·············0 | 17 | ··Segment·Size:·············0 |
| 18 | ····Address····Length | 18 | ····Address····Length |
| 19 | ····000196 | 19 | ····000196d0·00009578 |
| 20 | ····00013c7e·000007 | 20 | ····00013c7e·00000760 |
| 21 | ····00022 | 21 | ····00022c50·000001d9 |
| 22 | ····00022 | 22 | ····00022e30·000000db |
| 23 | ····00022 | 23 | ····00022f10·00000112 |
| 24 | ····0002 | 24 | ····00023030·00000030 |
| 25 | ····0002 | 25 | ····00023060·00000079 |
| 26 | ····00022770·00000064 | ||
| 27 | ····0002 | 26 | ····000230e0·00000064 |
| 28 | ····0002 | 27 | ····00023150·00000064 |
| 28 | ····000231c0·000000e1 | ||
| 29 | ····0002 | 29 | ····000232b0·00000216 |
| 30 | ····0002 | 30 | ····000234d0·00000024 |
| 31 | ····0002 | 31 | ····00023500·000000d2 |
| 32 | ····0002 | 32 | ····000235e0·00000319 |
| 33 | ····0002 | 33 | ····00023900·000000f4 |
| 34 | ····00023 | 34 | ····00023a00·00000172 |
| 35 | ····00023230·00000265 | ||
| 36 | ····000234a0·00000338 | ||
| 37 | ····000237e0·000001c6 | ||
| 38 | ····00023 | 35 | ····00023b80·0000023c |
| 39 | ····00023 | 36 | ····00023dc0·00000368 |
| 40 | ····00023c40·0000015a | ||
| 41 | ····00023da0·00000163 | ||
| 42 | ····00023f10·000001c4 | ||
| 43 | ····000240e0·0000025c | ||
| 44 | ····00024 | 37 | ····00024130·000001be |
| 38 | ····000242f0·00000280 | ||
| 39 | ····00024570·0000003f | ||
| 40 | ····000245b0·0000015a | ||
| 45 | ····00024 | 41 | ····00024710·00000163 |
| 46 | ····000246a0·000001c4 | ||
| 47 | ····000248 | 42 | ····00024880·000001eb |
| 48 | ····00024a | 43 | ····00024a70·0000025c |
| 49 | ····00024 | 44 | ····00024cd0·00000204 |
| 45 | ····00024ee0·00000163 | ||
| 46 | ····00025050·000001eb | ||
| 47 | ····00025240·00000277 | ||
| 48 | ····000254c0·000002d7 | ||
| 49 | ····000257a0·000003c2 | ||
| 50 | ····00025 | 50 | ····00025b70·00000163 |
| 51 | ····00025 | 51 | ····00025ce0·00000163 |
| 52 | ····000253d0·00000169 | ||
| 53 | ····00025 | 52 | ····00025e50·000001a1 |
| 54 | ····000256b0·000007ee | ||
| 55 | ····00025ea0·0000045a | ||
| 56 | ····00026 | 53 | ····00026000·000001a1 |
| 57 | ····000264f0·00000039 | ||
| 58 | ····00026530·0000036b | ||
| 59 | ····000268a0·000005bd | ||
| 60 | ····00026 | 54 | ····000261b0·000007fe |
| 55 | ····000269b0·0000045a | ||
| 56 | ····00026e10·00000055 | ||
| 57 | ····00026e70·000001ec | ||
| 61 | ····00027 | 58 | ····00027060·00000044 |
| 59 | ····000270b0·0000036b | ||
| 60 | ····00027420·000004c5 | ||
| 62 | ····00027 | 61 | ····000278f0·000007ce |
| 63 | ····00028 | 62 | ····000280c0·000004ca |
| 64 | ····000285 | 63 | ····00028590·00000806 |
| 65 | ····00028d | 64 | ····00028da0·000000eb |
| 65 | ····00028e90·0000079c | ||
| 66 | ····00029630·00000753 | ||
| 67 | ····00029d90·000000eb | ||
| 68 | ····00029e80·0000101f | ||
| 66 | ····0002 | 69 | ····0002aea0·000001f2 |
| 67 | ····00029df0·000002c2 | ||
| 68 | ····0002a0c0·0000045f | ||
| 69 | ····0002a520·000004a4 | ||
| 70 | ····0002a9d0·000007df | ||
| 71 | ····0002b1b0·000008bc | ||
| 72 | ····0002b | 70 | ····0002b0a0·000003de |
| 73 | ····0002b | 71 | ····0002b480·00000af2 |
| 72 | ····0002bf80·0000024c | ||
| 73 | ····0002c1d0·000002aa | ||
| 74 | ····000191 | 74 | ····000191a0·00000038 |
| 75 | ····00000000·00000000 | 75 | ····00000000·00000000 |
| 76 | ··Length:···················7 | 76 | ··Length:···················716 |
| 77 | ··Version:··················2 | 77 | ··Version:··················2 |
| 78 | ··Offset·into·.debug_info:··0x8 | 78 | ··Offset·into·.debug_info:··0x86d2f |
| 79 | ··Pointer·Size:·············4 | 79 | ··Pointer·Size:·············4 |
| 80 | ··Segment·Size:·············0 | 80 | ··Segment·Size:·············0 |
| 81 | ····Address····Length | 81 | ····Address····Length |
| 82 | ····0002c | 82 | ····0002c490·00009ca5 |
| 83 | ····00014 | 83 | ····000143de·00000a19 |
| 84 | ····00036 | 84 | ····00036140·00000006 |
| 85 | ····00036 | 85 | ····00036150·00000075 |
| 86 | ····00036 | 86 | ····000361d0·0000011d |
| 87 | ····00036 | 87 | ····000362f0·0000016e |
| 88 | ····00022 | 88 | ····00022e30·000000db |
| 89 | ····0002 | 89 | ····00023500·000000d2 |
| 90 | ····00036460·00000068 | ||
| 91 | ····000364d0·000001ce | ||
| 92 | ····000366a0·00000051 | ||
| 90 | ····00036700·00000068 | 93 | ····00036700·00000068 |
| 91 | ····00036770·00000 | 94 | ····00036770·000000f6 |
| 92 | ····000369b0·0000007a | ||
| 93 | ····00036a30·00000068 | ||
| 94 | ····00036aa0·00000122 | ||
| 95 | ····00036 | 95 | ····00036870·00000216 |
| 96 | ····00036 | 96 | ····00036a90·00000175 |
| 97 | ····00036 | 97 | ····00036c10·00000379 |
| 98 | ····0003 | 98 | ····00036f90·000000f4 |
| 99 | ····00037 | 99 | ····00037090·0000018a |
| 100 | ····00037 | 100 | ····00037220·0000015a |
| Max diff block lines reached; 14956/19704 bytes (75.90%) of diff not shown. | |||
| Offset 1, 533 lines modified | Offset 1, 533 lines modified | ||
| 1 | Contents·of·the·.debug_loclists·section: | 1 | Contents·of·the·.debug_loclists·section: |
| 2 | ····Offset···Begin············End··············Expression | 2 | ····Offset···Begin············End··············Expression |
| 3 | ····0000000c·v0000002·v0000000·location·view·pair | 3 | ····0000000c·v0000002·v0000000·location·view·pair |
| 4 | ····0000000e·v0000002·v0000000·views·at·0000000c·for: | 4 | ····0000000e·v0000002·v0000000·views·at·0000000c·for: |
| 5 | ·············000191 | 5 | ·············00019160·00019192·(DW_OP_lit1;·DW_OP_stack_value) |
| 6 | ····00000017·<End·of·list> | 6 | ····00000017·<End·of·list> |
| 7 | ····00000018·v0000002·v0000000·location·view·pair | 7 | ····00000018·v0000002·v0000000·location·view·pair |
| 8 | ····0000001a·v0000002·v0000000·views·at·00000018·for: | 8 | ····0000001a·v0000002·v0000000·views·at·00000018·for: |
| 9 | ·············000191 | 9 | ·············00019160·00019192·(DW_OP_const2u:·65535;·DW_OP_stack_value) |
| 10 | ····00000025·<End·of·list> | 10 | ····00000025·<End·of·list> |
| 11 | ····00000026·v0000000·v0000000·location·view·pair | 11 | ····00000026·v0000000·v0000000·location·view·pair |
| 12 | ····00000028·v0000000·v0000000·location·view·pair | 12 | ····00000028·v0000000·v0000000·location·view·pair |
| 13 | ····0000002a·v0000000·v0000000·location·view·pair | 13 | ····0000002a·v0000000·v0000000·location·view·pair |
| 14 | ····0000002c·v0000000·v0000000·location·view·pair | 14 | ····0000002c·v0000000·v0000000·location·view·pair |
| 15 | ····0000002e·v0000000·v0000000·location·view·pair | 15 | ····0000002e·v0000000·v0000000·location·view·pair |
| 16 | ····00000030·v0000000·v0000000·location·view·pair | 16 | ····00000030·v0000000·v0000000·location·view·pair |
| 17 | ····00000032·v0000000·v0000000·location·view·pair | 17 | ····00000032·v0000000·v0000000·location·view·pair |
| 18 | ····00000034·v0000000·v0000000·location·view·pair | 18 | ····00000034·v0000000·v0000000·location·view·pair |
| 19 | ····00000036·v0000000·v0000000·location·view·pair | 19 | ····00000036·v0000000·v0000000·location·view·pair |
| 20 | ····00000038·00018f | 20 | ····00000038·00018f70·(base·address) |
| 21 | ····0000003d·v0000000·v0000000·views·at·00000026·for: | 21 | ····0000003d·v0000000·v0000000·views·at·00000026·for: |
| 22 | ·············00018f | 22 | ·············00018f70·00018f74·(DW_OP_fbreg:·4) |
| 23 | ····00000043·v0000000·v0000000·views·at·00000028·for: | 23 | ····00000043·v0000000·v0000000·views·at·00000028·for: |
| 24 | ·············00018f | 24 | ·············00018f74·00018fb7·(DW_OP_breg1·(ecx):·4) |
| 25 | ····00000049·v0000000·v0000000·views·at·0000002a·for: | 25 | ····00000049·v0000000·v0000000·views·at·0000002a·for: |
| 26 | ·············00018f | 26 | ·············00018fb7·00018fd5·(DW_OP_breg5·(ebp):·-16;·DW_OP_deref;·DW_OP_plus_uconst:·4) |
| 27 | ····00000052·v0000000·v0000000·views·at·0000002c·for: | 27 | ····00000052·v0000000·v0000000·views·at·0000002c·for: |
| 28 | ·············00018f | 28 | ·············00018fd5·000190e0·(DW_OP_fbreg:·4) |
| 29 | ····00000059·v0000000·v0000000·views·at·0000002e·for: | 29 | ····00000059·v0000000·v0000000·views·at·0000002e·for: |
| 30 | ·············00019 | 30 | ·············000190e0·000190e4·(DW_OP_breg1·(ecx):·4) |
| 31 | ····00000061·v0000000·v0000000·views·at·00000030·for: | 31 | ····00000061·v0000000·v0000000·views·at·00000030·for: |
| 32 | ·············00019 | 32 | ·············000190e4·00019141·(DW_OP_fbreg:·4) |
| 33 | ····00000069·v0000000·v0000000·views·at·00000032·for: | 33 | ····00000069·v0000000·v0000000·views·at·00000032·for: |
| 34 | ·············000191 | 34 | ·············00019141·00019151·(DW_OP_breg5·(ebp):·-16;·DW_OP_deref;·DW_OP_plus_uconst:·4) |
| 35 | ····00000074·v0000000·v0000000·views·at·00000034·for: | 35 | ····00000074·v0000000·v0000000·views·at·00000034·for: |
| 36 | ·············000191 | 36 | ·············00019151·00019157·(DW_OP_fbreg:·4) |
| 37 | ····0000007c·v0000000·v0000000·views·at·00000036·for: | 37 | ····0000007c·v0000000·v0000000·views·at·00000036·for: |
| 38 | ·············00013c65·00013c79·(DW_OP_fbreg:·4) | 38 | ·············00013c65·00013c79·(DW_OP_fbreg:·4) |
| 39 | ····00000085·<End·of·list> | 39 | ····00000085·<End·of·list> |
| 40 | ····00000086·v0000000·v0000000·location·view·pair | 40 | ····00000086·v0000000·v0000000·location·view·pair |
| 41 | ····00000088·v0000000·v0000002·location·view·pair | 41 | ····00000088·v0000000·v0000002·location·view·pair |
| 42 | ····0000008a·v0000000·v0000000·location·view·pair | 42 | ····0000008a·v0000000·v0000000·location·view·pair |
| 43 | ····0000008c·v0000000·v0000000·location·view·pair | 43 | ····0000008c·v0000000·v0000000·location·view·pair |
| 44 | ····0000008e·v0000000·v0000000·location·view·pair | 44 | ····0000008e·v0000000·v0000000·location·view·pair |
| 45 | ····00000090·v0000000·v0000000·location·view·pair | 45 | ····00000090·v0000000·v0000000·location·view·pair |
| 46 | ····00000092·00018f | 46 | ····00000092·00018fb7·(base·address) |
| 47 | ····00000097·v0000000·v0000000·views·at·00000086·for: | 47 | ····00000097·v0000000·v0000000·views·at·00000086·for: |
| 48 | ·············00018f | 48 | ·············00018fb7·00018fd5·(DW_OP_reg1·(ecx)) |
| 49 | ····0000009c·v0000000·v0000002·views·at·00000088·for: | 49 | ····0000009c·v0000000·v0000002·views·at·00000088·for: |
| 50 | ·············00018f | 50 | ·············00018fd5·00019007·(DW_OP_breg5·(ebp):·-68) |
| 51 | ····000000a3·v0000000·v0000000·views·at·0000008a·for: | 51 | ····000000a3·v0000000·v0000000·views·at·0000008a·for: |
| 52 | ·············000190 | 52 | ·············00019063·00019072·(DW_OP_reg1·(ecx)) |
| 53 | ····000000aa·v0000000·v0000000·views·at·0000008c·for: | 53 | ····000000aa·v0000000·v0000000·views·at·0000008c·for: |
| 54 | ·············000190 | 54 | ·············00019072·00019098·(DW_OP_breg5·(ebp):·-68) |
| 55 | ····000000b3·v0000000·v0000000·views·at·0000008e·for: | 55 | ····000000b3·v0000000·v0000000·views·at·0000008e·for: |
| 56 | ·············00019 | 56 | ·············000190ef·000190fc·(DW_OP_reg1·(ecx)) |
| 57 | ····000000ba·v0000000·v0000000·views·at·00000090·for: | 57 | ····000000ba·v0000000·v0000000·views·at·00000090·for: |
| 58 | ·············000191 | 58 | ·············00019141·00019151·(DW_OP_reg1·(ecx)) |
| 59 | ····000000c1·<End·of·list> | 59 | ····000000c1·<End·of·list> |
| 60 | ····000000c2·v0000000·v0000002·location·view·pair | 60 | ····000000c2·v0000000·v0000002·location·view·pair |
| 61 | ····000000c4·v0000000·v0000000·location·view·pair | 61 | ····000000c4·v0000000·v0000000·location·view·pair |
| 62 | ····000000c6·v0000000·v0000000·location·view·pair | 62 | ····000000c6·v0000000·v0000000·location·view·pair |
| 63 | ····000000c8·v0000000·v0000000·location·view·pair | 63 | ····000000c8·v0000000·v0000000·location·view·pair |
| 64 | ····000000ca·00018f | 64 | ····000000ca·00018fb7·(base·address) |
| 65 | ····000000cf·v0000000·v0000002·views·at·000000c2·for: | 65 | ····000000cf·v0000000·v0000002·views·at·000000c2·for: |
| 66 | ·············00018f | 66 | ·············00018fb7·00019007·(DW_OP_reg7·(edi)) |
| 67 | ····000000d4·v0000000·v0000000·views·at·000000c4·for: | 67 | ····000000d4·v0000000·v0000000·views·at·000000c4·for: |
| 68 | ·············000190 | 68 | ·············00019063·00019098·(DW_OP_reg7·(edi)) |
| 69 | ····000000db·v0000000·v0000000·views·at·000000c6·for: | 69 | ····000000db·v0000000·v0000000·views·at·000000c6·for: |
| 70 | ·············00019 | 70 | ·············000190ef·000190fc·(DW_OP_reg7·(edi)) |
| 71 | ····000000e2·v0000000·v0000000·views·at·000000c8·for: | 71 | ····000000e2·v0000000·v0000000·views·at·000000c8·for: |
| 72 | ·············000191 | 72 | ·············00019141·00019152·(DW_OP_reg7·(edi)) |
| 73 | ····000000e9·<End·of·list> | 73 | ····000000e9·<End·of·list> |
| 74 | ····000000ea·v0000002·v0000000·location·view·pair | 74 | ····000000ea·v0000002·v0000000·location·view·pair |
| 75 | ····000000ec·v0000000·v0000000·location·view·pair | 75 | ····000000ec·v0000000·v0000000·location·view·pair |
| 76 | ····000000ee·00018f | 76 | ····000000ee·00018fb7·(base·address) |
| 77 | ····000000f3·v0000002·v0000000·views·at·000000ea·for: | 77 | ····000000f3·v0000002·v0000000·views·at·000000ea·for: |
| 78 | ·············00018f | 78 | ·············00018fb7·00018fba·(DW_OP_breg5·(ebp):·-44;·DW_OP_stack_value) |
| 79 | ····000000fa·v0000000·v0000000·views·at·000000ec·for: | 79 | ····000000fa·v0000000·v0000000·views·at·000000ec·for: |
| 80 | ·············00018f | 80 | ·············00018fba·00018fc0·(DW_OP_reg0·(eax)) |
| 81 | ····000000ff·<End·of·list> | 81 | ····000000ff·<End·of·list> |
| 82 | ····00000100·v0000002·v0000000·location·view·pair | 82 | ····00000100·v0000002·v0000000·location·view·pair |
| 83 | ····00000102·v0000002·v0000000·views·at·00000100·for: | 83 | ····00000102·v0000002·v0000000·views·at·00000100·for: |
| 84 | ·············00018f | 84 | ·············00018fb7·00018fc0·(DW_OP_reg7·(edi)) |
| 85 | ····0000010a·<End·of·list> | 85 | ····0000010a·<End·of·list> |
| 86 | ····0000010b·v0000004·v0000006·location·view·pair | 86 | ····0000010b·v0000004·v0000006·location·view·pair |
| 87 | ····0000010d·v0000004·v0000006·views·at·0000010b·for: | 87 | ····0000010d·v0000004·v0000006·views·at·0000010b·for: |
| 88 | ·············00018f | 88 | ·············00018fb7·00018fb7·(DW_OP_reg7·(edi)) |
| 89 | ····00000115·<End·of·list> | 89 | ····00000115·<End·of·list> |
| 90 | ····00000116·v0000005·v0000006·location·view·pair | 90 | ····00000116·v0000005·v0000006·location·view·pair |
| 91 | ····00000118·v0000005·v0000006·views·at·00000116·for: | 91 | ····00000118·v0000005·v0000006·views·at·00000116·for: |
| 92 | ·············00018f | 92 | ·············00018fb7·00018fb7·(DW_OP_reg7·(edi)) |
| 93 | ····00000120·<End·of·list> | 93 | ····00000120·<End·of·list> |
| 94 | ····00000121·v0000001·v0000002·location·view·pair | 94 | ····00000121·v0000001·v0000002·location·view·pair |
| 95 | ····00000123·v0000001·v0000002·views·at·00000121·for: | 95 | ····00000123·v0000001·v0000002·views·at·00000121·for: |
| 96 | ·············00018f | 96 | ·············00018fb7·00018fb7·(DW_OP_reg7·(edi)) |
| 97 | ····0000012b·<End·of·list> | 97 | ····0000012b·<End·of·list> |
| 98 | ····0000012c·v0000000·v0000000·location·view·pair | 98 | ····0000012c·v0000000·v0000000·location·view·pair |
| 99 | ····0000012e·v0000000·v0000000·location·view·pair | 99 | ····0000012e·v0000000·v0000000·location·view·pair |
| 100 | ····00000130·v0000000·v0000000·location·view·pair | 100 | ····00000130·v0000000·v0000000·location·view·pair |
| 101 | ····00000132·v0000000·v0000000·location·view·pair | 101 | ····00000132·v0000000·v0000000·location·view·pair |
| 102 | ····00000134·v0000000·v000000a·location·view·pair | 102 | ····00000134·v0000000·v000000a·location·view·pair |
| 103 | ····00000136·v0000000·v0000000·location·view·pair | 103 | ····00000136·v0000000·v0000000·location·view·pair |
| 104 | ····00000138·v0000000·v0000000·location·view·pair | 104 | ····00000138·v0000000·v0000000·location·view·pair |
| Max diff block lines reached; 39569477/39576589 bytes (99.98%) of diff not shown. | |||
| Offset 1, 462 lines modified | Offset 1, 458 lines modified | ||
| 1 | Contents·of·the·.debug_aranges·section: | 1 | Contents·of·the·.debug_aranges·section: |
| 2 | ··Length:···················52 | 2 | ··Length:···················52 |
| 3 | ··Version:··················2 | 3 | ··Version:··················2 |
| 4 | ··Offset·into·.debug_info:··0x10 | 4 | ··Offset·into·.debug_info:··0x107d |
| 5 | ··Pointer·Size:·············4 | 5 | ··Pointer·Size:·············4 |
| 6 | ··Segment·Size:·············0 | 6 | ··Segment·Size:·············0 |
| 7 | ····Address····Length | 7 | ····Address····Length |
| 8 | ····000195 | 8 | ····00019560·00000165 |
| 9 | ····00013c30·0000004e | 9 | ····00013c30·0000004e |
| 10 | ····00018f | 10 | ····00018f70·000001e7 |
| 11 | ····000191 | 11 | ····00019160·00000038 |
| 12 | ····00000000·00000000 | 12 | ····00000000·00000000 |
| 13 | ··Length:···················468 | 13 | ··Length:···················468 |
| 14 | ··Version:··················2 | 14 | ··Version:··················2 |
| 15 | ··Offset·into·.debug_info:··0x40 | 15 | ··Offset·into·.debug_info:··0x40c6 |
| 16 | ··Pointer·Size:·············4 | 16 | ··Pointer·Size:·············4 |
| 17 | ··Segment·Size:·············0 | 17 | ··Segment·Size:·············0 |
| 18 | ····Address····Length | 18 | ····Address····Length |
| 19 | ····000196 | 19 | ····000196d0·00009578 |
| 20 | ····00013c7e·000007 | 20 | ····00013c7e·00000760 |
| 21 | ····00022 | 21 | ····00022c50·000001d9 |
| 22 | ····00022 | 22 | ····00022e30·000000db |
| 23 | ····00022 | 23 | ····00022f10·00000112 |
| 24 | ····0002 | 24 | ····00023030·00000030 |
| 25 | ····0002 | 25 | ····00023060·00000079 |
| 26 | ····00022770·00000064 | ||
| 27 | ····0002 | 26 | ····000230e0·00000064 |
| 28 | ····0002 | 27 | ····00023150·00000064 |
| 28 | ····000231c0·000000e1 | ||
| 29 | ····0002 | 29 | ····000232b0·00000216 |
| 30 | ····0002 | 30 | ····000234d0·00000024 |
| 31 | ····0002 | 31 | ····00023500·000000d2 |
| 32 | ····0002 | 32 | ····000235e0·00000319 |
| 33 | ····0002 | 33 | ····00023900·000000f4 |
| 34 | ····00023 | 34 | ····00023a00·00000172 |
| 35 | ····00023230·00000265 | ||
| 36 | ····000234a0·00000338 | ||
| 37 | ····000237e0·000001c6 | ||
| 38 | ····00023 | 35 | ····00023b80·0000023c |
| 39 | ····00023 | 36 | ····00023dc0·00000368 |
| 40 | ····00023c40·0000015a | ||
| 41 | ····00023da0·00000163 | ||
| 42 | ····00023f10·000001c4 | ||
| 43 | ····000240e0·0000025c | ||
| 44 | ····00024 | 37 | ····00024130·000001be |
| 38 | ····000242f0·00000280 | ||
| 39 | ····00024570·0000003f | ||
| 40 | ····000245b0·0000015a | ||
| 45 | ····00024 | 41 | ····00024710·00000163 |
| 46 | ····000246a0·000001c4 | ||
| 47 | ····000248 | 42 | ····00024880·000001eb |
| 48 | ····00024a | 43 | ····00024a70·0000025c |
| 49 | ····00024 | 44 | ····00024cd0·00000204 |
| 45 | ····00024ee0·00000163 | ||
| 46 | ····00025050·000001eb | ||
| 47 | ····00025240·00000277 | ||
| 48 | ····000254c0·000002d7 | ||
| 49 | ····000257a0·000003c2 | ||
| 50 | ····00025 | 50 | ····00025b70·00000163 |
| 51 | ····00025 | 51 | ····00025ce0·00000163 |
| 52 | ····000253d0·00000169 | ||
| 53 | ····00025 | 52 | ····00025e50·000001a1 |
| 54 | ····000256b0·000007ee | ||
| 55 | ····00025ea0·0000045a | ||
| 56 | ····00026 | 53 | ····00026000·000001a1 |
| 57 | ····000264f0·00000039 | ||
| 58 | ····00026530·0000036b | ||
| 59 | ····000268a0·000005bd | ||
| 60 | ····00026 | 54 | ····000261b0·000007fe |
| 55 | ····000269b0·0000045a | ||
| 56 | ····00026e10·00000055 | ||
| 57 | ····00026e70·000001ec | ||
| 61 | ····00027 | 58 | ····00027060·00000044 |
| 59 | ····000270b0·0000036b | ||
| 60 | ····00027420·000004c5 | ||
| 62 | ····00027 | 61 | ····000278f0·000007ce |
| 63 | ····00028 | 62 | ····000280c0·000004ca |
| 64 | ····000285 | 63 | ····00028590·00000806 |
| 65 | ····00028d | 64 | ····00028da0·000000eb |
| 65 | ····00028e90·0000079c | ||
| 66 | ····00029630·00000753 | ||
| 67 | ····00029d90·000000eb | ||
| 68 | ····00029e80·0000101f | ||
| 66 | ····0002 | 69 | ····0002aea0·000001f2 |
| 67 | ····00029df0·000002c2 | ||
| 68 | ····0002a0c0·0000045f | ||
| 69 | ····0002a520·000004a4 | ||
| 70 | ····0002a9d0·000007df | ||
| 71 | ····0002b1b0·000008bc | ||
| 72 | ····0002b | 70 | ····0002b0a0·000003de |
| 73 | ····0002b | 71 | ····0002b480·00000af2 |
| 72 | ····0002bf80·0000024c | ||
| 73 | ····0002c1d0·000002aa | ||
| 74 | ····000191 | 74 | ····000191a0·00000038 |
| 75 | ····00000000·00000000 | 75 | ····00000000·00000000 |
| 76 | ··Length:···················7 | 76 | ··Length:···················716 |
| 77 | ··Version:··················2 | 77 | ··Version:··················2 |
| 78 | ··Offset·into·.debug_info:··0x8 | 78 | ··Offset·into·.debug_info:··0x86d2f |
| 79 | ··Pointer·Size:·············4 | 79 | ··Pointer·Size:·············4 |
| 80 | ··Segment·Size:·············0 | 80 | ··Segment·Size:·············0 |
| 81 | ····Address····Length | 81 | ····Address····Length |
| 82 | ····0002c | 82 | ····0002c490·00009ca5 |
| 83 | ····00014 | 83 | ····000143de·00000a19 |
| 84 | ····00036 | 84 | ····00036140·00000006 |
| 85 | ····00036 | 85 | ····00036150·00000075 |
| 86 | ····00036 | 86 | ····000361d0·0000011d |
| 87 | ····00036 | 87 | ····000362f0·0000016e |
| 88 | ····00022 | 88 | ····00022e30·000000db |
| 89 | ····0002 | 89 | ····00023500·000000d2 |
| 90 | ····00036460·00000068 | ||
| 91 | ····000364d0·000001ce | ||
| 92 | ····000366a0·00000051 | ||
| 90 | ····00036700·00000068 | 93 | ····00036700·00000068 |
| 91 | ····00036770·00000 | 94 | ····00036770·000000f6 |
| 92 | ····000369b0·0000007a | ||
| 93 | ····00036a30·00000068 | ||
| 94 | ····00036aa0·00000122 | ||
| 95 | ····00036 | 95 | ····00036870·00000216 |
| 96 | ····00036 | 96 | ····00036a90·00000175 |
| 97 | ····00036 | 97 | ····00036c10·00000379 |
| 98 | ····0003 | 98 | ····00036f90·000000f4 |
| 99 | ····00037 | 99 | ····00037090·0000018a |
| 100 | ····00037 | 100 | ····00037220·0000015a |
| Max diff block lines reached; 14956/19704 bytes (75.90%) of diff not shown. | |||
| Offset 1, 556 lines modified | Offset 1, 550 lines modified | ||
| 1 | GCC:·(Debian·12.2.0-14)·12.2.0 | 1 | GCC:·(Debian·12.2.0-14)·12.2.0 |
| 2 | 3&yUmNHJ | ||
| 3 | @#=*56|b | ||
| 4 | 9|Lefj37 | ||
| 5 | 7B7Yws\L | ||
| 6 | )tohN/8A | ||
| 7 | =c&KS9mQ+ | ||
| 8 | FI)8]!/;~ | ||
| 9 | 0|Mg>BY= | ||
| 10 | 9r» 2.Za{ee | ||
| 11 | (ftG» n>BN@ | ||
| 12 | \:#Ta:>p | ||
| 13 | kmsuTuEk | ||
| 14 | <7*NESnS | ||
| 15 | 9fCxw%9Pi | ||
| 16 | ^[)zyi+Y | ||
| 17 | =Ub» gOYyH | ||
| 18 | 2s%\t%o^b: | ||
| 19 | ~9We`]·< | ||
| 20 | uXai}7V4 | ||
| 21 | [`/5RrwS | ||
| 22 | KF>P]U12r | ||
| 23 | }xR:6HNJG | ||
| 24 | @dX?IZ4" | ||
| 25 | IyCe7jHC | ||
| 26 | /X/{X~`t· | ||
| 27 | Y}y&X/Y{ | ||
| 28 | 9RLZ'$B3H#7 | ||
| 29 | M>gM9jh{ | ||
| 30 | ^Dj_Qi/c | ||
| 31 | @&"u#rpu | ||
| 32 | `kUFu-Xa | ||
| 33 | TJ2+%9P) | ||
| 34 | PJ2+%9P) | ||
| 35 | UJ*+%5P) | ||
| 36 | q&ja1'<z | ||
| 37 | 9[[Nou}q | ||
| 38 | tUy0Mn0y | ||
| 39 | LN_PdY5` | ||
| 40 | VKJ=ey"' | ||
| 41 | ·rm6» qx9'mu | ||
| 42 | DGk+Q.'W | ||
| 43 | U`"5"2]T | ||
| 44 | Wmp[@SFN | ||
| 45 | +~n{4GOP | ||
| 46 | l%`6Kfk; | ||
| 47 | U46)7xL5t | ||
| 48 | js:_]%&_]]Yc | ||
| 49 | Lq)&$Ohh· | ||
| 50 | >Q#TDL#3U | ||
| 51 | -rxEswEk | ||
| 52 | |XQ!9P-? | ||
| 53 | ,ckjMQ^L2} | ||
| 54 | JIsj>gX& | ||
| 55 | _BX*Y8we | ||
| 56 | }BXu+14j` | ||
| 57 | 9744Za![B | ||
| 58 | zA",d{"= | ||
| 59 | *XQ!;7B^ | ||
| 60 | Fb#Wtsma | ||
| 61 | s,ht*m4J· | ||
| 62 | » tD)Py=@ | ||
| 63 | @m?9v-`XE | ||
| 64 | dyvGt:An | ||
| 65 | dy%\3h>9Y. | ||
| 66 | wOi6gos6 | ||
| 67 | @p"<ToFA | ||
| 68 | DF\k[32Md | ||
| 69 | /RB9Jwi_ | ||
| 70 | G5x9v4x8 | ||
| 71 | u7-TQ·,4 | ||
| 72 | Wl<?C7o_ | ||
| 73 | 0<\:t&;t | ||
| 74 | 1HTqY-o:f+w | ||
| 75 | T-^·Y-Z8p | ||
| 76 | DEnxZ)1O\: | ||
| 77 | :QB·QqB· | ||
| 78 | w{()_f#. | ||
| 79 | -bmg·[Zo | ||
| 80 | FA)Iw=3b | ||
| 81 | {gy\/yr` | ||
| 82 | RqwVa3Y;! | ||
| 83 | » g-ueQY` | ||
| 84 | -|6wCqEms | ||
| 85 | (q>Og-Ow | ||
| 86 | UQ]6g,M0 | ||
| 87 | D=wWPU·U | ||
| 88 | Z)8W4Q9pp | ||
| 89 | }qdPp#>/ | ||
| 90 | aG0G·Xmc | ||
| 91 | 0*(7WyUW | ||
| 92 | 4=2Z\X*4= | ||
| 93 | -BS_p{+M | ||
| 94 | ;HMu8NuT | ||
| 95 | 8k0r<XkR | ||
| 96 | 3b*z~.OE{ | ||
| 97 | X',?]Xk. | ||
| 98 | |EKUK'Cu:7 | ||
| 99 | Y·z~&WiX | ||
| 100 | nhZK0ZJV2 | ||
| 101 | d5nB$.LVc | ||
| 102 | _C5KQFe; | ||
| 103 | QLDdBGyF | ||
| 104 | l%PU+_w2 | ||
| 105 | X}@Z0·i· | ||
| 106 | 7Q/VY?C< | ||
| 107 | :jt*`]st | ||
| 108 | T0F!8MU- | ||
| 109 | ~,.R<`|· | ||
| 110 | H7;K"Q@5 | ||
| 111 | 66QrCKv7 | ||
| 112 | U[8gO,=bp | ||
| 113 | {b+F3yx{ | ||
| 114 | {r#O[6:k@ | ||
| 115 | BK=OP43FW | ||
| 116 | (gU(.49| | ||
| 117 | wa'Pv*n' | ||
| 118 | #{TrG;F@Ih | ||
| 119 | o.@_7/#; | ||
| 120 | p($3\E]+ | ||
| 121 | J96]!S~cG | ||
| 122 | LV^6aii] | ||
| 123 | uHe*OeA'/ | ||
| 124 | n"*i1*O| | ||
| 125 | `Yw^M~kK | ||
| 126 | 2S<C-7m` | ||
| 127 | x3bD>Rx?· | ||
| Max diff block lines reached; 32490/40472 bytes (80.28%) of diff not shown. | |||
| Offset 17, 2473 lines modified | Offset 17, 2457 lines modified | ||
| 17 | 00013ce6·<std::_Rb_tree_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·>·std::_Rb_tree<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>,·std::_Select1st<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·>·>::_M_emplace_hint_unique<std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>,·std::tuple<>·>(std::_Rb_tree_const_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·>,·std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>&&,·std::tuple<>&&)·[clone·.isra.0]·[clone·.cold]>: | 17 | 00013ce6·<std::_Rb_tree_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·>·std::_Rb_tree<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>,·std::_Select1st<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·>·>::_M_emplace_hint_unique<std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>,·std::tuple<>·>(std::_Rb_tree_const_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·>,·std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>&&,·std::tuple<>&&)·[clone·.isra.0]·[clone·.cold]>: |
| 18 | » ... | 18 | » ... |
| 19 | 00013d19·<PrepareHotspots(int,·char·const**)·[clone·.cold]>: | 19 | 00013d19·<PrepareHotspots(int,·char·const**)·[clone·.cold]>: |
| 20 | » ... | 20 | » ... |
| 21 | 00014 | 21 | 000143de·<BedFile::log_column(ErrorLevel,·SuppressGroup,·int,·int,·BedLine*,·char·const*,·char·const*)·[clone·.isra.0]·[clone·.cold]>: |
| 22 | » ... | 22 | » ... |
| 23 | 000144 | 23 | 00014402·<BedFile::log_line(ErrorLevel,·SuppressGroup,·int,·BedLine*,·char·const*,·char·const*)·[clone·.isra.0]·[clone·.cold]>: |
| 24 | » ... | 24 | » ... |
| 25 | 000144 | 25 | 00014426·<ValidateBedHelp()·[clone·.cold]>: |
| 26 | » ... | 26 | » ... |
| 27 | 000144 | 27 | 0001445b·<validate_name[abi:cxx11](char*,·int,·int,·BedLine*,·BedFile&)·[clone·.cold]>: |
| 28 | » ... | 28 | » ... |
| 29 | 000144 | 29 | 00014470·<std::_Rb_tree_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·int>·>·std::_Rb_tree<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·int>,·std::_Select1st<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·int>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·int>·>·>::_M_emplace_hint_unique<std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>,·std::tuple<>·>(std::_Rb_tree_const_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·int>·>,·std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>&&,·std::tuple<>&&)·[clone·.isra.0]·[clone·.cold]>: |
| 30 | » ... | 30 | » ... |
| 31 | 000144 | 31 | 000144a3·<parse_bed_detail_targets(char*,·char*,·int,·int,·BedLine*,·BedFile&)·[clone·.cold]>: |
| 32 | » ... | 32 | » ... |
| 33 | 000146 | 33 | 0001460f·<merge_overlapping_regions(ReferenceReader&,·BedFile&)·[clone·.cold]>: |
| 34 | » ... | 34 | » ... |
| 35 | 000146 | 35 | 00014624·<parse_bed_detail_hotspots(char·const*,·char*,·int,·int,·BedLine*,·BedFile&,·ReferenceReader&)·[clone·.cold]>: |
| 36 | » ... | 36 | » ... |
| 37 | 000146 | 37 | 00014681·<parse_track_line(char*,·int,·BedFile&)·[clone·.cold]>: |
| 38 | » ... | 38 | » ... |
| 39 | 00014 | 39 | 000146c3·<load_and_validate_bed(std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·ReferenceReader&,·BedFile&,·Json::Value&,·bool)·[clone·.cold]>: |
| 40 | » ... | 40 | » ... |
| 41 | 00014 | 41 | 000147c6·<std::_Deque_iterator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>*>·std::__uninitialized_copy_a<std::_Deque_iterator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const*>,·std::_Deque_iterator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>*>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>(std::_Deque_iterator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const*>,·std::_Deque_iterator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const*>,·std::_Deque_iterator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>*>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>&)·[clone·.isra.0]·[clone·.cold]>: |
| 42 | » ... | 42 | » ... |
| 43 | 000148 | 43 | 00014810·<std::deque<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>::operator=(std::deque<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·const&)·[clone·.isra.0]·[clone·.cold]>: |
| 44 | » ... | 44 | » ... |
| 45 | 00014 | 45 | 000148d4·<std::_Deque_iterator<BedLine,·BedLine&,·BedLine*>·std::__uninitialized_copy_a<std::_Deque_iterator<BedLine,·BedLine·const&,·BedLine·const*>,·std::_Deque_iterator<BedLine,·BedLine&,·BedLine*>,·BedLine>(std::_Deque_iterator<BedLine,·BedLine·const&,·BedLine·const*>,·std::_Deque_iterator<BedLine,·BedLine·const&,·BedLine·const*>,·std::_Deque_iterator<BedLine,·BedLine&,·BedLine*>,·std::allocator<BedLine>&)·[clone·.isra.0]·[clone·.cold]>: |
| 46 | » ... | 46 | » ... |
| 47 | 000149 | 47 | 0001491b·<ValidateBed(int,·char·const**)·[clone·.cold]>: |
| 48 | » ... | 48 | » ... |
| 49 | 00014 | 49 | 00014df8·<boost::wrapexcept<std::overflow_error>::rethrow()·const>: |
| 50 | » ... | 50 | » ... |
| 51 | 00014 | 51 | 00014ee6·<boost::wrapexcept<std::domain_error>::rethrow()·const>: |
| 52 | » ... | 52 | » ... |
| 53 | 0001 | 53 | 00014fd4·<boost::wrapexcept<boost::math::rounding_error>::rethrow()·const>: |
| 54 | » ... | 54 | » ... |
| 55 | 00015 | 55 | 000150c8·<boost::wrapexcept<boost::math::evaluation_error>::rethrow()·const>: |
| 56 | » ... | 56 | » ... |
| 57 | 000151 | 57 | 000151bc·<UnifyVcfHelp()·[clone·.cold]>: |
| 58 | » ... | 58 | » ... |
| 59 | 00015 | 59 | 000151f1·<extend_header(vcf::VariantCallFile&)·[clone·.cold]>: |
| 60 | » ... | 60 | » ... |
| 61 | 000152 | 61 | 00015256·<CoverageInfoEntry::parse(char·const*,·ReferenceReader·const&)·[clone·.cold]>: |
| 62 | » ... | 62 | » ... |
| 63 | 000153 | 63 | 0001539e·<VcfOrderedMerger::next_cov_entry()·[clone·.cold]>: |
| 64 | » ... | 64 | » ... |
| 65 | 000153 | 65 | 000153c6·<bgzf_stream&·bgzf_stream::operator<<·<char·const·[2]>(char·const·(&)·[2])·[clone·.isra.0]·[clone·.cold]>: |
| 66 | » ... | 66 | » ... |
| 67 | 00015 | 67 | 000153f4·<check_on_write(std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>)·[clone·.cold]>: |
| 68 | » ... | 68 | » ... |
| 69 | 000154 | 69 | 0001547a·<check_on_read(std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>)·[clone·.cold]>: |
| 70 | » ... | 70 | » ... |
| 71 | 000155 | 71 | 0001550a·<parse_parameters_from_json(std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·vcf::VariantCallFile&)·[clone·.cold]>: |
| 72 | » ... | 72 | » ... |
| 73 | 000156 | 73 | 0001563c·<VcfOrderedMerger::write_header(vcf::VariantCallFile&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>)·[clone·.cold]>: |
| 74 | » ... | 74 | » ... |
| 75 | 000156 | 75 | 00015650·<std::_Rb_tree_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·int>·>·std::_Rb_tree<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·int>,·std::_Select1st<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·int>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·int>·>·>::_M_emplace_hint_unique<std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>,·std::tuple<>·>(std::_Rb_tree_const_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·int>·>,·std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>&&,·std::tuple<>&&)·[clone·.isra.0]·[clone·.cold]>: |
| 76 | » ... | 76 | » ... |
| 77 | 000156 | 77 | 00015684·<std::_Rb_tree_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·std::_Rb_tree<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>,·std::_Select1st<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·>::_M_emplace_hint_unique<std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>,·std::tuple<>·>(std::_Rb_tree_const_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>,·std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>&&,·std::tuple<>&&)·[clone·.isra.0]·[clone·.cold]>: |
| 78 | » ... | 78 | » ... |
| 79 | 000156 | 79 | 000156b8·<PriorityQueue::get_next_variant(vcf::Variant*)·[clone·.cold]>: |
| 80 | » ... | 80 | » ... |
| 81 | 00015 | 81 | 000156de·<PriorityQueue::left_align_variant(vcf::Variant*)·[clone·.cold]>: |
| 82 | » ... | 82 | » ... |
| 83 | 000157 | 83 | 0001571c·<VcfOrderedMerger::generate_novel_annotations(vcf::Variant*)·[clone·.cold]>: |
| 84 | » ... | 84 | » ... |
| 85 | 000157 | 85 | 000157a8·<PriorityQueue::trim_variant(vcf::Variant*)·[clone·.cold]>: |
| 86 | » ... | 86 | » ... |
| 87 | 000157 | 87 | 000157be·<std::_Rb_tree_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·>·>·>·std::_Rb_tree<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·>·>,·std::_Select1st<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·>·>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·>·>·>·>::_M_emplace_hint_unique<std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>,·std::tuple<>·>(std::_Rb_tree_const_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·>·>·>,·std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>&&,·std::tuple<>&&)·[clone·.isra.0]·[clone·.cold]>: |
| 88 | » ... | 88 | » ... |
| 89 | 00015 | 89 | 000157f1·<push_value_to_entry(vcf::Variant&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>)·[clone·.cold]>: |
| 90 | » ... | 90 | » ... |
| 91 | 000158 | 91 | 0001583f·<push_value_to_entry(vcf::Variant&,·unsigned·int,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>)·[clone·.cold]>: |
| 92 | » ... | 92 | » ... |
| 93 | 000158 | 93 | 0001587c·<std::_Rb_tree_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·std::_Rb_tree<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::_Select1st<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>::_M_emplace_hint_unique<std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>,·std::tuple<>·>(std::_Rb_tree_const_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>,·std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>&&,·std::tuple<>&&)·[clone·.isra.0]·[clone·.cold]>: |
| 94 | » ... | 94 | » ... |
| 95 | 000158 | 95 | 000158b0·<VcfOrderedMerger::merge_annotation_into_vcf(vcf::Variant*)·[clone·.cold]>: |
| 96 | » ... | 96 | » ... |
| 97 | 00015c | 97 | 00015c3e·<std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>::operator=(std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·const&)·[clone·.isra.0]·[clone·.cold]>: |
| 98 | » ... | 98 | » ... |
| 99 | 00015c | 99 | 00015cb8·<VcfOrderedMerger::transfer_fields(std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·>&,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·>·>·>&,·std::map<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·int,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·int>·>·>&,·std::__cxx11::list<std::pair<int,·int>,·std::allocator<std::pair<int,·int>·>·>&,·unsigned·int)·[clone·.cold]>: |
| 100 | » ... | 100 | » ... |
| Max diff block lines reached; 505734/547367 bytes (92.39%) of diff not shown. | |||
| Offset 1, 7 lines modified | Offset 1, 7 lines modified | ||
| 1 | Disassembly·of·section·.fini: | 1 | Disassembly·of·section·.fini: |
| 2 | 000 | 2 | 0007e5c4·<_fini>: |
| 3 | » ... | 3 | » ... |
| Offset 4151, 1491 lines modified | Offset 4151, 1490 lines modified | ||
| 4151 | ··[·5b299]··adopt | 4151 | ··[·5b299]··adopt |
| 4152 | ··[·5b29f]··ref_start | 4152 | ··[·5b29f]··ref_start |
| 4153 | ··[·5b2a9]··tmp_start | 4153 | ··[·5b2a9]··tmp_start |
| 4154 | ··[·5b2b3]··current_start | 4154 | ··[·5b2b3]··current_start |
| 4155 | ··[·5b2c1]··last_start | 4155 | ··[·5b2c1]··last_start |
| 4156 | ··[·5b2cc]··~bad_numeric_cast | 4156 | ··[·5b2cc]··~bad_numeric_cast | Diff chunk too large, falling back to line-by-line diff (1482 lines added, 1483 lines removed) |
| 4157 | ··[·5b2de]··__buffer_last | 4157 | ··[·5b2de]··__buffer_last |
| 4158 | ··[·5b2ec]·· | 4158 | ··[·5b2ec]··lhs_cost |
| 4159 | ··[·5b2f | 4159 | ··[·5b2f5]··rhs_cost |
| 4160 | ··[·5b2f | 4160 | ··[·5b2fe]··boost |
| 4161 | ··[·5b30 | 4161 | ··[·5b304]··__second_cut |
| 4162 | ··[·5b3 | 4162 | ··[·5b311]··__first_cut |
| 4163 | ··[·5b31 | 4163 | ··[·5b31d]··gvcf_out |
| 4164 | ··[·5b32 | 4164 | ··[·5b326]··bgz_out |
| 4165 | ··[·5b32 | 4165 | ··[·5b32e]··gvcf_output |
| 4166 | ··[·5b33 | 4166 | ··[·5b33a]··has_next |
| 4167 | ··[·5b3 | 4167 | ··[·5b343]··_ZN5boost10wrapexceptINS_4math14rounding_errorEED0Ev |
| 4168 | ··[·5b3 | 4168 | ··[·5b378]··_ZN5boost10wrapexceptINS_4math16evaluation_errorEED0Ev |
| 4169 | ··[·5b3 | 4169 | ··[·5b3af]··_ZN5boost10wrapexceptISt12domain_errorED0Ev |
| 4170 | ··[·5b3 | 4170 | ··[·5b3db]··_ZN5boost10wrapexceptISt14overflow_errorED0Ev |
| 4171 | ··[·5b | 4171 | ··[·5b409]··_ZNSdD0Ev |
| 4172 | ··[·5b4 | 4172 | ··[·5b413]··_ZTv0_n12_NSdD0Ev |
| 4173 | ··[·5b4 | 4173 | ··[·5b425]··_ZThn8_NSdD0Ev |
| 4174 | ··[·5b4 | 4174 | ··[·5b434]··_ZN5boost16exception_detail10clone_baseD0Ev |
| 4175 | ··[·5b4 | 4175 | ··[·5b460]··_ZNSiD0Ev |
| 4176 | ··[·5b46 | 4176 | ··[·5b46a]··_ZTv0_n12_NSiD0Ev |
| 4177 | ··[·5b4 | 4177 | ··[·5b47c]··_ZN5boost9exceptionD0Ev |
| 4178 | ··[·5b4 | 4178 | ··[·5b494]··_ZN5boost4math14rounding_errorD0Ev |
| 4179 | ··[·5b4 | 4179 | ··[·5b4b7]··_ZNSt12domain_errorD0Ev |
| 4180 | ··[·5b4 | 4180 | ··[·5b4cf]··_ZN5boost4math16evaluation_errorD0Ev |
| 4181 | ··[·5b4 | 4181 | ··[·5b4f4]··_ZNSt14overflow_errorD0Ev |
| 4182 | ··[·5b | 4182 | ··[·5b50e]··_ZNSdD1Ev |
| 4183 | ··[·5b51 | 4183 | ··[·5b518]··_ZTv0_n12_NSdD1Ev |
| 4184 | ··[·5b5 | 4184 | ··[·5b52a]··_ZThn8_NSdD1Ev |
| 4185 | ··[·5b5 | 4185 | ··[·5b539]··_ZNSiD1Ev |
| 4186 | ··[·5b5 | 4186 | ··[·5b543]··_ZTv0_n12_NSiD1Ev |
| 4187 | ··[·5b5 | 4187 | ··[·5b555]··_ZNSt12domain_errorD1Ev |
| 4188 | ··[·5b5 | 4188 | ··[·5b56d]··_ZNSt14overflow_errorD1Ev |
| 4189 | ··[·5b5 | 4189 | ··[·5b587]··_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_St3setIS5_St4lessIS5_ESaIS5_EEESt10_Select1stISD_ESA_SaISD_EE13_Rb_tree_implISA_Lb1EEC2Ev |
| 4190 | ··[·5b | 4190 | ··[·5b630]··_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_St3mapIS5_S5_St4lessIS5_ESaIS6_IS7_S5_EEEESt10_Select1stISE_ESA_SaISE_EE13_Rb_tree_implISA_Lb1EEC2Ev |
| 4191 | ··[·5b6 | 4191 | ··[·5b6e4]··_ZNSaISt13_Rb_tree_nodeISt4pairIKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt3mapIS6_S6_St4lessIS6_ESaIS0_IS7_S6_EEEEEEC2Ev |
| 4192 | ··[·5b | 4192 | ··[·5b76a]··_ZNSt15__new_allocatorISt13_Rb_tree_nodeISt4pairIKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt3mapIS7_S7_St4lessIS7_ESaIS1_IS8_S7_EEEEEEC2Ev |
| 4193 | ··[·5b | 4193 | ··[·5b801]··_ZNSaISt13_Rb_tree_nodeISt4pairIKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt3setIS6_St4lessIS6_ESaIS6_EEEEEC2Ev |
| 4194 | ··[·5b8 | 4194 | ··[·5b87c]··_ZNSt15__new_allocatorISt13_Rb_tree_nodeISt4pairIKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt3setIS7_St4lessIS7_ESaIS7_EEEEEC2Ev |
| 4195 | ··[·5b | 4195 | ··[·5b908]··_ZNSt15__new_allocatorIPNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEEC2Ev |
| 4196 | ··[·5b9 | 4196 | ··[·5b95a]··_ZNSaISt5dequeI6AlleleSaIS0_EEEC2Ev |
| 4197 | ··[·5b9 | 4197 | ··[·5b97e]··_ZNSaISt5dequeI7BedLineSaIS0_EEEC2Ev |
| 4198 | ··[·5b9 | 4198 | ··[·5b9a3]··_ZN9__gnu_cxx17__normal_iteratorIP12MergedTargetSt6vectorIS1_SaIS1_EEEC2Ev |
| 4199 | ··[·5b9 | 4199 | ··[·5b9ee]··_ZNSt15__new_allocatorISt5dequeI6AlleleSaIS1_EEEC2Ev |
| 4200 | ··[·5b | 4200 | ··[·5ba23]··_ZNSt15__new_allocatorISt5dequeI7BedLineSaIS1_EEEC2Ev |
| 4201 | ··[·5ba | 4201 | ··[·5ba59]··_ZNSt3mapINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt3setIS5_St4lessIS5_ESaIS5_EES8_SaISt4pairIKS5_SA_EEEC2Ev |
| 4202 | ··[·5ba | 4202 | ··[·5bad2]··_ZNSt3mapINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES_IS5_S5_St4lessIS5_ESaISt4pairIKS5_S5_EEES7_SaIS8_IS9_SC_EEEC2Ev |
| 4203 | ··[·5b | 4203 | ··[·5bb52]··_ZNSaISt10_List_nodeISt4pairIiiEEEC2Ev |
| 4204 | ··[·5bb | 4204 | ··[·5bb79]··_ZNSt15__new_allocatorISt10_List_nodeISt4pairIiiEEEC2Ev |
| 4205 | ··[·5bb | 4205 | ··[·5bbb1]··_ZNSt12_Vector_baseI9ReferenceSaIS0_EEC2Ev |
| 4206 | ··[·5bb | 4206 | ··[·5bbdc]··_ZNSt6vectorI9ReferenceSaIS0_EEC2Ev |
| 4207 | ··[·5b | 4207 | ··[·5bc00]··_ZNSt11_Deque_baseI10LogMessageSaIS0_EEC2Ev |
| 4208 | ··[·5bc | 4208 | ··[·5bc2c]··_ZNSt5dequeI10LogMessageSaIS0_EEC2Ev |
| 4209 | ··[·5bc | 4209 | ··[·5bc51]··_ZNSt11_Deque_baseI7BedLineSaIS0_EEC2Ev |
| 4210 | ··[·5bc | 4210 | ··[·5bc79]··_ZNSt5dequeI7BedLineSaIS0_EEC2Ev |
| 4211 | ··[·5bc | 4211 | ··[·5bc9a]··_ZNSt12_Vector_baseI12markov_stateSaIS0_EEC2Ev |
| 4212 | ··[·5bc | 4212 | ··[·5bcc9]··_ZNSt6vectorI12markov_stateSaIS0_EEC2Ev |
| 4213 | ··[·5bc | 4213 | ··[·5bcf1]··_ZNSt12_Vector_baseI12junction_chrSaIS0_EEC2Ev |
| 4214 | ··[·5b | 4214 | ··[·5bd20]··_ZNSt6vectorI12junction_chrSaIS0_EEC2Ev |
| 4215 | ··[·5bd | 4215 | ··[·5bd48]··_ZNSt11_Deque_baseI10LineStatusSaIS0_EEC2Ev |
| 4216 | ··[·5bd | 4216 | ··[·5bd74]··_ZNSt5dequeI10LineStatusSaIS0_EEC2Ev |
| 4217 | ··[·5bd | 4217 | ··[·5bd99]··_ZNSt12_Vector_baseIP20ComparableVcfVariantSaIS1_EEC2Ev |
| 4218 | ··[·5bd | 4218 | ··[·5bdd1]··_ZNSt6vectorIP20ComparableVcfVariantSaIS1_EEC2Ev |
| 4219 | ··[·5b | 4219 | ··[·5be02]··_ZNSt7__cxx1110_List_baseISt4pairIiiESaIS2_EEC2Ev |
| 4220 | ··[·5be | 4220 | ··[·5be34]··_ZNSt7__cxx114listISt4pairIiiESaIS2_EEC2Ev |
| 4221 | ··[·5be | 4221 | ··[·5be5f]··_ZNSt12_Vector_baseISt5dequeI7BedLineSaIS1_EESaIS3_EEC2Ev |
| 4222 | ··[·5be | 4222 | ··[·5be99]··_ZNSt6vectorISt5dequeI7BedLineSaIS1_EESaIS3_EEC2Ev |
| 4223 | ··[·5be | 4223 | ··[·5becc]··_ZNSt12_Vector_baseISt4pairI10depth_infoIjElESaIS3_EEC2Ev |
| 4224 | ··[·5b | 4224 | ··[·5bf06]··_ZNSt6vectorISt4pairI10depth_infoIjElESaIS3_EEC2Ev |
| 4225 | ··[·5bf | 4225 | ··[·5bf39]··_ZNSt11_Deque_baseINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS5_EEC2Ev |
| 4226 | ··[·5bf | 4226 | ··[·5bf8d]··_ZNSt5dequeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS5_EEC2Ev |
| 4227 | ··[·5bf | 4227 | ··[·5bfda]··_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_St3setIS5_St4lessIS5_ESaIS5_EEESt10_Select1stISD_ESA_SaISD_EEC2Ev |
| 4228 | ··[·5 | 4228 | ··[·5c06b]··_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_St3mapIS5_S5_St4lessIS5_ESaIS6_IS7_S5_EEEESt10_Select1stISE_ESA_SaISE_EEC2Ev |
| 4229 | ··[·5c07 | 4229 | ··[·5c107]··_ZNSaISt4pairI10depth_infoIjElEEC2Ev |
| 4230 | ··[·5c1 | 4230 | ··[·5c12c]··_ZNSt15__new_allocatorISt4pairI10depth_infoIjElEEC2Ev |
| 4231 | ··[·5c1 | 4231 | ··[·5c162]··_ZN5boost16exception_detail12refcount_ptrINS0_20error_info_containerEEC2Ev |
| 4232 | ··[·5c1 | 4232 | ··[·5c1ad]··_ZNSt15_Deque_iteratorI10LogMessageRS0_PS0_EC2Ev |
| 4233 | ··[·5c1 | 4233 | ··[·5c1de]··_ZNSt15_Deque_iteratorI7BedLineRS0_PS0_EC2Ev |
| 4234 | ··[·5c | 4234 | ··[·5c20b]··_ZNSt15_Deque_iteratorI10LineStatusRS0_PS0_EC2Ev |
| 4235 | ··[·5c2 | 4235 | ··[·5c23c]··_ZNSt15_Deque_iteratorINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERS5_PS5_EC2Ev |
| 4236 | ··[·5c2 | 4236 | ··[·5c295]··_ZNSaI9ReferenceEC2Ev |
| 4237 | ··[·5c2 | 4237 | ··[·5c2ab]··_ZNSt15__new_allocatorI9ReferenceEC2Ev |
| 4238 | ··[·5c2 | 4238 | ··[·5c2d2]··_ZNSaI10LogMessageEC2Ev |
| 4239 | ··[·5c2 | 4239 | ··[·5c2ea]··_ZNSt15__new_allocatorI10LogMessageEC2Ev |
| 4240 | ··[·5c | 4240 | ··[·5c313]··_ZNSt15__new_allocatorIP10LogMessageEC2Ev |
| 4241 | ··[·5c3 | 4241 | ··[·5c33d]··_ZNSaI7BedLineEC2Ev |
| 4242 | ··[·5c3 | 4242 | ··[·5c351]··_ZNSt15__new_allocatorI7BedLineEC2Ev |
| 4243 | ··[·5c3 | 4243 | ··[·5c376]··_ZNSt15__new_allocatorIP7BedLineEC2Ev |
| 4244 | ··[·5c3 | 4244 | ··[·5c39c]··_ZNSaI12markov_stateEC2Ev |
| 4245 | ··[·5c3 | 4245 | ··[·5c3b6]··_ZNSt15__new_allocatorI12markov_stateEC2Ev |
| 4246 | ··[·5c3 | 4246 | ··[·5c3e1]··_ZNSaI12junction_chrEC2Ev |
| 4247 | ··[·5c3 | 4247 | ··[·5c3fb]··_ZNSt15__new_allocatorI12junction_chrEC2Ev |
| 4248 | ··[·5c4 | 4248 | ··[·5c426]··_ZNSaI10LineStatusEC2Ev |
| 4249 | ··[·5c4 | 4249 | ··[·5c43e]··_ZNSt15__new_allocatorI10LineStatusEC2Ev |
| 4250 | ··[·5c4 | 4250 | ··[·5c467]··_ZNSt15__new_allocatorIP10LineStatusEC2Ev |
| 4251 | ··[·5c4 | 4251 | ··[·5c491]··_ZNSaIP20ComparableVcfVariantEC2Ev |
| 4252 | ··[·5c4 | 4252 | ··[·5c4b4]··_ZNSt15__new_allocatorIP20ComparableVcfVariantEC2Ev |
| 4253 | ··[·5c4 | 4253 | ··[·5c4e8]··_ZNSt11_Deque_baseI10LogMessageSaIS0_EE16_Deque_impl_dataC2Ev |
| 4254 | ··[·5c | 4254 | ··[·5c526]··_ZNSt11_Deque_baseI7BedLineSaIS0_EE16_Deque_impl_dataC2Ev |
| 4255 | ··[·5c5 | 4255 | ··[·5c560]··_ZNSt11_Deque_baseI10LineStatusSaIS0_EE16_Deque_impl_dataC2Ev |
| 4256 | ··[·5c5 | 4256 | ··[·5c59e]··_ZNSt11_Deque_baseINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS5_EE16_Deque_impl_dataC2Ev |
| 4257 | ··[·5c | 4257 | ··[·5c604]··_ZNSt12_Vector_baseI9ReferenceSaIS0_EE17_Vector_impl_dataC2Ev |
| 4258 | ··[·5c6 | 4258 | ··[·5c642]··_ZNSt12_Vector_baseI12markov_stateSaIS0_EE17_Vector_impl_dataC2Ev |
| 4259 | ··[·5c6 | 4259 | ··[·5c684]··_ZNSt12_Vector_baseI12junction_chrSaIS0_EE17_Vector_impl_dataC2Ev |
| 4260 | ··[·5c6 | 4260 | ··[·5c6c6]··_ZNSt12_Vector_baseIP20ComparableVcfVariantSaIS1_EE17_Vector_impl_dataC2Ev |
| 4261 | ··[·5c | 4261 | ··[·5c711]··_ZNSt12_Vector_baseISt5dequeI6AlleleSaIS1_EESaIS3_EE17_Vector_impl_dataC2Ev |
| 4262 | ··[·5c7 | 4262 | ··[·5c75d]··_ZNSt12_Vector_baseISt5dequeI7BedLineSaIS1_EESaIS3_EE17_Vector_impl_dataC2Ev |
| 4263 | ··[·5c7 | 4263 | ··[·5c7aa]··_ZNSt12_Vector_baseISt4pairI10depth_infoIjElESaIS3_EE17_Vector_impl_dataC2Ev |
| 4264 | ··[·5c7 | 4264 | ··[·5c7f7]··_ZN9ReferenceC2Ev |
| 4265 | ··[·5c | 4265 | ··[·5c809]··_ZN10LogMessageC2Ev |
| 4266 | ··[·5c8 | 4266 | ··[·5c81d]··_ZN7BedFileC2Ev |
| 4267 | ··[·5c82 | 4267 | ··[·5c82d]··_ZN7BedLineC2Ev |
| 4268 | ··[·5c83 | 4268 | ··[·5c83d]··_ZN5boost16exception_detail10clone_baseC2Ev |
| 4269 | ··[·5c8 | 4269 | ··[·5c869]··_ZNSt11_Deque_baseI10LogMessageSaIS0_EE11_Deque_implC2Ev |
| 4270 | ··[·5c8 | 4270 | ··[·5c8a2]··_ZNSt11_Deque_baseI7BedLineSaIS0_EE11_Deque_implC2Ev |
| 4271 | ··[·5c8 | 4271 | ··[·5c8d7]··_ZNSt11_Deque_baseI10LineStatusSaIS0_EE11_Deque_implC2Ev |
| 4272 | ··[·5c | 4272 | ··[·5c910]··_ZNSt11_Deque_baseINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS5_EE11_Deque_implC2Ev |
| 4273 | ··[·5c9 | 4273 | ··[·5c971]··_ZNSt12_Vector_baseI9ReferenceSaIS0_EE12_Vector_implC2Ev |
| 4274 | ··[·5c9 | 4274 | ··[·5c9aa]··_ZNSt12_Vector_baseI12markov_stateSaIS0_EE12_Vector_implC2Ev |
| 4275 | ··[·5c9 | 4275 | ··[·5c9e7]··_ZNSt12_Vector_baseI12junction_chrSaIS0_EE12_Vector_implC2Ev |
| 4276 | ··[·5c | 4276 | ··[·5ca24]··_ZNSt12_Vector_baseIP20ComparableVcfVariantSaIS1_EE12_Vector_implC2Ev |
| Max diff block lines reached; 0/240062 bytes (0.00%) of diff not shown. | |||
| Offset 169, 16 lines modified | Offset 169, 16 lines modified | ||
| 169 | ··[···b69]··rational_horner3_20.hpp | 169 | ··[···b69]··rational_horner3_20.hpp |
| 170 | ··[···b81]··throw_exception.hpp | 170 | ··[···b81]··throw_exception.hpp |
| 171 | ··[···b95]··stdexcept | 171 | ··[···b95]··stdexcept |
| 172 | ··[···b9f]··unchecked_factorial.hpp | 172 | ··[···b9f]··unchecked_factorial.hpp |
| 173 | ··[···bb7]··array | 173 | ··[···bb7]··array |
| 174 | ··[···bbd]··viterbi.hpp | 174 | ··[···bbd]··viterbi.hpp |
| 175 | ··[···bc9]··viterbi.h | 175 | ··[···bc9]··viterbi.h |
| 176 | ··[···bd3]··Variant.h | ||
| 177 | ··[···bd | 176 | ··[···bd3]··unify_vcf.h |
| 177 | ··[···bdf]··Variant.h | ||
| 178 | ··[···be9]··join.h | 178 | ··[···be9]··join.h |
| 179 | ··[···bf0]··stl_list.h | 179 | ··[···bf0]··stl_list.h |
| 180 | ··[···bfb]··allocated_ptr.h | 180 | ··[···bfb]··allocated_ptr.h |
| 181 | ··[···c0b]··list.tcc | 181 | ··[···c0b]··list.tcc |
| 182 | ··[···c14]··stl_queue.h | 182 | ··[···c14]··stl_queue.h |
| 183 | ··[···c20]··gamma.hpp | 183 | ··[···c20]··gamma.hpp |
| 184 | ··[···c2a]··iomanip | 184 | ··[···c2a]··iomanip |
| Offset 1, 8 lines modified | Offset 1, 8 lines modified | ||
| 1 | Hex·dump·of·section·'.gnu_debugaltlink': | 1 | Hex·dump·of·section·'.gnu_debugaltlink': |
| 2 | ··0x00000000·2f757372·2f6c6962·2f646562·75672f2e·/usr/lib/debug/. | 2 | ··0x00000000·2f757372·2f6c6962·2f646562·75672f2e·/usr/lib/debug/. |
| 3 | ··0x00000010·64777a2f·69333836·2d6c696e·75782d67·dwz/i386-linux-g | 3 | ··0x00000010·64777a2f·69333836·2d6c696e·75782d67·dwz/i386-linux-g |
| 4 | ··0x00000020·6e752f74·76632e64·65627567·00 | 4 | ··0x00000020·6e752f74·76632e64·65627567·00baab79·nu/tvc.debug...y |
| 5 | ··0x00000030· | 5 | ··0x00000030·896f6c2f·e012d0a5·f1bd009f·e4175a15·.ol/..........Z. |
| 6 | ··0x00000040· | 6 | ··0x00000040·a6··································. |
| Offset 10, 40 lines modified | Offset 10, 40 lines modified | ||
| 10 | ··0x00000070·00707265·70617265·5f686f74·73706f74·.prepare_hotspot | 10 | ··0x00000070·00707265·70617265·5f686f74·73706f74·.prepare_hotspot |
| 11 | ··0x00000080·732e6370·70005f5a·4e537431·355f4465·s.cpp._ZNSt15_De | 11 | ··0x00000080·732e6370·70005f5a·4e537431·355f4465·s.cpp._ZNSt15_De |
| 12 | ··0x00000090·7175655f·69746572·61746f72·4936416c·que_iteratorI6Al | 12 | ··0x00000090·7175655f·69746572·61746f72·4936416c·que_iteratorI6Al |
| 13 | ··0x000000a0·6c656c65·5253305f·5053305f·45704c45·leleRS0_PS0_EpLE | 13 | ··0x000000a0·6c656c65·5253305f·5053305f·45704c45·leleRS0_PS0_EpLE |
| 14 | ··0x000000b0·692e6973·72612e30·005f5a4e·5374375f·i.isra.0._ZNSt7_ | 14 | ··0x000000b0·692e6973·72612e30·005f5a4e·5374375f·i.isra.0._ZNSt7_ |
| 15 | ··0x000000c0·5f637878·31313132·62617369·635f7374·_cxx1112basic_st | 15 | ··0x000000c0·5f637878·31313132·62617369·635f7374·_cxx1112basic_st |
| 16 | ··0x000000d0·72696e67·49635374·31316368·61725f74·ringIcSt11char_t | 16 | ··0x000000d0·72696e67·49635374·31316368·61725f74·ringIcSt11char_t |
| 17 | ··0x000000e0·72616974·73496345·53614963·45453 | 17 | ··0x000000e0·72616974·73496345·53614963·45453132·raitsIcESaIcEE12 |
| 18 | ··0x000000f0·5f4d5f63·6f6e7374·72756374·49506345·_M_constructIPcE | ||
| 19 | ··0x00000100·4576545f·53375f53·74323066·6f727761·EvT_S7_St20forwa | ||
| 20 | ··0x00000110·72645f69·74657261·746f725f·7461672e·rd_iterator_tag. | ||
| 21 | ··0x00000120·69737261·2e30005f·5a4e5374·375f5f63·isra.0._ZNSt7__c | ||
| 22 | ··0x00000130·78783131·31326261·7369635f·73747269·xx1112basic_stri | ||
| 23 | ··0x00000140·6e674963·53743131·63686172·5f747261·ngIcSt11char_tra | ||
| 24 | ··0x00000150·69747349·63455361·49634545·36617373·itsIcESaIcEE6ass | ||
| 18 | ··0x00000 | 25 | ··0x00000160·69676e45·504b632e·69737261·2e30005f·ignEPKc.isra.0._ |
| 26 | ··0x00000170·5a4e4b53·74375f5f·63787831·31313262·ZNKSt7__cxx1112b | ||
| 27 | ··0x00000180·61736963·5f737472·696e6749·63537431·asic_stringIcSt1 | ||
| 28 | ··0x00000190·31636861·725f7472·61697473·49634553·1char_traitsIcES | ||
| 29 | ··0x000001a0·61496345·4537636f·6d706172·6545524b·aIcEE7compareERK | ||
| 30 | ··0x000001b0·53345f2e·69737261·2e30005f·5a4e5374·S4_.isra.0._ZNSt | ||
| 31 | ··0x000001c0·31355f44·65717565·5f697465·7261746f·15_Deque_iterato | ||
| 32 | ··0x000001d0·72493641·6c6c656c·65525330·5f505330·rI6AlleleRS0_PS0 | ||
| 33 | ··0x000001e0·5f457070·45762e69·7372612e·30005f5a·_EppEv.isra.0._Z | ||
| 34 | ··0x000001f0·4e537437·5f5f6378·78313131·32626173·NSt7__cxx1112bas | ||
| 35 | ··0x00000200·69635f73·7472696e·67496353·74313163·ic_stringIcSt11c | ||
| 36 | ··0x00000210·6861725f·74726169·74734963·45536149·har_traitsIcESaI | ||
| 37 | ··0x00000220·63454561·53454f53·345f2e69·7372612e·cEEaSEOS4_.isra. | ||
| 19 | ··0x00000 | 38 | ··0x00000230·30005f5a·4e537437·5f5f6378·78313131·0._ZNSt7__cxx111 |
| 20 | ··0x00000 | 39 | ··0x00000240·32626173·69635f73·7472696e·67496353·2basic_stringIcS |
| 21 | ··0x00000 | 40 | ··0x00000250·74313163·6861725f·74726169·74734963·t11char_traitsIc |
| 22 | ··0x00000130·45536149·63454537·636f6d70·61726545·ESaIcEE7compareE | ||
| 23 | ··0x00000140·524b5334·5f2e6973·72612e30·005f5a4e·RKS4_.isra.0._ZN | ||
| 24 | ··0x00000150·5374375f·5f637878·31313132·62617369·St7__cxx1112basi | ||
| 25 | ··0x00000160·635f7374·72696e67·49635374·31316368·c_stringIcSt11ch | ||
| 26 | ··0x00000170·61725f74·72616974·73496345·53614963·ar_traitsIcESaIc | ||
| 27 | ··0x00000180·45453132·5f4d5f63·6f6e7374·72756374·EE12_M_construct | ||
| 28 | ··0x00000190·49504b63·45457654·5f53385f·53743230·IPKcEEvT_S8_St20 | ||
| 29 | ··0x000001a0·666f7277·6172645f·69746572·61746f72·forward_iterator | ||
| 30 | ··0x000001b0·5f746167·2e697372·612e3000·5f5a4e53·_tag.isra.0._ZNS | ||
| 31 | ··0x000001c0·7431355f·44657175·655f6974·65726174·t15_Deque_iterat | ||
| 32 | ··0x000001d0·6f724936·416c6c65·6c655253·305f5053·orI6AlleleRS0_PS | ||
| 33 | ··0x000001e0·305f4570·7045762e·69737261·2e30005f·0_EppEv.isra.0._ | ||
| 34 | ··0x000001f0·5a4e5374·375f5f63·78783131·31326261·ZNSt7__cxx1112ba | ||
| 35 | ··0x00000200·7369635f·73747269·6e674963·53743131·sic_stringIcSt11 | ||
| 36 | ··0x00000210·63686172·5f747261·69747349·63455361·char_traitsIcESa | ||
| 37 | ··0x00000220·49634545·6153454f·53345f2e·69737261·IcEEaSEOS4_.isra | ||
| 38 | ··0x00000230·2e30005f·5a4e5374·375f5f63·78783131·.0._ZNSt7__cxx11 | ||
| 39 | ··0x00000240·31326261·7369635f·73747269·6e674963·12basic_stringIc | ||
| 40 | ··0x00000250·53743131·63686172·5f747261·69747349·St11char_traitsI | ||
| 41 | ··0x00000260· | 41 | ··0x00000260·45536149·63454531·325f4d5f·636f6e73·ESaIcEE12_M_cons |
| 42 | ··0x00000270·7 | 42 | ··0x00000270·74727563·7449504b·63454576·545f5338·tructIPKcEEvT_S8 |
| 43 | ··0x00000280·5f537432·30666f72·77617264·5f697465·_St20forward_ite | 43 | ··0x00000280·5f537432·30666f72·77617264·5f697465·_St20forward_ite |
| 44 | ··0x00000290·7261746f·725f7461·672e6973·72612e30·rator_tag.isra.0 | 44 | ··0x00000290·7261746f·725f7461·672e6973·72612e30·rator_tag.isra.0 |
| 45 | ··0x000002a0·005f5a4e·5374375f·5f637878·31313132·._ZNSt7__cxx1112 | 45 | ··0x000002a0·005f5a4e·5374375f·5f637878·31313132·._ZNSt7__cxx1112 |
| 46 | ··0x000002b0·62617369·635f7374·72696e67·49635374·basic_stringIcSt | 46 | ··0x000002b0·62617369·635f7374·72696e67·49635374·basic_stringIcSt |
| 47 | ··0x000002c0·31316368·61725f74·72616974·73496345·11char_traitsIcE | 47 | ··0x000002c0·31316368·61725f74·72616974·73496345·11char_traitsIcE |
| 48 | ··0x000002d0·53614963·45454332·4953335f·4545504b·SaIcEEC2IS3_EEPK | 48 | ··0x000002d0·53614963·45454332·4953335f·4545504b·SaIcEEC2IS3_EEPK |
| 49 | ··0x000002e0·63524b53·335f2e63·6f6e7374·70726f70·cRKS3_.constprop | 49 | ··0x000002e0·63524b53·335f2e63·6f6e7374·70726f70·cRKS3_.constprop |
| Offset 220, 33 lines modified | Offset 220, 33 lines modified | ||
| 220 | ··0x00000d90·72696e67·49635374·31316368·61725f74·ringIcSt11char_t | 220 | ··0x00000d90·72696e67·49635374·31316368·61725f74·ringIcSt11char_t |
| 221 | ··0x00000da0·72616974·73496345·53614963·45454552·raitsIcESaIcEEER | 221 | ··0x00000da0·72616974·73496345·53614963·45454552·raitsIcESaIcEEER |
| 222 | ··0x00000db0·53355f50·53355f45·704c4569·2e697372·S5_PS5_EpLEi.isr | 222 | ··0x00000db0·53355f50·53355f45·704c4569·2e697372·S5_PS5_EpLEi.isr |
| 223 | ··0x00000dc0·612e3000·5f5a5374·34656e64·6c496353·a.0._ZSt4endlIcS | 223 | ··0x00000dc0·612e3000·5f5a5374·34656e64·6c496353·a.0._ZSt4endlIcS |
| 224 | ··0x00000dd0·74313163·6861725f·74726169·74734963·t11char_traitsIc | 224 | ··0x00000dd0·74313163·6861725f·74726169·74734963·t11char_traitsIc |
| 225 | ··0x00000de0·45455253·74313362·61736963·5f6f7374·EERSt13basic_ost | 225 | ··0x00000de0·45455253·74313362·61736963·5f6f7374·EERSt13basic_ost |
| 226 | ··0x00000df0·7265616d·49545f54·305f4553·365f2e69·reamIT_T0_ES6_.i | 226 | ··0x00000df0·7265616d·49545f54·305f4553·365f2e69·reamIT_T0_ES6_.i |
| 227 | ··0x00000e00·7372612e·30005f5a·53743232·5f5f756e·sra.0._ZSt22__un | ||
| 228 | ··0x00000e10·696e6974·69616c69·7a65645f·6d6f7665·initialized_move | ||
| 229 | ··0x00000e20·5f614953·7431355f·44657175·655f6974·_aISt15_Deque_it | ||
| 230 | ··0x00000e30·65726174·6f72494e·5374375f·5f637878·eratorINSt7__cxx | ||
| 231 | ··0x00000e40·31313132·62617369·635f7374·72696e67·1112basic_string | ||
| 232 | ··0x00000e50·49635374·31316368·61725f74·72616974·IcSt11char_trait | ||
| 233 | ··0x00000e60·73496345·53614963·45454552·53365f50·sIcESaIcEEERS6_P | ||
| 234 | ··0x00000e70·53365f45·53395f53·61495336·5f454554·S6_ES9_SaIS6_EET | ||
| 235 | ··0x00000e80·305f545f·53435f53·425f5254·315f2e69·0_T_SC_SB_RT1_.i | ||
| 227 | ··0x00000e | 236 | ··0x00000e90·7372612e·30005f5a·4e537435·64657175·sra.0._ZNSt5dequ |
| 228 | ··0x00000e | 237 | ··0x00000ea0·65494e53·74375f5f·63787831·31313262·eINSt7__cxx1112b |
| 229 | ··0x00000e | 238 | ··0x00000eb0·61736963·5f737472·696e6749·63537431·asic_stringIcSt1 |
| 230 | ··0x00000e | 239 | ··0x00000ec0·31636861·725f7472·61697473·49634553·1char_traitsIcES |
| 231 | ··0x00000e | 240 | ··0x00000ed0·61496345·45455361·4953355f·45453139·aIcEEESaIS5_EE19 |
| 232 | ··0x00000e | 241 | ··0x00000ee0·5f4d5f64·65737472·6f795f64·6174615f·_M_destroy_data_ |
| 233 | ··0x00000e | 242 | ··0x00000ef0·61757845·53743135·5f446571·75655f69·auxESt15_Deque_i |
| 234 | ··0x00000 | 243 | ··0x00000f00·74657261·746f7249·53355f52·53355f50·teratorIS5_RS5_P |
| 235 | ··0x00000 | 244 | ··0x00000f10·53355f45·53425f2e·69737261·2e30005f·S5_ESB_.isra.0._ |
| 236 | ··0x00000 | 245 | ··0x00000f20·5a4e3742·65644c69·6e656153·454f535f·ZN7BedLineaSEOS_ |
| 237 | ··0x00000ea0·2e697372·612e3000·5f5a5374·32325f5f·.isra.0._ZSt22__ | ||
| 238 | ··0x00000eb0·756e696e·69746961·6c697a65·645f6d6f·uninitialized_mo | ||
| 239 | ··0x00000ec0·76655f61·49537431·355f4465·7175655f·ve_aISt15_Deque_ | ||
| 240 | ··0x00000ed0·69746572·61746f72·494e5374·375f5f63·iteratorINSt7__c | ||
| 241 | ··0x00000ee0·78783131·31326261·7369635f·73747269·xx1112basic_stri | ||
| 242 | ··0x00000ef0·6e674963·53743131·63686172·5f747261·ngIcSt11char_tra | ||
| 243 | ··0x00000f00·69747349·63455361·49634545·45525336·itsIcESaIcEEERS6 | ||
| 244 | ··0x00000f10·5f505336·5f455339·5f536149·53365f45·_PS6_ES9_SaIS6_E | ||
| 245 | ··0x00000f20·4554305f·545f5343·5f53425f·5254315f·ET0_T_SC_SB_RT1_ | ||
| 246 | ··0x00000f30·2e697372·612e3000·5f5a4e53·74356465·.isra.0._ZNSt5de | 246 | ··0x00000f30·2e697372·612e3000·5f5a4e53·74356465·.isra.0._ZNSt5de |
| 247 | ··0x00000f40·71756549·31304c6f·674d6573·73616765·queI10LogMessage | 247 | ··0x00000f40·71756549·31304c6f·674d6573·73616765·queI10LogMessage |
| 248 | ··0x00000f50·53614953·305f4545·3132656d·706c6163·SaIS0_EE12emplac | 248 | ··0x00000f50·53614953·305f4545·3132656d·706c6163·SaIS0_EE12emplac |
| 249 | ··0x00000f60·655f6261·636b494a·53305f45·45455253·e_backIJS0_EEERS | 249 | ··0x00000f60·655f6261·636b494a·53305f45·45455253·e_backIJS0_EEERS |
| 250 | ··0x00000f70·305f4470·4f545f2e·69737261·2e30005f·0_DpOT_.isra.0._ | 250 | ··0x00000f70·305f4470·4f545f2e·69737261·2e30005f·0_DpOT_.isra.0._ |
| 251 | ··0x00000f80·5a4e3742·65644669·6c653130·6c6f675f·ZN7BedFile10log_ | 251 | ··0x00000f80·5a4e3742·65644669·6c653130·6c6f675f·ZN7BedFile10log_ |
| 252 | ··0x00000f90·636f6c75·6d6e4531·30457272·6f724c65·columnE10ErrorLe | 252 | ··0x00000f90·636f6c75·6d6e4531·30457272·6f724c65·columnE10ErrorLe |
| Offset 362, 4627 lines modified | Offset 362, 4587 lines modified | ||
| 362 | ··0x00001670·7472696e·67496353·74313163·6861725f·tringIcSt11char_ | 362 | ··0x00001670·7472696e·67496353·74313163·6861725f·tringIcSt11char_ |
| 363 | ··0x00001680·74726169·74734963·45536149·63454545·traitsIcESaIcEEE | 363 | ··0x00001680·74726169·74734963·45536149·63454545·traitsIcESaIcEEE |
| 364 | ··0x00001690·524b5336·5f505337·5f455330·5f495336·RKS6_PS7_ES0_IS6 | 364 | ··0x00001690·524b5336·5f505337·5f455330·5f495336·RKS6_PS7_ES0_IS6 |
| 365 | ··0x000016a0·5f525336·5f505336·5f455336·5f455430·_RS6_PS6_ES6_ET0 | 365 | ··0x000016a0·5f525336·5f505336·5f455336·5f455430·_RS6_PS6_ES6_ET0 |
| 366 | ··0x000016b0·5f545f53·465f5345·5f525361·4954315f·_T_SF_SE_RSaIT1_ | 366 | ··0x000016b0·5f545f53·465f5345·5f525361·4954315f·_T_SF_SE_RSaIT1_ |
| 367 | ··0x000016c0·452e6973·72612e30·2e636f6c·64005f5a·E.isra.0.cold._Z | 367 | ··0x000016c0·452e6973·72612e30·2e636f6c·64005f5a·E.isra.0.cold._Z | Diff chunk too large, falling back to line-by-line diff (2074 lines added, 2074 lines removed) |
| 368 | ··0x000016d0·53743232·5f5f756e·696e6974·69616c69·St22__uninitiali | 368 | ··0x000016d0·53743232·5f5f756e·696e6974·69616c69·St22__uninitiali |
| 369 | ··0x000016e0·7a65645f·6 | 369 | ··0x000016e0·7a65645f·6d6f7665·5f614953·7431355f·zed_move_aISt15_ |
| 370 | ··0x000016f0·44657175·655f6974·65726174·6f7249 | 370 | ··0x000016f0·44657175·655f6974·65726174·6f724937·Deque_iteratorI7 |
| 371 | ··0x00001700·5 | 371 | ··0x00001700·4265644c·696e6552·53315f50·53315f45·BedLineRS1_PS1_E |
| 372 | ··0x00001710· | 372 | ··0x00001710·53345f53·61495331·5f454554·305f545f·S4_SaIS1_EET0_T_ |
| 373 | ··0x00001720·53 | 373 | ··0x00001720·53375f53·365f5254·315f2e69·7372612e·S7_S6_RT1_.isra. |
| 374 | ··0x00001730· | 374 | ··0x00001730·30005f5a·4e537435·64657175·65494e53·0._ZNSt5dequeINS |
| 375 | ··0x00001740· | 375 | ··0x00001740·74375f5f·63787831·31313262·61736963·t7__cxx1112basic |
| 376 | ··0x00001750·5f | 376 | ··0x00001750·5f737472·696e6749·63537431·31636861·_stringIcSt11cha |
| 377 | ··0x00001760· | 377 | ··0x00001760·725f7472·61697473·49634553·61496345·r_traitsIcESaIcE |
| 378 | ··0x00001770·45 | 378 | ··0x00001770·45455361·4953355f·45456153·45524b53·EESaIS5_EEaSERKS |
| 379 | ··0x00001780· | 379 | ··0x00001780·375f2e69·7372612e·30005f5a·4e537435·7_.isra.0._ZNSt5 |
| 380 | ··0x00001790· | 380 | ··0x00001790·64657175·65494e53·74375f5f·63787831·dequeINSt7__cxx1 |
| 381 | ··0x000017a0· | 381 | ··0x000017a0·31313262·61736963·5f737472·696e6749·112basic_stringI |
| 382 | ··0x000017b0·635 | 382 | ··0x000017b0·63537431·31636861·725f7472·61697473·cSt11char_traits |
| 383 | ··0x000017c0· | 383 | ··0x000017c0·49634553·61496345·45455361·4953355f·IcESaIcEEESaIS5_ |
| 384 | ··0x000017d0·4545 | 384 | ··0x000017d0·45456153·45524b53·375f2e69·7372612e·EEaSERKS7_.isra. |
| Max diff block lines reached; 338006/624432 bytes (54.13%) of diff not shown. | |||
| Offset 4, 17 lines modified | Offset 4, 17 lines modified | ||
| 4 | ··Data:······························2's·complement,·little·endian | 4 | ··Data:······························2's·complement,·little·endian |
| 5 | ··Version:···························1·(current) | 5 | ··Version:···························1·(current) |
| 6 | ··OS/ABI:····························UNIX·-·GNU | 6 | ··OS/ABI:····························UNIX·-·GNU |
| 7 | ··ABI·Version:·······················0 | 7 | ··ABI·Version:·······················0 |
| 8 | ··Type:······························DYN·(Shared·object·file) | 8 | ··Type:······························DYN·(Shared·object·file) |
| 9 | ··Machine:···························Intel·80386 | 9 | ··Machine:···························Intel·80386 |
| 10 | ··Version:···························0x1 | 10 | ··Version:···························0x1 |
| 11 | ··Entry·point·address:···············0x2 | 11 | ··Entry·point·address:···············0x2b1b0 |
| 12 | ··Start·of·program·headers:··········52·(bytes·into·file) | 12 | ··Start·of·program·headers:··········52·(bytes·into·file) |
| 13 | ··Start·of·section·headers:·········· | 13 | ··Start·of·section·headers:··········8067144·(bytes·into·file) |
| 14 | ··Flags:·····························0x0 | 14 | ··Flags:·····························0x0 |
| 15 | ··Size·of·this·header:···············52·(bytes) | 15 | ··Size·of·this·header:···············52·(bytes) |
| 16 | ··Size·of·program·headers:···········32·(bytes) | 16 | ··Size·of·program·headers:···········32·(bytes) |
| 17 | ··Number·of·program·headers:·········11 | 17 | ··Number·of·program·headers:·········11 |
| 18 | ··Size·of·section·headers:···········40·(bytes) | 18 | ··Size·of·section·headers:···········40·(bytes) |
| 19 | ··Number·of·section·headers:·········40 | 19 | ··Number·of·section·headers:·········40 |
| 20 | ··Section·header·string·table·index:·39 | 20 | ··Section·header·string·table·index:·39 |
| Offset 1, 25 lines modified | Offset 1, 25 lines modified | ||
| 1 | Elf·file·type·is·DYN·(Shared·object·file) | 1 | Elf·file·type·is·DYN·(Shared·object·file) |
| 2 | Entry·point·0x2 | 2 | Entry·point·0x2b1b0 |
| 3 | There·are·11·program·headers,·starting·at·offset·52 | 3 | There·are·11·program·headers,·starting·at·offset·52 |
| 4 | Program·Headers: | 4 | Program·Headers: |
| 5 | ··Type···········Offset···VirtAddr···PhysAddr···FileSiz·MemSiz··Flg·Align | 5 | ··Type···········Offset···VirtAddr···PhysAddr···FileSiz·MemSiz··Flg·Align |
| 6 | ··PHDR···········0x000034·0x00000034·0x00000034·0x00160·0x00160·R···0x4 | 6 | ··PHDR···········0x000034·0x00000034·0x00000034·0x00160·0x00160·R···0x4 |
| 7 | ··INTERP·········0x000194·0x00000194·0x00000194·0x00000·0x00013·R···0x1 | 7 | ··INTERP·········0x000194·0x00000194·0x00000194·0x00000·0x00013·R···0x1 |
| 8 | ··LOAD···········0x000000·0x00000000·0x00000000·0x001ec·0x1d | 8 | ··LOAD···········0x000000·0x00000000·0x00000000·0x001ec·0x1d8f4·R···0x1000 |
| 9 | ··LOAD···········0x000000·0x0001e000·0x0001e000·0x00000·0xd | 9 | ··LOAD···········0x000000·0x0001e000·0x0001e000·0x00000·0xd6338·R·E·0x1000 |
| 10 | ··LOAD···········0x000000·0x000f | 10 | ··LOAD···········0x000000·0x000f5000·0x000f5000·0x00000·0x36b3b·R···0x1000 |
| 11 | ··LOAD···········0x000da | 11 | ··LOAD···········0x000da0·0x0012cda0·0x0012cda0·0x00000·0x00bfc·RW··0x1000 |
| 12 | ··DYNAMIC········0x000da | 12 | ··DYNAMIC········0x000da0·0x0012ce3c·0x0012ce3c·0x00000·0x00138·RW··0x4 |
| 13 | ··NOTE···········0x0001a8·0x000001a8·0x000001a8·0x00044·0x00044·R···0x4 | 13 | ··NOTE···········0x0001a8·0x000001a8·0x000001a8·0x00044·0x00044·R···0x4 |
| 14 | ··GNU_EH_FRAME···0x001000·0x00 | 14 | ··GNU_EH_FRAME···0x001000·0x00100384·0x00100384·0x00000·0x02f64·R···0x4 |
| 15 | ··GNU_STACK······0x000000·0x00000000·0x00000000·0x00000·0x00000·RW··0x10 | 15 | ··GNU_STACK······0x000000·0x00000000·0x00000000·0x00000·0x00000·RW··0x10 |
| 16 | ··GNU_RELRO······0x000da | 16 | ··GNU_RELRO······0x000da0·0x0012cda0·0x0012cda0·0x00000·0x00260·R···0x1 |
| 17 | ·Section·to·Segment·mapping: | 17 | ·Section·to·Segment·mapping: |
| 18 | ··Segment·Sections... | 18 | ··Segment·Sections... |
| 19 | ···00····· | 19 | ···00····· |
| 20 | ···01·····.interp· | 20 | ···01·····.interp· |
| 21 | ···02·····.interp·.note.gnu.build-id·.note.ABI-tag·.gnu.hash·.dynsym·.dynstr·.gnu.version·.gnu.version_r·.rel.dyn·.rel.plt· | 21 | ···02·····.interp·.note.gnu.build-id·.note.ABI-tag·.gnu.hash·.dynsym·.dynstr·.gnu.version·.gnu.version_r·.rel.dyn·.rel.plt· |
| 22 | ···03·····.init·.plt·.plt.got·.text·.fini· | 22 | ···03·····.init·.plt·.plt.got·.text·.fini· |
| Offset 1, 49 lines modified | Offset 1, 49 lines modified | ||
| 1 | There·are·40·section·headers,·starting·at·offset·0x7 | 1 | There·are·40·section·headers,·starting·at·offset·0x7b1848: |
| 2 | Section·Headers: | 2 | Section·Headers: |
| 3 | ··[Nr]·Name··············Type············Addr·····Off····Size···ES·Flg·Lk·Inf·Al | 3 | ··[Nr]·Name··············Type············Addr·····Off····Size···ES·Flg·Lk·Inf·Al |
| 4 | ··[·0]···················NULL············00000000·000000·000000·00······0···0··0 | 4 | ··[·0]···················NULL············00000000·000000·000000·00······0···0··0 |
| 5 | ··[·1]·.interp···········NOBITS··········00000194·000194·000013·00···A··0···0··1 | 5 | ··[·1]·.interp···········NOBITS··········00000194·000194·000013·00···A··0···0··1 |
| 6 | ··[·2]·.note.gnu.build-id·NOTE············000001a8·0001a8·000024·00···A··0···0··4 | 6 | ··[·2]·.note.gnu.build-id·NOTE············000001a8·0001a8·000024·00···A··0···0··4 |
| 7 | ··[·3]·.note.ABI-tag·····NOTE············000001cc·0001cc·000020·00···A··0···0··4 | 7 | ··[·3]·.note.ABI-tag·····NOTE············000001cc·0001cc·000020·00···A··0···0··4 |
| 8 | ··[·4]·.gnu.hash·········NOBITS··········000001ec·0001ec·0026 | 8 | ··[·4]·.gnu.hash·········NOBITS··········000001ec·0001ec·002660·04···A··5···0··4 |
| 9 | ··[·5]·.dynsym···········NOBITS··········00002 | 9 | ··[·5]·.dynsym···········NOBITS··········0000284c·0001ec·005b50·10···A··6···1··4 |
| 10 | ··[·6]·.dynstr···········NOBITS··········00008 | 10 | ··[·6]·.dynstr···········NOBITS··········0000839c·0001ec·013d5d·00···A··0···0··1 |
| 11 | ··[·7]·.gnu.version······NOBITS··········0001 | 11 | ··[·7]·.gnu.version······NOBITS··········0001c0fa·0001ec·000b6a·02···A··5···0··2 |
| 12 | ··[·8]·.gnu.version_r····NOBITS··········0001c | 12 | ··[·8]·.gnu.version_r····NOBITS··········0001cc64·0001ec·000200·00···A··6···4··4 |
| 13 | ··[·9]·.rel.dyn··········NOBITS··········0001c | 13 | ··[·9]·.rel.dyn··········NOBITS··········0001ce64·0001ec·000258·08···A··5···0··4 |
| 14 | ··[10]·.rel.plt··········NOBITS··········0001 | 14 | ··[10]·.rel.plt··········NOBITS··········0001d0bc·0001ec·000838·08···A··5··24··4 |
| 15 | ··[11]·.init·············NOBITS··········0001e000·001000·000020·00··AX··0···0··4 | 15 | ··[11]·.init·············NOBITS··········0001e000·001000·000020·00··AX··0···0··4 |
| 16 | ··[12]·.plt··············NOBITS··········0001e020·001000·0010 | 16 | ··[12]·.plt··············NOBITS··········0001e020·001000·001080·04··AX··0···0·16 |
| 17 | ··[13]·.plt.got··········NOBITS··········0001f0 | 17 | ··[13]·.plt.got··········NOBITS··········0001f0a0·001000·000008·08··AX··0···0··8 |
| 18 | ··[14]·.text·············NOBITS··········0001f0 | 18 | ··[14]·.text·············NOBITS··········0001f0b0·001000·0d5274·00··AX··0···0·16 |
| 19 | ··[15]·.fini·············NOBITS··········000 | 19 | ··[15]·.fini·············NOBITS··········000f4324·001000·000014·00··AX··0···0··4 |
| 20 | ··[16]·.rodata···········NOBITS··········000f | 20 | ··[16]·.rodata···········NOBITS··········000f5000·001000·00b384·00···A··0···0·32 |
| 21 | ··[17]·.eh_frame_hdr·····NOBITS··········00 | 21 | ··[17]·.eh_frame_hdr·····NOBITS··········00100384·001000·002f64·00···A··0···0··4 |
| 22 | ··[18]·.eh_frame·········NOBITS··········00 | 22 | ··[18]·.eh_frame·········NOBITS··········001032e8·001000·022d20·00···A··0···0··4 |
| 23 | ··[19]·.gcc_except_table·NOBITS··········001 | 23 | ··[19]·.gcc_except_table·NOBITS··········00126008·001000·005b33·00···A··0···0··4 |
| 24 | ··[20]·.init_array·······NOBITS··········0012 | 24 | ··[20]·.init_array·······NOBITS··········0012cda0·000da0·000098·04··WA··0···0··4 |
| 25 | ··[21]·.fini_array·······NOBITS··········0012 | 25 | ··[21]·.fini_array·······NOBITS··········0012ce38·000da0·000004·04··WA··0···0··4 |
| 26 | ··[22]·.dynamic··········NOBITS··········0012 | 26 | ··[22]·.dynamic··········NOBITS··········0012ce3c·000da0·000138·08··WA··6···0··4 |
| 27 | ··[23]·.got··············NOBITS··········0012 | 27 | ··[23]·.got··············NOBITS··········0012cf74·000da0·000080·04··WA··0···0··4 |
| 28 | ··[24]·.got.plt··········NOBITS··········0012 | 28 | ··[24]·.got.plt··········NOBITS··········0012cff4·000da0·000428·04··WA··0···0··4 |
| 29 | ··[25]·.data·············NOBITS··········0012 | 29 | ··[25]·.data·············NOBITS··········0012d420·000da0·000540·00··WA··0···0·32 |
| 30 | ··[26]·.bss··············NOBITS··········0012 | 30 | ··[26]·.bss··············NOBITS··········0012d960·000da0·00003c·00··WA··0···0··8 |
| 31 | ··[27]·.comment··········PROGBITS········00000000·0001ec·00001f·01··MS··0···0··1 | 31 | ··[27]·.comment··········PROGBITS········00000000·0001ec·00001f·01··MS··0···0··1 |
| 32 | ··[28]·.debug_aranges····PROGBITS········00000000·00020c·000b | 32 | ··[28]·.debug_aranges····PROGBITS········00000000·00020c·000b93·00···C··0···0··4 |
| 33 | ··[29]·.debug_info·······PROGBITS········00000000·000d | 33 | ··[29]·.debug_info·······PROGBITS········00000000·000da0·5c2cd8·00···C··0···0··4 |
| 34 | ··[30]·.debug_abbrev·····PROGBITS········00000000·5 | 34 | ··[30]·.debug_abbrev·····PROGBITS········00000000·5c3a78·012c01·00···C··0···0··4 |
| 35 | ··[31]·.debug_line·······PROGBITS········00000000·5 | 35 | ··[31]·.debug_line·······PROGBITS········00000000·5d667c·06f338·00···C··0···0··4 |
| 36 | ··[32]·.debug_str········PROGBITS········00000000·6 | 36 | ··[32]·.debug_str········PROGBITS········00000000·6459b4·022318·01·MSC··0···0··4 |
| 37 | ··[33]·.debug_line_str···PROGBITS········00000000·6 | 37 | ··[33]·.debug_line_str···PROGBITS········00000000·667ccc·0008c5·01·MSC··0···0··4 |
| 38 | ··[34]·.debug_loclists···PROGBITS········00000000·6 | 38 | ··[34]·.debug_loclists···PROGBITS········00000000·668594·0eb42b·00···C··0···0··4 |
| 39 | ··[35]·.debug_rnglists···PROGBITS········00000000·7 | 39 | ··[35]·.debug_rnglists···PROGBITS········00000000·7539c0·03750f·00···C··0···0··4 |
| 40 | ··[36]·.gnu_debugaltlink·PROGBITS········00000000·7 | 40 | ··[36]·.gnu_debugaltlink·PROGBITS········00000000·78aecf·000041·00······0···0··1 |
| 41 | ··[37]·.symtab···········SYMTAB··········00000000·7 | 41 | ··[37]·.symtab···········SYMTAB··········00000000·78af10·008e50·10·····38·817··4 |
| 42 | ··[38]·.strtab···········STRTAB··········00000000·7 | 42 | ··[38]·.strtab···········STRTAB··········00000000·793d60·01d94d·00······0···0··1 |
| 43 | ··[39]·.shstrtab·········STRTAB··········00000000·7 | 43 | ··[39]·.shstrtab·········STRTAB··········00000000·7b16ad·000199·00······0···0··1 |
| 44 | Key·to·Flags: | 44 | Key·to·Flags: |
| 45 | ··W·(write),·A·(alloc),·X·(execute),·M·(merge),·S·(strings),·I·(info), | 45 | ··W·(write),·A·(alloc),·X·(execute),·M·(merge),·S·(strings),·I·(info), |
| 46 | ··L·(link·order),·O·(extra·OS·processing·required),·G·(group),·T·(TLS), | 46 | ··L·(link·order),·O·(extra·OS·processing·required),·G·(group),·T·(TLS), |
| 47 | ··C·(compressed),·x·(unknown),·o·(OS·specific),·E·(exclude), | 47 | ··C·(compressed),·x·(unknown),·o·(OS·specific),·E·(exclude), |
| 48 | ··R·(retain),·D·(mbind),·p·(processor·specific) | 48 | ··R·(retain),·D·(mbind),·p·(processor·specific) |
| Offset 1, 2247 lines modified | Offset 1, 2280 lines modified | ||
| 1 | Symbol·table·'.symtab'·contains·22 | 1 | Symbol·table·'.symtab'·contains·2277·entries: |
| 2 | ···Num:····Value··Size·Type····Bind···Vis······Ndx·Name | 2 | ···Num:····Value··Size·Type····Bind···Vis······Ndx·Name |
| 3 | ·····0:·00000000·····0·NOTYPE··LOCAL··DEFAULT··UND· | 3 | ·····0:·00000000·····0·NOTYPE··LOCAL··DEFAULT··UND· |
| 4 | ·····1:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·Scrt1.o | 4 | ·····1:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·Scrt1.o |
| 5 | ·····2:·000001cc····32·OBJECT··LOCAL··DEFAULT····3·__abi_tag | 5 | ·····2:·000001cc····32·OBJECT··LOCAL··DEFAULT····3·__abi_tag |
| 6 | ·····3:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·VariantCaller.cpp | 6 | ·····3:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·VariantCaller.cpp |
| 7 | ·····4:·0002 | 7 | ·····4:·0002b2e0···117·FUNC····LOCAL··DEFAULT···14·_ZSt4endlIcSt11char_traitsIcEERSt13basic_ostreamIT_T0_ES6_.isra.0 |
| 8 | ·····5:·0002 | 8 | ·····5:·0002b360···611·FUNC····LOCAL··DEFAULT···14·_ZNSt5dequeIbSaIbEE12emplace_backIJbEEERbDpOT_.isra.0 |
| 9 | ·····6:·0002b | 9 | ·····6:·0002b5d0···167·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12_M_constructIPcEEvT_S7_St20forward_iterator_tag.isra.0 |
| 10 | ·····7:·0002d | 10 | ·····7:·0002d330···446·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeIjSt4pairIKj9TMetaDataESt10_Select1stIS3_ESt4lessIjESaIS3_EE8_M_eraseEPSt13_Rb_tree_nodeIS3_E.isra.0 |
| 11 | ·····8:·0002b | 11 | ·····8:·0002b680···188·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_St6vectorIS5_SaIS5_EEESt10_Select1stISB_ESt4lessIS5_ESaISB_EE8_M_eraseEPSt13_Rb_tree_nodeISB_E.isra.0 |
| 12 | ·····9:·0002b | 12 | ·····9:·0002b740···294·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_St3mapIS5_St6vectorIS5_SaIS5_EESt4lessIS5_ESaIS6_IS7_SB_EEEESt10_Select1stISH_ESD_SaISH_EE8_M_eraseEPSt13_Rb_tree_nodeISH_E.isra.0 |
| 13 | ····10:·0002d | 13 | ····10:·0002d4f0···352·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_11OptArgumentESt10_Select1stIS9_ESt4lessIS5_ESaIS9_EE8_M_eraseEPSt13_Rb_tree_nodeIS9_E.isra.0 |
| 14 | ····11:·0002d | 14 | ····11:·0002d650···873·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_22LinearCalibrationModelESt10_Select1stIS9_ESt4lessIS5_ESaIS9_EE8_M_eraseEPSt13_Rb_tree_nodeIS9_E.isra.0 |
| 15 | ····12:·0002b | 15 | ····12:·0002b870···716·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_N3vcf16VariantFieldTypeEESt10_Select1stISA_ESt4lessIS5_ESaISA_EE8_M_eraseEPSt13_Rb_tree_nodeISA_E.isra.0 |
| 16 | ····13:·0002b750···716·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_bESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE8_M_eraseEPSt13_Rb_tree_nodeIS8_E.isra.0 | ||
| 17 | ····1 | 16 | ····13:·0002d9c0···716·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_S6_IiiEESt10_Select1stIS9_ESt4lessIS5_ESaIS9_EE8_M_eraseEPSt13_Rb_tree_nodeIS9_E.isra.0 |
| 17 | ····14:·0002bb40···716·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_bESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE8_M_eraseEPSt13_Rb_tree_nodeIS8_E.isra.0 | ||
| 18 | ····15:·0002d | 18 | ····15:·0002dc90···973·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_S5_ESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE8_M_eraseEPSt13_Rb_tree_nodeIS8_E.isra.0 |
| 19 | ····16:·0002b | 19 | ····16:·0002be10···716·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_iESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE8_M_eraseEPSt13_Rb_tree_nodeIS8_E.isra.0 |
| 20 | ····17:·0002 | 20 | ····17:·0002c100··1370·FUNC····LOCAL··DEFAULT···14·_ZNSt5dequeI16VariantCandidateSaIS0_EE19_M_destroy_data_auxESt15_Deque_iteratorIS0_RS0_PS0_ES6_.isra.0 |
| 21 | ····18:·0001f0 | 21 | ····18:·0001f0b0···339·FUNC····LOCAL··DEFAULT···14·main.cold |
| 22 | ····19:·0001f | 22 | ····19:·0001f203····62·FUNC····LOCAL··DEFAULT···14·_Z19VariantCallerWorkerPv.cold |
| 23 | ····20:·00029 | 23 | ····20:·000293b0····87·FUNC····LOCAL··DEFAULT···14·_GLOBAL__sub_I__Z25TheSilenceOfTheArmadillosRSt14basic_ofstreamIcSt11char_traitsIcEE |
| 24 | ····21:·0012 | 24 | ····21:·0012d961·····1·OBJECT··LOCAL··DEFAULT···26·_ZStL8__ioinit |
| 25 | ····22:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·BAMWalkerEngine.cpp | 25 | ····22:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·BAMWalkerEngine.cpp |
| 26 | ····23:·00033680···167·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12_M_constructIPKcEEvT_S8_St20forward_iterator_tag.isra.0 | ||
| 27 | ····24:·00033730···351·FUNC····LOCAL··DEFAULT···14·_ZNSt6vectorIN8BamTools7CigarOpESaIS1_EEaSERKS3_.isra.0 | ||
| 26 | ····2 | 28 | ····25:·00033890···167·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12_M_constructIPcEEvT_S7_St20forward_iterator_tag.isra.0 |
| 27 | ····24:·000338e0···349·FUNC····LOCAL··DEFAULT···14·_ZNSt6vectorIN8BamTools7CigarOpESaIS1_EEaSERKS3_.isra.0 | ||
| 28 | ····25:·00033a40···167·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12_M_constructIPKcEEvT_S8_St20forward_iterator_tag.isra.0 | ||
| 29 | ····26:·00033 | 29 | ····26:·00033940···340·FUNC····LOCAL··DEFAULT···14·_ZL7myorderPN8BamTools12BamAlignmentES1_ |
| 30 | ····27:·0012 | 30 | ····27:·0012d430·····4·OBJECT··LOCAL··DEFAULT···25·_ZL15prefix_exclude_ |
| 31 | ····28:·0001f2 | 31 | ····28:·0001f242····20·FUNC····LOCAL··DEFAULT···14·_ZL7myorderPN8BamTools12BamAlignmentES1_.cold |
| 32 | ····29:·00033 | 32 | ····29:·00033aa0···476·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES5_St9_IdentityIS5_ESt4lessIS5_ESaIS5_EE16_M_insert_uniqueIRKS5_EESt4pairISt17_Rb_tree_iteratorIS5_EbEOT_.isra.0 |
| 33 | ····30:·0001f25 | 33 | ····30:·0001f256····51·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES5_St9_IdentityIS5_ESt4lessIS5_ESaIS5_EE16_M_insert_uniqueIRKS5_EESt4pairISt17_Rb_tree_iteratorIS5_EbEOT_.isra.0.cold |
| 34 | ····31:·00033c80···716·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES5_St9_IdentityIS5_ESt4lessIS5_ESaIS5_EE8_M_eraseEPSt13_Rb_tree_nodeIS5_E.isra.0 | ||
| 34 | ····3 | 35 | ····32:·00033f50···716·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_jESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE8_M_eraseEPSt13_Rb_tree_nodeIS8_E.isra.0 |
| 35 | ····3 | 36 | ····33:·00034220···247·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_jESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE7_M_copyILb0ENSE_11_Alloc_nodeEEEPSt13_Rb_tree_nodeIS8_ESJ_PSt18_Rb_tree_node_baseRT0_.isra.0 |
| 36 | ····3 | 37 | ····34:·0001f28a···140·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_jESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE7_M_copyILb0ENSE_11_Alloc_nodeEEEPSt13_Rb_tree_nodeIS8_ESJ_PSt18_Rb_tree_node_baseRT0_.isra.0.cold |
| 37 | ····34:·00034200···716·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES5_St9_IdentityIS5_ESt4lessIS5_ESaIS5_EE8_M_eraseEPSt13_Rb_tree_nodeIS5_E.isra.0 | ||
| 38 | ····35:·0001f31 | 38 | ····35:·0001f316····63·FUNC····LOCAL··DEFAULT···14·_ZN15BAMWalkerEngine14SaveAlignmentsEP9Alignment.cold |
| 39 | ····36:·0001f35 | 39 | ····36:·0001f356···116·FUNC····LOCAL··DEFAULT···14·_ZN15BAMWalkerEngine25RequestReadProcessingTaskERP9Alignment.cold |
| 40 | ····37:·0001f3c | 40 | ····37:·0001f3ca····21·FUNC····LOCAL··DEFAULT···14·_ZN15BAMWalkerEngine28FinishPositionProcessingTaskERSt14_List_iteratorI18PositionInProgressE.cold |
| 41 | ····38:·0001f3 | 41 | ····38:·0001f3e0···198·FUNC····LOCAL··DEFAULT···14·_ZN15BAMWalkerEngineC2Ev.cold |
| 42 | ····39:·0001f4a | 42 | ····39:·0001f4a6···148·FUNC····LOCAL··DEFAULT···14·_ZN15BAMWalkerEngine14InitializeBAMsERK15ReferenceReaderRKSt6vectorINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS9_EE.cold |
| 43 | ····40:·0001f53 | 43 | ····40:·0001f53a····60·FUNC····LOCAL··DEFAULT···14·_ZN15BAMWalkerEngine10InitializeERK15ReferenceReaderR14TargetsManagerRKSt6vectorINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaISB_EERKSB_i.cold |
| 44 | ····41:·00029 | 44 | ····41:·00029410····56·FUNC····LOCAL··DEFAULT···14·_GLOBAL__sub_I__ZN15BAMWalkerEngineC2Ev |
| 45 | ····42:·0012 | 45 | ····42:·0012d978·····1·OBJECT··LOCAL··DEFAULT···26·_ZStL8__ioinit |
| 46 | ····43:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·SampleManager.cpp | 46 | ····43:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·SampleManager.cpp |
| 47 | ····44:·0003c | 47 | ····44:·0003ca00···117·FUNC····LOCAL··DEFAULT···14·_ZSt4endlIcSt11char_traitsIcEERSt13basic_ostreamIT_T0_ES6_.isra.0 |
| 48 | ····45:·0003c | 48 | ····45:·0003ca80···167·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12_M_constructIPcEEvT_S7_St20forward_iterator_tag.isra.0 |
| 49 | ····46:·0001f57 | 49 | ····46:·0001f576····37·FUNC····LOCAL··DEFAULT···14·_ZNK13SampleManager14IdentifySampleERKN8BamTools12BamAlignmentERiRb.cold |
| 50 | ····47:·0003 | 50 | ····47:·0003cdc0···945·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_iESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE22_M_emplace_hint_uniqueIJRKSt21piecewise_construct_tSt5tupleIJRS7_EESJ_IJEEEEESt17_Rb_tree_iteratorIS8_ESt23_Rb_tree_const_iteratorIS8_EDpOT_.isra.0 |
| 51 | ····48:·0001f59 | 51 | ····48:·0001f59c····51·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_iESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE22_M_emplace_hint_uniqueIJRKSt21piecewise_construct_tSt5tupleIJRS7_EESJ_IJEEEEESt17_Rb_tree_iteratorIS8_ESt23_Rb_tree_const_iteratorIS8_EDpOT_.isra.0.cold |
| 52 | ····49:·0001f5 | 52 | ····49:·0001f5d0····22·FUNC····LOCAL··DEFAULT···14·_ZN13SampleManager10InitializeERKN8BamTools9SamHeaderERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERKS9_.cold |
| 53 | ····50:·00029 | 53 | ····50:·00029490····56·FUNC····LOCAL··DEFAULT···14·_GLOBAL__sub_I__ZN13SampleManager10InitializeERKN8BamTools9SamHeaderERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERKS9_ |
| 54 | ····51:·0012 | 54 | ····51:·0012d97a·····1·OBJECT··LOCAL··DEFAULT···26·_ZStL8__ioinit |
| 55 | ····52:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·TargetsManager.cpp | 55 | ····52:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·TargetsManager.cpp |
| 56 | ····53:·0003 | 56 | ····53:·0003ddb0···117·FUNC····LOCAL··DEFAULT···14·_ZSt4endlIcSt11char_traitsIcEERSt13basic_ostreamIT_T0_ES6_.isra.0 |
| 57 | ····54:·0003 | 57 | ····54:·0003de30···167·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12_M_constructIPcEEvT_S7_St20forward_iterator_tag.isra.0 |
| 58 | ····55:·0001f5e | 58 | ····55:·0001f5e6···103·FUNC····LOCAL··DEFAULT···14·_ZN14TargetsManager12AddExtraTrimERNS_14UnmergedTargetEPci.cold |
| 59 | ····56:·0001f64 | 59 | ····56:·0001f64e····69·FUNC····LOCAL··DEFAULT···14·_ZN14TargetsManager14LoadRawTargetsERK15ReferenceReaderRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERNS3_4listINS_14UnmergedTargetESaISC_EEE.cold |
| 60 | ····57:·0001f69 | 60 | ····57:·0001f694···448·FUNC····LOCAL··DEFAULT···14·_ZNK14TargetsManager19TrimAmpliseqPrimersEP9Alignmenti.cold |
| 61 | ····58:·0001f85 | 61 | ····58:·0001f854···183·FUNC····LOCAL··DEFAULT···14·_ZN14TargetsManager10InitializeERK15ReferenceReaderRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEb.cold |
| 62 | ····59:·00029 | 62 | ····59:·000294d0····56·FUNC····LOCAL··DEFAULT···14·_GLOBAL__sub_I__ZN14TargetsManagerC2Ev |
| 63 | ····60:·0012 | 63 | ····60:·0012d97b·····1·OBJECT··LOCAL··DEFAULT···26·_ZStL8__ioinit |
| 64 | ····61:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·HandleVariant.cpp | 64 | ····61:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·HandleVariant.cpp |
| 65 | ····62:·0001f | 65 | ····62:·0001f90c····54·FUNC····LOCAL··DEFAULT···14·_ZN4armaL19arma_stop_bad_allocIA39_cEEvRKT_.constprop.0 |
| 66 | ····63:·00042 | 66 | ····63:·00042020···167·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12_M_constructIPKcEEvT_S8_St20forward_iterator_tag.isra.0 |
| 67 | ····64:·0001f9 | 67 | ····64:·0001f942···290·FUNC····LOCAL··DEFAULT···14·_ZN4armaL21arma_stop_logic_errorIPKcEEvRKT_ |
| 68 | ····65:·00042 | 68 | ····65:·00042380···166·FUNC····LOCAL··DEFAULT···14·_ZNSt6vectorINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS5_EE12emplace_backIJS5_EEERS5_DpOT_.isra.0 |
| 69 | ····66:·00042 | 69 | ····66:·00042430··1045·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_St6vectorIS5_SaIS5_EEESt10_Select1stISB_ESt4lessIS5_ESaISB_EE22_M_emplace_hint_uniqueIJRKSt21piecewise_construct_tSt5tupleIJOS5_EESM_IJEEEEESt17_Rb_tree_iteratorISB_ESt23_Rb_tree_const_iteratorISB_EDpOT_.isra.0 |
| 70 | ····67:·0001fa | 70 | ····67:·0001fa64···252·FUNC····LOCAL··DEFAULT···14·_Z31SummarizeInfoFieldsFromEnsembleR12EnsembleEvalRN3vcf7VariantEi.cold |
| 71 | ····68:·0001fb | 71 | ····68:·0001fb60···173·FUNC····LOCAL··DEFAULT···14·_Z17GlueOutputVariantR12EnsembleEvalR16VariantCandidateRK16ExtendParametersi.cold |
| 72 | ····69:·0001f | 72 | ····69:·0001fc0e···149·FUNC····LOCAL··DEFAULT···14·_ZN12EnsembleEval22SpliceAllelesIntoReadsER23PersistingThreadObjectsRK15InputStructuresRK16ExtendParametersRK15ReferenceReaderi.cold |
| 73 | ····70:·0001fc | 73 | ····70:·0001fca3····23·FUNC····LOCAL··DEFAULT···14·_Z25EnsembleProcessOneVariantR23PersistingThreadObjectsR20VariantCallerContextR16VariantCandidateRK18PositionInProgress.cold |
| 74 | ····71:·00029 | 74 | ····71:·00029510····87·FUNC····LOCAL··DEFAULT···14·_GLOBAL__sub_I__ZN12EnsembleEval22SpliceAllelesIntoReadsER23PersistingThreadObjectsRK15InputStructuresRK16ExtendParametersRK15ReferenceReaderi |
| 75 | ····72:·0012 | 75 | ····72:·0012d97c·····1·OBJECT··LOCAL··DEFAULT···26·_ZStL8__ioinit |
| 76 | ····73:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·HotspotReader.cpp | 76 | ····73:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·HotspotReader.cpp |
| 77 | ····74:·00049 | 77 | ····74:·00049290···117·FUNC····LOCAL··DEFAULT···14·_ZSt4endlIcSt11char_traitsIcEERSt13basic_ostreamIT_T0_ES6_.isra.0 |
| 78 | ····75:·00049 | 78 | ····75:·00049310···167·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12_M_constructIPcEEvT_S7_St20forward_iterator_tag.isra.0 |
| 79 | ····76:·00049 | 79 | ····76:·000493c0···188·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_St6vectorIS5_SaIS5_EEESt10_Select1stISB_ESt4lessIS5_ESaISB_EE8_M_eraseEPSt13_Rb_tree_nodeISB_E.isra.0 |
| 80 | ····77:·00049 | 80 | ····77:·00049480···716·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_bESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE8_M_eraseEPSt13_Rb_tree_nodeIS8_E.isra.0 |
| 81 | ····78:·00049 | 81 | ····78:·00049750···294·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_St3mapIS5_St6vectorIS5_SaIS5_EESt4lessIS5_ESaIS6_IS7_SB_EEEESt10_Select1stISH_ESD_SaISH_EE8_M_eraseEPSt13_Rb_tree_nodeISH_E.isra.0 |
| 82 | ····79:·00049 | 82 | ····79:·00049880···716·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_N3vcf16VariantFieldTypeEESt10_Select1stISA_ESt4lessIS5_ESaISA_EE8_M_eraseEPSt13_Rb_tree_nodeISA_E.isra.0 |
| 83 | ····80:·0004 | 83 | ····80:·00049b50···716·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_iESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE8_M_eraseEPSt13_Rb_tree_nodeIS8_E.isra.0 |
| 84 | ····81:·0001fc | 84 | ····81:·0001fcba····24·FUNC····LOCAL··DEFAULT···14·_ZN13HotspotReaderD2Ev.cold |
| 85 | ····82:·0001fc | 85 | ····82:·0001fcd2···402·FUNC····LOCAL··DEFAULT···14·_ZN13HotspotReaderC2Ev.cold |
| 86 | ····83:·0001fe | 86 | ····83:·0001fe64···252·FUNC····LOCAL··DEFAULT···14·_ZN13HotspotReader13MakeHintQueueERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE.cold |
| 87 | ····84:·0004 | 87 | ····84:·0004adc0··1045·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_St6vectorIS5_SaIS5_EEESt10_Select1stISB_ESt4lessIS5_ESaISB_EE22_M_emplace_hint_uniqueIJRKSt21piecewise_construct_tSt5tupleIJOS5_EESM_IJEEEEESt17_Rb_tree_iteratorISB_ESt23_Rb_tree_const_iteratorISB_EDpOT_.isra.0 |
| 88 | ····85:·0001ff | 88 | ····85:·0001ff60···259·FUNC····LOCAL··DEFAULT···14·_ZN13HotspotReader16FetchNextVariantEv.cold |
| 89 | ····86:·000200 | 89 | ····86:·00020064····71·FUNC····LOCAL··DEFAULT···14·_ZN13HotspotReader10InitializeERK15ReferenceReaderRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE.cold |
| 90 | ····87:·00029 | 90 | ····87:·00029570····56·FUNC····LOCAL··DEFAULT···14·_GLOBAL__sub_I__ZN13HotspotReaderC2Ev |
| 91 | ····88:·0012 | 91 | ····88:·0012d97d·····1·OBJECT··LOCAL··DEFAULT···26·_ZStL8__ioinit |
| 92 | ····89:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·MetricsManager.cpp | 92 | ····89:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·MetricsManager.cpp |
| 93 | ····90:·000200 | 93 | ····90:·000200ac···504·FUNC····LOCAL··DEFAULT···14·_ZN14MetricsManager15FinalizeAndSaveERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE.cold |
| 94 | ····91:·00029 | 94 | ····91:·000295b0····56·FUNC····LOCAL··DEFAULT···14·_GLOBAL__sub_I__ZN14MetricsManager14NewAccumulatorEv |
| 95 | ····92:·0012 | 95 | ····92:·0012d97e·····1·OBJECT··LOCAL··DEFAULT···26·_ZStL8__ioinit |
| 96 | ····93:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·MiscUtil.cpp | 96 | ····93:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·MiscUtil.cpp |
| 97 | ····94:·0004f | 97 | ····94:·0004f7f8·····0·NOTYPE··LOCAL··DEFAULT···14·.L25 |
| 98 | ····95:·0004f | 98 | ····95:·0004f828·····0·NOTYPE··LOCAL··DEFAULT···14·.L35 |
| 99 | ····96:·0004f | 99 | ····96:·0004f998·····0·NOTYPE··LOCAL··DEFAULT···14·.L54 |
| 100 | ····97:·0004f | 100 | ····97:·0004fa88·····0·NOTYPE··LOCAL··DEFAULT···14·.L73 |
| 101 | ····98:·000202 | 101 | ····98:·000202a4···271·FUNC····LOCAL··DEFAULT···14·_Z11intToStringB5cxx11ii.cold |
| 102 | ····99:·00029 | 102 | ····99:·000295f0····56·FUNC····LOCAL··DEFAULT···14·_GLOBAL__sub_I__Z13NucComplementc |
| 103 | ···100:·0012 | 103 | ···100:·0012d97f·····1·OBJECT··LOCAL··DEFAULT···26·_ZStL8__ioinit |
| 104 | ···101:·0004f | 104 | ···101:·0004f71d·····0·NOTYPE··LOCAL··DEFAULT···14·.L1 |
| 105 | ···102:·0004f | 105 | ···102:·0004f718·····0·NOTYPE··LOCAL··DEFAULT···14·.L12 |
| 106 | ···103:·0004f | 106 | ···103:·0004f780·····0·NOTYPE··LOCAL··DEFAULT···14·.L10 |
| 107 | ···104:·0004f | 107 | ···104:·0004f730·····0·NOTYPE··LOCAL··DEFAULT···14·.L9 |
| 108 | ···105:·0004f | 108 | ···105:·0004f740·····0·NOTYPE··LOCAL··DEFAULT···14·.L8 |
| 109 | ···106:·0004f | 109 | ···106:·0004f750·····0·NOTYPE··LOCAL··DEFAULT···14·.L7 |
| 110 | ···107:·0004f | 110 | ···107:·0004f760·····0·NOTYPE··LOCAL··DEFAULT···14·.L6 |
| 111 | ···108:·0004f | 111 | ···108:·0004f770·····0·NOTYPE··LOCAL··DEFAULT···14·.L5 |
| 112 | ···109:·0004f | 112 | ···109:·0004f720·····0·NOTYPE··LOCAL··DEFAULT···14·.L3 |
| 113 | ···110:·0004f | 113 | ···110:·0004f910·····0·NOTYPE··LOCAL··DEFAULT···14·.L39 |
| 114 | ···111:·0004f | 114 | ···111:·0004f930·····0·NOTYPE··LOCAL··DEFAULT···14·.L24 |
| 115 | ···112:·0004f | 115 | ···112:·0004f7f0·····0·NOTYPE··LOCAL··DEFAULT···14·.L23 |
| 116 | ···113:·0004f | 116 | ···113:·0004f880·····0·NOTYPE··LOCAL··DEFAULT···14·.L22 |
| 117 | ···114:·0004f | 117 | ···114:·0004f870·····0·NOTYPE··LOCAL··DEFAULT···14·.L21 |
| 118 | ···115:·0004f | 118 | ···115:·0004f860·····0·NOTYPE··LOCAL··DEFAULT···14·.L20 |
| 119 | ···116:·0004f | 119 | ···116:·0004f8a0·····0·NOTYPE··LOCAL··DEFAULT···14·.L19 |
| 120 | ···117:·0004f | 120 | ···117:·0004f890·····0·NOTYPE··LOCAL··DEFAULT···14·.L17 |
| 121 | ···118:·0004f | 121 | ···118:·0004f900·····0·NOTYPE··LOCAL··DEFAULT···14·.L40 |
| 122 | ···119:·0004f | 122 | ···119:·0004f920·····0·NOTYPE··LOCAL··DEFAULT···14·.L34 |
| Max diff block lines reached; 476086/509284 bytes (93.48%) of diff not shown. | |||
| Offset 1, 8 lines modified | Offset 1, 8 lines modified | ||
| 1 | Displaying·notes·found·in:·.note.gnu.build-id | 1 | Displaying·notes·found·in:·.note.gnu.build-id |
| 2 | ··Owner················Data·size·» Description | 2 | ··Owner················Data·size·» Description |
| 3 | ··GNU··················0x00000014» NT_GNU_BUILD_ID·(unique·build·ID·bitstring)» ····Build·ID:· | 3 | ··GNU··················0x00000014» NT_GNU_BUILD_ID·(unique·build·ID·bitstring)» ····Build·ID:·94b56f66fe5cec5e6f031245f840bcf70e13ee39 |
| 4 | Displaying·notes·found·in:·.note.ABI-tag | 4 | Displaying·notes·found·in:·.note.ABI-tag |
| 5 | ··Owner················Data·size·» Description | 5 | ··Owner················Data·size·» Description |
| 6 | ··GNU··················0x00000010» NT_GNU_ABI_TAG·(ABI·version·tag)» ····OS:·Linux,·ABI:·3.2.0 | 6 | ··GNU··················0x00000010» NT_GNU_ABI_TAG·(ABI·version·tag)» ····OS:·Linux,·ABI:·3.2.0 |
| Offset 1, 15 lines modified | Offset 1, 15 lines modified | ||
| 1 | Raw·dump·of·debug·contents·of·section·.debug_line: | 1 | Raw·dump·of·debug·contents·of·section·.debug_line: |
| 2 | ··Offset:······················0 | 2 | ··Offset:······················0 |
| 3 | ··Length:······················7 | 3 | ··Length:······················72931 |
| 4 | ··DWARF·Version:···············5 | 4 | ··DWARF·Version:···············5 |
| 5 | ··Address·size·(bytes):········4 | 5 | ··Address·size·(bytes):········4 |
| 6 | ··Segment·selector·(bytes):····0 | 6 | ··Segment·selector·(bytes):····0 |
| 7 | ··Prologue·Length:·············117 | 7 | ··Prologue·Length:·············1178 |
| 8 | ··Minimum·Instruction·Length:··1 | 8 | ··Minimum·Instruction·Length:··1 |
| 9 | ··Maximum·Ops·per·Instruction:·1 | 9 | ··Maximum·Ops·per·Instruction:·1 |
| 10 | ··Initial·value·of·'is_stmt':··1 | 10 | ··Initial·value·of·'is_stmt':··1 |
| 11 | ··Line·Base:···················-5 | 11 | ··Line·Base:···················-5 |
| 12 | ··Line·Range:··················14 | 12 | ··Line·Range:··················14 |
| 13 | ··Opcode·Base:·················13 | 13 | ··Opcode·Base:·················13 |
| Offset 32, 19 lines modified | Offset 32, 19 lines modified | ||
| 32 | ··0» (line_strp)» (offset:·0):·./obj-i686-linux-gnu | 32 | ··0» (line_strp)» (offset:·0):·./obj-i686-linux-gnu |
| 33 | ··1» (line_strp)» (offset:·0x37):·./VariantCaller | 33 | ··1» (line_strp)» (offset:·0x37):·./VariantCaller |
| 34 | ··2» (line_strp)» (offset:·0x47):·/usr/include/c++/12/bits | 34 | ··2» (line_strp)» (offset:·0x47):·/usr/include/c++/12/bits |
| 35 | ··3» (line_strp)» (offset:·0x60):·/usr/include/c++/12 | 35 | ··3» (line_strp)» (offset:·0x60):·/usr/include/c++/12 |
| 36 | ··4» (line_strp)» (offset:·0x74):·./Util | 36 | ··4» (line_strp)» (offset:·0x74):·./Util |
| 37 | ··5» (line_strp)» (offset:·0x7b):·./Calibration | 37 | ··5» (line_strp)» (offset:·0x7b):·./Calibration |
| 38 | ··6» (line_strp)» (offset:·0x89):·./external/vcflib | 38 | ··6» (line_strp)» (offset:·0x89):·./external/vcflib |
| 39 | ··7» (line_strp)» (offset:·0x9b):·./realignment | ||
| 40 | ··8» (line_strp)» (offset:·0xa9):·/usr/include/armadillo_bits | ||
| 41 | ·· | 39 | ··7» (line_strp)» (offset:·0x9b):·./VariantCaller/Bookkeeping |
| 40 | ··8» (line_strp)» (offset:·0xb7):·./BaseCaller | ||
| 41 | ··9» (line_strp)» (offset:·0xc4):·./realignment | ||
| 42 | ··10» (line_strp)» (offset:·0xd2):·/usr/include/armadillo_bits | ||
| 42 | ··1 | 43 | ··11» (line_strp)» (offset:·0xee):·./VariantCaller/Bookkeeping/../Splice |
| 43 | ··11» (line_strp)» (offset:·0x107):·./BaseCaller | ||
| 44 | ··12» (line_strp)» (offset:·0x114):·/usr/include/c++/12/ext | 44 | ··12» (line_strp)» (offset:·0x114):·/usr/include/c++/12/ext |
| 45 | ··13» (line_strp)» (offset:·0x12c):·/usr/include/i386-linux-gnu/bits | 45 | ··13» (line_strp)» (offset:·0x12c):·/usr/include/i386-linux-gnu/bits |
| 46 | ··14» (line_strp)» (offset:·0x14d):·/usr/lib/gcc/i686-linux-gnu/12/include | 46 | ··14» (line_strp)» (offset:·0x14d):·/usr/lib/gcc/i686-linux-gnu/12/include |
| 47 | ··15» (line_strp)» (offset:·0x174):·/usr/include/i386-linux-gnu/bits/types | 47 | ··15» (line_strp)» (offset:·0x174):·/usr/include/i386-linux-gnu/bits/types |
| 48 | ··16» (line_strp)» (offset:·0x19b):·/usr/include/i386-linux-gnu/c++/12/bits | 48 | ··16» (line_strp)» (offset:·0x19b):·/usr/include/i386-linux-gnu/c++/12/bits |
| 49 | ··17» (line_strp)» (offset:·0x1c3):·/usr/include/c++/12/debug | 49 | ··17» (line_strp)» (offset:·0x1c3):·/usr/include/c++/12/debug |
| 50 | ··18» (line_strp)» (offset:·0x1dd):·/usr/include | 50 | ··18» (line_strp)» (offset:·0x1dd):·/usr/include |
| Offset 57, 42933 lines modified | Offset 57, 42781 lines modified | ||
| 57 | ··25» (line_strp)» (offset:·0x283):·./external/freebayes/src | 57 | ··25» (line_strp)» (offset:·0x283):·./external/freebayes/src |
| 58 | ··26» (line_strp)» (offset:·0x29c):·./VariantCaller/Filter | 58 | ··26» (line_strp)» (offset:·0x29c):·./VariantCaller/Filter |
| 59 | ··27» (line_strp)» (offset:·0x2b3):·./VariantCaller/Reads | 59 | ··27» (line_strp)» (offset:·0x2b3):·./VariantCaller/Reads |
| 60 | ··28» (line_strp)» (offset:·0x2c9):·./VariantCaller/EnsembleEval | 60 | ··28» (line_strp)» (offset:·0x2c9):·./VariantCaller/EnsembleEval |
| 61 | ··29» (line_strp)» (offset:·0x2e6):·. | 61 | ··29» (line_strp)» (offset:·0x2e6):·. |
| 62 | ··30» (line_strp)» (offset:·0x2e8):·/usr/include/i386-linux-gnu/sys | 62 | ··30» (line_strp)» (offset:·0x2e8):·/usr/include/i386-linux-gnu/sys |
| 63 | ·The·File·Name·Table·(offset·0xa5,·lines·20 | 63 | ·The·File·Name·Table·(offset·0xa5,·lines·205,·columns·2): |
| 64 | ··Entry» Dir» Name | 64 | ··Entry» Dir» Name |
| 65 | ··0» (udata)» 1» (line_strp)» (offset:·0x25):·VariantCaller.cpp | 65 | ··0» (udata)» 1» (line_strp)» (offset:·0x25):·VariantCaller.cpp |
| 66 | ··1» (udata)» 2» (line_strp)» (offset:·0x308):·locale_facets.h | 66 | ··1» (udata)» 2» (line_strp)» (offset:·0x308):·locale_facets.h |
| 67 | ··2» (udata)» 3» (line_strp)» (offset:·0x5 | 67 | ··2» (udata)» 3» (line_strp)» (offset:·0x5d3):·ostream |
| 68 | ··3» (udata)» 2» (line_strp)» (offset:·0x318):·basic_ios.h | 68 | ··3» (udata)» 2» (line_strp)» (offset:·0x318):·basic_ios.h |
| 69 | ··4» (udata)» 2» (line_strp)» (offset:·0x324):·deque.tcc | 69 | ··4» (udata)» 2» (line_strp)» (offset:·0x324):·deque.tcc |
| 70 | ··5» (udata)» 2» (line_strp)» (offset:·0x32e):·alloc_traits.h | 70 | ··5» (udata)» 2» (line_strp)» (offset:·0x32e):·alloc_traits.h |
| 71 | ··6» (udata)» 2» (line_strp)» (offset:·0x33d):·new_allocator.h | 71 | ··6» (udata)» 2» (line_strp)» (offset:·0x33d):·new_allocator.h |
| 72 | ··7» (udata)» 2» (line_strp)» (offset:·0x34d):·stl_deque.h | 72 | ··7» (udata)» 2» (line_strp)» (offset:·0x34d):·stl_deque.h |
| 73 | ··8» (udata)» 2» (line_strp)» (offset:·0x359):·stl_algobase.h | 73 | ··8» (udata)» 2» (line_strp)» (offset:·0x359):·stl_algobase.h |
| 74 | ··9» (udata)» 2» (line_strp)» (offset:·0x7 | 74 | ··9» (udata)» 2» (line_strp)» (offset:·0x7ac):·allocator.h |
| 75 | ··10» (udata)» 2» (line_strp)» (offset:·0x368):·basic_string.tcc | 75 | ··10» (udata)» 2» (line_strp)» (offset:·0x368):·basic_string.tcc |
| 76 | ··11» (udata)» 2» (line_strp)» (offset:·0x379):·stl_iterator_base_funcs.h | 76 | ··11» (udata)» 2» (line_strp)» (offset:·0x379):·stl_iterator_base_funcs.h |
| 77 | ··12» (udata)» 2» (line_strp)» (offset:·0x393):·basic_string.h | 77 | ··12» (udata)» 2» (line_strp)» (offset:·0x393):·basic_string.h |
| 78 | ··13» (udata)» 2» (line_strp)» (offset:·0x3a2):·char_traits.h | 78 | ··13» (udata)» 2» (line_strp)» (offset:·0x3a2):·char_traits.h |
| 79 | ··14» (udata)» 2» (line_strp)» (offset:·0x3b0):·stl_tree.h | 79 | ··14» (udata)» 2» (line_strp)» (offset:·0x3b0):·stl_tree.h |
| 80 | ··15» (udata)» 2» (line_strp)» (offset:·0x3bb):·stl_vector.h | 80 | ··15» (udata)» 2» (line_strp)» (offset:·0x3bb):·stl_vector.h |
| 81 | ··16» (udata)» 2» (line_strp)» (offset:·0x3c8):·stl_pair.h | 81 | ··16» (udata)» 2» (line_strp)» (offset:·0x3c8):·stl_pair.h |
| 82 | ··17» (udata)» 2» (line_strp)» (offset:·0x3d3):·stl_construct.h | 82 | ··17» (udata)» 2» (line_strp)» (offset:·0x3d3):·stl_construct.h |
| 83 | ··18» (udata)» 2» (line_strp)» (offset:·0x3e3):·stl_map.h | 83 | ··18» (udata)» 2» (line_strp)» (offset:·0x3e3):·stl_map.h |
| 84 | ··19» (udata)» 4» (line_strp)» (offset:·0x3ed):·OptArgs.h | 84 | ··19» (udata)» 4» (line_strp)» (offset:·0x3ed):·OptArgs.h |
| 85 | ··20» (udata)» 5» (line_strp)» (offset:·0x3f7):·LinearCalibrationModel.h | 85 | ··20» (udata)» 5» (line_strp)» (offset:·0x3f7):·LinearCalibrationModel.h |
| 86 | ··21» (udata)» 6» (line_strp)» (offset:·0xc | 86 | ··21» (udata)» 6» (line_strp)» (offset:·0xc84):·Variant.h |
| 87 | ··22» (udata)» 3» (line_strp)» (offset:·0x410):·fstream | 87 | ··22» (udata)» 3» (line_strp)» (offset:·0x410):·fstream |
| 88 | ··23» (udata)» 3» (line_strp)» (offset:·0x418):·streambuf | 88 | ··23» (udata)» 3» (line_strp)» (offset:·0x418):·streambuf |
| 89 | ··24» (udata)» 3» (line_strp)» (offset:·0x422):·istream | 89 | ··24» (udata)» 3» (line_strp)» (offset:·0x422):·istream |
| 90 | ··25» (udata)» 1» (line_strp)» (offset:·0x42a):·ReferenceReader.h | 90 | ··25» (udata)» 1» (line_strp)» (offset:·0x42a):·ReferenceReader.h |
| 91 | ··26» (udata)» 7» (line_strp)» (offset:·0x43c):·InputStructures.h | ||
| 92 | ··27» (udata)» 8» (line_strp)» (offset:·0x44e):·TreephaserSSE.h | ||
| 93 | ··28» (udata)» 8» (line_strp)» (offset:·0x45e):·BaseCallerUtils.h | ||
| 94 | ··29» (udata)» 8» (line_strp)» (offset:·0x470):·DPTreephaser.h | ||
| 91 | ·· | 95 | ··30» (udata)» 9» (line_strp)» (offset:·0x47f):·Realigner.h |
| 92 | ·· | 96 | ··31» (udata)» 1» (line_strp)» (offset:·0x48b):·SampleManager.h |
| 93 | ·· | 97 | ··32» (udata)» 1» (line_strp)» (offset:·0x49b):·OrderedVCFWriter.h |
| 94 | ·· | 98 | ··33» (udata)» 2» (line_strp)» (offset:·0x4ae):·ios_base.h |
| 95 | ··3 | 99 | ··34» (udata)» 1» (line_strp)» (offset:·0x25):·VariantCaller.cpp |
| 96 | ··3 | 100 | ··35» (udata)» 10» (line_strp)» (offset:·0x4b9):·debug.hpp |
| 97 | ··3 | 101 | ··36» (udata)» 7» (line_strp)» (offset:·0x4c3):·ExtendParameters.h |
| 98 | ··33» (udata)» 9» (line_strp)» (offset:·0x493):·InputStructures.h | ||
| 99 | ··3 | 102 | ··37» (udata)» 2» (line_strp)» (offset:·0x4d6):·stl_multimap.h |
| 100 | ··3 | 103 | ··38» (udata)» 11» (line_strp)» (offset:·0x4e5):·ErrorMotifs.h |
| 101 | ··36» (udata)» 11» (line_strp)» (offset:·0x4c2):·BaseCallerUtils.h | ||
| 102 | ··3 | 104 | ··39» (udata)» 12» (line_strp)» (offset:·0x32e):·alloc_traits.h |
| 103 | ··38» (udata)» 11» (line_strp)» (offset:·0x4d4):·DPTreephaser.h | ||
| 104 | ·· | 105 | ··40» (udata)» 2» (line_strp)» (offset:·0x4f3):·vector.tcc |
| 105 | ··4 | 106 | ··41» (udata)» 2» (line_strp)» (offset:·0x4fe):·stl_iterator.h |
| 106 | ··4 | 107 | ··42» (udata)» 2» (line_strp)» (offset:·0x50d):·stl_uninitialized.h |
| 107 | ··4 | 108 | ··43» (udata)» 2» (line_strp)» (offset:·0x521):·list.tcc |
| 108 | ··4 | 109 | ··44» (udata)» 2» (line_strp)» (offset:·0x52a):·stl_list.h |
| 109 | ··4 | 110 | ··45» (udata)» 2» (line_strp)» (offset:·0x535):·move.h |
| 110 | ··4 | 111 | ··46» (udata)» 2» (line_strp)» (offset:·0x53c):·stl_function.h |
| 111 | ··4 | 112 | ··47» (udata)» 13» (line_strp)» (offset:·0x54b):·fcntl2.h |
| 112 | ··4 | 113 | ··48» (udata)» 13» (line_strp)» (offset:·0x554):·stdio2.h |
| 113 | ··4 | 114 | ··49» (udata)» 3» (line_strp)» (offset:·0x55d):·tuple |
| 114 | ·· | 115 | ··50» (udata)» 2» (line_strp)» (offset:·0x563):·stl_heap.h |
| 115 | ··5 | 116 | ··51» (udata)» 2» (line_strp)» (offset:·0x56e):·predefined_ops.h |
| 116 | ··5 | 117 | ··52» (udata)» 1» (line_strp)» (offset:·0x57f):·OrderedBAMWriter.h |
| 117 | ··5 | 118 | ··53» (udata)» 2» (line_strp)» (offset:·0x592):·stl_queue.h |
| 118 | ··5 | 119 | ··54» (udata)» 1» (line_strp)» (offset:·0x59e):·BAMWalkerEngine.h |
| 119 | ··5 | 120 | ··55» (udata)» 1» (line_strp)» (offset:·0x5b0):·MetricsManager.h |
| 120 | ··5 | 121 | ··56» (udata)» 12» (line_strp)» (offset:·0x5c1):·aligned_buffer.h |
| 121 | ··5 | 122 | ··57» (udata)» 3» (line_strp)» (offset:·0x5d2):·iostream |
| 122 | ··5 | 123 | ··58» (udata)» 10» (line_strp)» (offset:·0x5db):·fill.hpp |
| 123 | ··5 | 124 | ··59» (udata)» 10» (line_strp)» (offset:·0x5e4):·hdf5_name.hpp |
| 124 | ·· | 125 | ··60» (udata)» 10» (line_strp)» (offset:·0x5f2):·csv_name.hpp |
| 125 | ··6 | 126 | ··61» (udata)» 10» (line_strp)» (offset:·0x5ff):·op_inv_gen_bones.hpp |
| 126 | ··6 | 127 | ··62» (udata)» 10» (line_strp)» (offset:·0x614):·glue_solve_bones.hpp |
| 127 | ··6 | 128 | ··63» (udata)» 10» (line_strp)» (offset:·0x629):·gmm_misc_bones.hpp |
| 128 | ··6 | 129 | ··64» (udata)» 10» (line_strp)» (offset:·0x63c):·constants.hpp |
| 129 | ··6 | 130 | ··65» (udata)» 14» (line_strp)» (offset:·0x64a):·stddef.h |
| 130 | ··6 | 131 | ··66» (udata)» 14» (line_strp)» (offset:·0x653):·stdarg.h |
| 131 | ··6 | 132 | ··67» (udata)» 15» (line_strp)» (offset:·0x65c):·wint_t.h |
| 132 | ··6 | 133 | ··68» (udata)» 15» (line_strp)» (offset:·0x665):·__mbstate_t.h |
| 133 | ··6 | 134 | ··69» (udata)» 15» (line_strp)» (offset:·0x667):·mbstate_t.h |
| 134 | ·· | 135 | ··70» (udata)» 15» (line_strp)» (offset:·0x673):·__FILE.h |
| 135 | ··7 | 136 | ··71» (udata)» 15» (line_strp)» (offset:·0x67c):·struct_FILE.h |
| 136 | ··7 | 137 | ··72» (udata)» 15» (line_strp)» (offset:·0x675):·FILE.h |
| 137 | ··7 | 138 | ··73» (udata)» 3» (line_strp)» (offset:·0x68a):·cwchar |
| 138 | ··7 | 139 | ··74» (udata)» 3» (line_strp)» (offset:·0x691):·type_traits |
| 139 | ··7 | 140 | ··75» (udata)» 16» (line_strp)» (offset:·0x69d):·c++config.h |
| Max diff block lines reached; 92480403/92505708 bytes (99.97%) of diff not shown. | |||
| Offset 1, 4194304 lines modified | Offset 1, 4194304 lines modified | ||
| 1 | Contents·of·the·.debug_info·section: | 1 | Contents·of·the·.debug_info·section: |
| 2 | ··Compilation·Unit·@·offset·0: | 2 | ··Compilation·Unit·@·offset·0: |
| 3 | ···Length:········0x14·(32-bit) | 3 | ···Length:········0x14·(32-bit) |
| 4 | ···Version:·······5 | 4 | ···Version:·······5 |
| 5 | ···Unit·Type:·····DW_UT_partial·(3) | 5 | ···Unit·Type:·····DW_UT_partial·(3) |
| 6 | ···Abbrev·Offset:·0x | 6 | ···Abbrev·Offset:·0xebef |
| 7 | ···Pointer·Size:··4 | 7 | ···Pointer·Size:··4 |
| 8 | ·<0><c>:·Abbrev·Number:· | 8 | ·<0><c>:·Abbrev·Number:·125·(DW_TAG_partial_unit) |
| 9 | ·<1><d>:·Abbrev·Number:· | 9 | ·<1><d>:·Abbrev·Number:·10·(DW_TAG_imported_unit) |
| 10 | ····<e>···DW_AT_import······:·(GNU_ref_alt)·<0xa5 | 10 | ····<e>···DW_AT_import······:·(GNU_ref_alt)·<0xa51f7> |
| 11 | ·<1><12>:·Abbrev·Number:· | 11 | ·<1><12>:·Abbrev·Number:·10·(DW_TAG_imported_unit) |
| 12 | ····<13>···DW_AT_import······:·(GNU_ref_alt)·<0x221> | 12 | ····<13>···DW_AT_import······:·(GNU_ref_alt)·<0x221> |
| 13 | ·<1><17>:·Abbrev·Number:·0 | 13 | ·<1><17>:·Abbrev·Number:·0 |
| 14 | ··Compilation·Unit·@·offset·0x18: | 14 | ··Compilation·Unit·@·offset·0x18: |
| 15 | ···Length:········0x14·(32-bit) | 15 | ···Length:········0x14·(32-bit) |
| 16 | ···Version:·······5 | 16 | ···Version:·······5 |
| 17 | ···Unit·Type:·····DW_UT_partial·(3) | 17 | ···Unit·Type:·····DW_UT_partial·(3) |
| 18 | ···Abbrev·Offset:·0x | 18 | ···Abbrev·Offset:·0xebef |
| 19 | ···Pointer·Size:··4 | 19 | ···Pointer·Size:··4 |
| 20 | ·<0><24>:·Abbrev·Number:· | 20 | ·<0><24>:·Abbrev·Number:·125·(DW_TAG_partial_unit) |
| 21 | ·<1><25>:·Abbrev·Number:· | 21 | ·<1><25>:·Abbrev·Number:·10·(DW_TAG_imported_unit) |
| 22 | ····<26>···DW_AT_import······:·(GNU_ref_alt)·<0xa5 | 22 | ····<26>···DW_AT_import······:·(GNU_ref_alt)·<0xa5b20> |
| 23 | ·<1><2a>:·Abbrev·Number:· | 23 | ·<1><2a>:·Abbrev·Number:·10·(DW_TAG_imported_unit) |
| 24 | ····<2b>···DW_AT_import······:·(GNU_ref_alt)·<0xa5 | 24 | ····<2b>···DW_AT_import······:·(GNU_ref_alt)·<0xa5b3d> |
| 25 | ·<1><2f>:·Abbrev·Number:·0 | 25 | ·<1><2f>:·Abbrev·Number:·0 |
| 26 | ··Compilation·Unit·@·offset·0x30: | 26 | ··Compilation·Unit·@·offset·0x30: |
| 27 | ···Length:········0x1c·(32-bit) | 27 | ···Length:········0x1c·(32-bit) |
| 28 | ···Version:·······5 | 28 | ···Version:·······5 |
| 29 | ···Unit·Type:·····DW_UT_partial·(3) | 29 | ···Unit·Type:·····DW_UT_partial·(3) |
| 30 | ···Abbrev·Offset:·0 | 30 | ···Abbrev·Offset:·0 |
| 31 | ···Pointer·Size:··4 | 31 | ···Pointer·Size:··4 |
| 32 | ·<0><3c>:·Abbrev·Number:·2·(DW_TAG_partial_unit) | 32 | ·<0><3c>:·Abbrev·Number:·2·(DW_TAG_partial_unit) |
| 33 | ····<3d>···DW_AT_stmt_list···:·(sec_offset)·0 | 33 | ····<3d>···DW_AT_stmt_list···:·(sec_offset)·0 |
| 34 | ····<41>···DW_AT_comp_dir····:·(line_strp)·(offset:·0):·./obj-i686-linux-gnu | 34 | ····<41>···DW_AT_comp_dir····:·(line_strp)·(offset:·0):·./obj-i686-linux-gnu |
| 35 | ·<1><45>:·Abbrev·Number:· | 35 | ·<1><45>:·Abbrev·Number:·18·(DW_TAG_imported_unit) |
| 36 | ····<46>···DW_AT_import······:·(GNU_ref_alt)·<0x323> | 36 | ····<46>···DW_AT_import······:·(GNU_ref_alt)·<0x323> |
| 37 | ·<1><4a>:·Abbrev·Number:· | 37 | ·<1><4a>:·Abbrev·Number:·18·(DW_TAG_imported_unit) |
| 38 | ····<4b>···DW_AT_import······:·(GNU_ref_alt)·<0x1555> | 38 | ····<4b>···DW_AT_import······:·(GNU_ref_alt)·<0x1555> |
| 39 | ·<1><4f>:·Abbrev·Number:·0 | 39 | ·<1><4f>:·Abbrev·Number:·0 |
| 40 | ··Compilation·Unit·@·offset·0x50: | 40 | ··Compilation·Unit·@·offset·0x50: |
| 41 | ···Length:········0x1b·(32-bit) | 41 | ···Length:········0x1b·(32-bit) |
| 42 | ···Version:·······5 | 42 | ···Version:·······5 |
| 43 | ···Unit·Type:·····DW_UT_partial·(3) | 43 | ···Unit·Type:·····DW_UT_partial·(3) |
| 44 | ···Abbrev·Offset:·0 | 44 | ···Abbrev·Offset:·0 |
| 45 | ···Pointer·Size:··4 | 45 | ···Pointer·Size:··4 |
| 46 | ·<0><5c>:·Abbrev·Number:·2·(DW_TAG_partial_unit) | 46 | ·<0><5c>:·Abbrev·Number:·2·(DW_TAG_partial_unit) |
| 47 | ····<5d>···DW_AT_stmt_list···:·(sec_offset)·0 | 47 | ····<5d>···DW_AT_stmt_list···:·(sec_offset)·0 |
| 48 | ····<61>···DW_AT_comp_dir····:·(line_strp)·(offset:·0):·./obj-i686-linux-gnu | 48 | ····<61>···DW_AT_comp_dir····:·(line_strp)·(offset:·0):·./obj-i686-linux-gnu |
| 49 | ·<1><65>:·Abbrev·Number:· | 49 | ·<1><65>:·Abbrev·Number:·32·(DW_TAG_variable) |
| 50 | ····<66>···DW_AT_name········:·(GNU_strp_alt)·(offset:·0xc3594)· | 50 | ····<66>···DW_AT_name········:·(GNU_strp_alt)·(offset:·0xc3594)· |
| 51 | ····<6a>···DW_AT_type········:·(GNU_ref_alt)·<0x1da> | 51 | ····<6a>···DW_AT_type········:·(GNU_ref_alt)·<0x1da> |
| 52 | ····<6e>···DW_AT_external····:·(flag_present)·1 | 52 | ····<6e>···DW_AT_external····:·(flag_present)·1 |
| 53 | ····<6e>···DW_AT_artificial··:·(flag_present)·1 | 53 | ····<6e>···DW_AT_artificial··:·(flag_present)·1 |
| 54 | ····<6e>···DW_AT_declaration·:·(flag_present)·1 | 54 | ····<6e>···DW_AT_declaration·:·(flag_present)·1 |
| 55 | ·<1><6e>:·Abbrev·Number:·0 | 55 | ·<1><6e>:·Abbrev·Number:·0 |
| 56 | ··Compilation·Unit·@·offset·0x6f: | 56 | ··Compilation·Unit·@·offset·0x6f: |
| 57 | ···Length:········0x1b·(32-bit) | 57 | ···Length:········0x1b·(32-bit) |
| 58 | ···Version:·······5 | 58 | ···Version:·······5 |
| 59 | ···Unit·Type:·····DW_UT_partial·(3) | 59 | ···Unit·Type:·····DW_UT_partial·(3) |
| 60 | ···Abbrev·Offset:·0 | 60 | ···Abbrev·Offset:·0 |
| 61 | ···Pointer·Size:··4 | 61 | ···Pointer·Size:··4 |
| 62 | ·<0><7b>:·Abbrev·Number:·2·(DW_TAG_partial_unit) | 62 | ·<0><7b>:·Abbrev·Number:·2·(DW_TAG_partial_unit) |
| 63 | ····<7c>···DW_AT_stmt_list···:·(sec_offset)·0 | 63 | ····<7c>···DW_AT_stmt_list···:·(sec_offset)·0 |
| 64 | ····<80>···DW_AT_comp_dir····:·(line_strp)·(offset:·0):·./obj-i686-linux-gnu | 64 | ····<80>···DW_AT_comp_dir····:·(line_strp)·(offset:·0):·./obj-i686-linux-gnu |
| 65 | ·<1><84>:·Abbrev·Number:· | 65 | ·<1><84>:·Abbrev·Number:·21·(DW_TAG_subprogram) |
| 66 | ····<85>···DW_AT_external····:·(flag_present)·1 | 66 | ····<85>···DW_AT_external····:·(flag_present)·1 |
| 67 | ····<85>···DW_AT_declaration·:·(flag_present)·1 | 67 | ····<85>···DW_AT_declaration·:·(flag_present)·1 |
| 68 | ····<85>···DW_AT_linkage_name:·(GNU_strp_alt)·(offset:·0xe0cc7)· | 68 | ····<85>···DW_AT_linkage_name:·(GNU_strp_alt)·(offset:·0xe0cc7)· |
| 69 | ····<89>···DW_AT_name········:·(GNU_strp_alt)·(offset:·0xe0cc7)· | 69 | ····<89>···DW_AT_name········:·(GNU_strp_alt)·(offset:·0xe0cc7)· |
| 70 | ·<1><8d>:·Abbrev·Number:·0 | 70 | ·<1><8d>:·Abbrev·Number:·0 |
| 71 | ··Compilation·Unit·@·offset·0x8e: | 71 | ··Compilation·Unit·@·offset·0x8e: |
| 72 | ···Length:········0x21·(32-bit) | 72 | ···Length:········0x21·(32-bit) |
| 73 | ···Version:·······5 | 73 | ···Version:·······5 |
| 74 | ···Unit·Type:·····DW_UT_partial·(3) | 74 | ···Unit·Type:·····DW_UT_partial·(3) |
| 75 | ···Abbrev·Offset:·0 | 75 | ···Abbrev·Offset:·0 |
| 76 | ···Pointer·Size:··4 | 76 | ···Pointer·Size:··4 |
| 77 | ·<0><9a>:·Abbrev·Number:·2·(DW_TAG_partial_unit) | 77 | ·<0><9a>:·Abbrev·Number:·2·(DW_TAG_partial_unit) |
| 78 | ····<9b>···DW_AT_stmt_list···:·(sec_offset)·0 | 78 | ····<9b>···DW_AT_stmt_list···:·(sec_offset)·0 |
| 79 | ····<9f>···DW_AT_comp_dir····:·(line_strp)·(offset:·0):·./obj-i686-linux-gnu | 79 | ····<9f>···DW_AT_comp_dir····:·(line_strp)·(offset:·0):·./obj-i686-linux-gnu |
| 80 | ·<1><a3>:·Abbrev·Number:· | 80 | ·<1><a3>:·Abbrev·Number:·18·(DW_TAG_imported_unit) |
| 81 | ····<a4>···DW_AT_import······:·(GNU_ref_alt)·<0x18 | 81 | ····<a4>···DW_AT_import······:·(GNU_ref_alt)·<0x18d7> |
| 82 | ·<1><a8>:·Abbrev·Number:· | 82 | ·<1><a8>:·Abbrev·Number:·18·(DW_TAG_imported_unit) |
| 83 | ····<a9>···DW_AT_import······:·(GNU_ref_alt)·<0x1a | 83 | ····<a9>···DW_AT_import······:·(GNU_ref_alt)·<0x1a6c> |
| 84 | ·<1><ad>:·Abbrev·Number:· | 84 | ·<1><ad>:·Abbrev·Number:·18·(DW_TAG_imported_unit) |
| 85 | ····<ae>···DW_AT_import······:·(GNU_ref_alt)·<0x1a | 85 | ····<ae>···DW_AT_import······:·(GNU_ref_alt)·<0x1ac7> |
| 86 | ·<1><b2>:·Abbrev·Number:·0 | 86 | ·<1><b2>:·Abbrev·Number:·0 |
| 87 | ··Compilation·Unit·@·offset·0xb3: | 87 | ··Compilation·Unit·@·offset·0xb3: |
| 88 | ···Length:········0x1f·(32-bit) | 88 | ···Length:········0x1f·(32-bit) |
| 89 | ···Version:·······5 | 89 | ···Version:·······5 |
| 90 | ···Unit·Type:·····DW_UT_partial·(3) | 90 | ···Unit·Type:·····DW_UT_partial·(3) |
| 91 | ···Abbrev·Offset:·0x | 91 | ···Abbrev·Offset:·0x933 |
| 92 | ···Pointer·Size:··4 | 92 | ···Pointer·Size:··4 |
| 93 | ·<0><bf>:·Abbrev·Number:·4 | 93 | ·<0><bf>:·Abbrev·Number:·41·(DW_TAG_partial_unit) |
| 94 | ····<c0>···DW_AT_stmt_list···:·(sec_offset)·0 | 94 | ····<c0>···DW_AT_stmt_list···:·(sec_offset)·0 |
| 95 | ····<c4>···DW_AT_comp_dir····:·(line_strp)·(offset:·0):·./obj-i686-linux-gnu | 95 | ····<c4>···DW_AT_comp_dir····:·(line_strp)·(offset:·0):·./obj-i686-linux-gnu |
| 96 | ·<1><c8>:·Abbrev·Number:·9·(DW_TAG_imported_unit) | 96 | ·<1><c8>:·Abbrev·Number:·9·(DW_TAG_imported_unit) |
| 97 | ····<c9>···DW_AT_import······:·(GNU_ref_alt)·<0x1 | 97 | ····<c9>···DW_AT_import······:·(GNU_ref_alt)·<0x1c02> |
| 98 | ·<1><cd>:·Abbrev·Number:·73·(DW_TAG_imported_declaration) | 98 | ·<1><cd>:·Abbrev·Number:·73·(DW_TAG_imported_declaration) |
| 99 | ····<ce>···DW_AT_decl_file···:·(data1)·1 | 99 | ····<ce>···DW_AT_decl_file···:·(data1)·145 |
| 100 | ····<cf>···DW_AT_decl_line···:·(data1)·57 | 100 | ····<cf>···DW_AT_decl_line···:·(data1)·57 |
| 101 | ····<d0>···DW_AT_decl_column·:·(data1)·12 | 101 | ····<d0>···DW_AT_decl_column·:·(data1)·12 |
| 102 | ····<d1>···DW_AT_import······:·(GNU_ref_alt)·<0x1566> | 102 | ····<d1>···DW_AT_import······:·(GNU_ref_alt)·<0x1566> |
| 103 | ·<1><d5>:·Abbrev·Number:·0 | 103 | ·<1><d5>:·Abbrev·Number:·0 |
| 104 | ··Compilation·Unit·@·offset·0xd6: | 104 | ··Compilation·Unit·@·offset·0xd6: |
| 105 | ···Length:········0x2a·(32-bit) | 105 | ···Length:········0x2a·(32-bit) |
| 106 | ···Version:·······5 | 106 | ···Version:·······5 |
| 107 | ···Unit·Type:·····DW_UT_partial·(3) | 107 | ···Unit·Type:·····DW_UT_partial·(3) |
| 108 | ···Abbrev·Offset:·0x | 108 | ···Abbrev·Offset:·0x33e1 |
| 109 | ···Pointer·Size:··4 | 109 | ···Pointer·Size:··4 |
| 110 | ·<0><e2>:·Abbrev·Number:· | 110 | ·<0><e2>:·Abbrev·Number:·4·(DW_TAG_partial_unit) |
| 111 | ····<e3>···DW_AT_stmt_list···:·(sec_offset)·0 | 111 | ····<e3>···DW_AT_stmt_list···:·(sec_offset)·0 |
| 112 | ····<e7>···DW_AT_comp_dir····:·(line_strp)·(offset:·0):·./obj-i686-linux-gnu | 112 | ····<e7>···DW_AT_comp_dir····:·(line_strp)·(offset:·0):·./obj-i686-linux-gnu |
| 113 | ·<1><eb>:·Abbrev·Number:· | 113 | ·<1><eb>:·Abbrev·Number:·34·(DW_TAG_namespace) |
| 114 | ····<ec>···DW_AT_name········:·(string)·std | 114 | ····<ec>···DW_AT_name········:·(string)·std |
| 115 | ·<2><f0>:·Abbrev·Number:· | 115 | ·<2><f0>:·Abbrev·Number:·126·(DW_TAG_subprogram) |
| 116 | ····<f1>···DW_AT_external····:·(flag_present)·1 | 116 | ····<f1>···DW_AT_external····:·(flag_present)·1 |
| 117 | ····<f1>···DW_AT_name········:·(GNU_strp_alt)·(offset:·0xe2aef)· | 117 | ····<f1>···DW_AT_name········:·(GNU_strp_alt)·(offset:·0xe2aef)· |
| 118 | ····<f5>···DW_AT_decl_file···:·(data1)·1 | 118 | ····<f5>···DW_AT_decl_file···:·(data1)·110 |
| 119 | ····<f6>···DW_AT_decl_line···:·(data1)·75 | 119 | ····<f6>···DW_AT_decl_line···:·(data1)·75 |
| 120 | ····<f7>···DW_AT_decl_column·:·(data1)·3 | 120 | ····<f7>···DW_AT_decl_column·:·(data1)·3 |
| 121 | ····<f8>···DW_AT_linkage_name:·(GNU_strp_alt)·(offset:·0xc0fb6)· | 121 | ····<f8>···DW_AT_linkage_name:·(GNU_strp_alt)·(offset:·0xc0fb6)· |
| 122 | ····<fc>···DW_AT_noreturn····:·(flag_present)·1 | 122 | ····<fc>···DW_AT_noreturn····:·(flag_present)·1 |
| 123 | ····<fc>···DW_AT_declaration·:·(flag_present)·1 | 123 | ····<fc>···DW_AT_declaration·:·(flag_present)·1 |
| 124 | ·<3><fc>:·Abbrev·Number:· | 124 | ·<3><fc>:·Abbrev·Number:·9·(DW_TAG_formal_parameter) |
| 125 | ····<fd>···DW_AT_type········:·(GNU_ref_alt)·<0x187> | 125 | ····<fd>···DW_AT_type········:·(GNU_ref_alt)·<0x187> |
| 126 | ·<3><101>:·Abbrev·Number:·0 | 126 | ·<3><101>:·Abbrev·Number:·0 |
| Max diff block lines reached; 478896361/478903360 bytes (100.00%) of diff not shown. | |||
| Offset 1, 1003 lines modified | Offset 1, 1055 lines modified | ||
| 1 | Contents·of·the·.debug_abbrev·section: | 1 | Contents·of·the·.debug_abbrev·section: |
| 2 | ··Number·TAG·(0) | 2 | ··Number·TAG·(0) |
| 3 | ···1······DW_TAG_ | 3 | ···1······DW_TAG_subprogram····[has·children] |
| 4 | ····DW_AT_external·····DW_FORM_flag_present | ||
| 5 | ····DW_AT_name·········DW_FORM_GNU_strp_alt | ||
| 6 | ····DW_AT_decl_file····DW_FORM_data1 | ||
| 7 | ····DW_AT_decl_line····DW_FORM_data2 | ||
| 8 | ····DW_AT_decl_column··DW_FORM_data1 | ||
| 4 | ····DW_AT_type·········DW_FORM_GNU_ref_alt | 9 | ····DW_AT_type·········DW_FORM_GNU_ref_alt |
| 10 | ····DW_AT_declaration··DW_FORM_flag_present | ||
| 5 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 11 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 12 | ···2······DW_TAG_partial_unit····[has·children] | ||
| 13 | ····DW_AT_stmt_list····DW_FORM_sec_offset | ||
| 14 | ····DW_AT_comp_dir·····DW_FORM_line_strp | ||
| 15 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| 6 | ··· | 16 | ···3······DW_TAG_formal_parameter····[no·children] |
| 7 | ····DW_AT_name·········DW_FORM_string | ||
| 8 | ····DW_AT_type·········DW_FORM_GNU_ref_alt | 17 | ····DW_AT_type·········DW_FORM_GNU_ref_alt |
| 9 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 18 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 10 | ··· | 19 | ···4······DW_TAG_namespace····[has·children] |
| 11 | ····DW_AT_external·····DW_FORM_flag_present | ||
| 12 | ····DW_AT_name·········DW_FORM_str | 20 | ····DW_AT_name·········DW_FORM_string |
| 21 | ····DW_AT_sibling······DW_FORM_ref_udata | ||
| 22 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| 23 | ···5······DW_TAG_imported_declaration····[no·children] | ||
| 13 | ····DW_AT_decl_file····DW_FORM_data1 | 24 | ····DW_AT_decl_file····DW_FORM_data1 |
| 14 | ····DW_AT_decl_line····DW_FORM_data1 | 25 | ····DW_AT_decl_line····DW_FORM_data1 |
| 15 | ····DW_AT_decl_column··DW_FORM_data1 | 26 | ····DW_AT_decl_column··DW_FORM_data1 |
| 16 | ····DW_AT_linkage_name·DW_FORM_strp | ||
| 17 | ····DW_AT_ | 27 | ····DW_AT_import·······DW_FORM_ref_udata |
| 18 | ····DW_AT_declaration··DW_FORM_flag_present | ||
| 19 | ····DW_AT_object_pointer·DW_FORM_ref_udata | ||
| 20 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 28 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 21 | ··· | 29 | ···6······DW_TAG_subprogram····[has·children] |
| 22 | ····DW_AT_external·····DW_FORM_flag_present | 30 | ····DW_AT_external·····DW_FORM_flag_present |
| 23 | ····DW_AT_name·········DW_FORM_GNU_strp_alt | 31 | ····DW_AT_name·········DW_FORM_GNU_strp_alt |
| 24 | ····DW_AT_decl_file····DW_FORM_data1 | 32 | ····DW_AT_decl_file····DW_FORM_data1 |
| 25 | ····DW_AT_decl_line····DW_FORM_data1 | 33 | ····DW_AT_decl_line····DW_FORM_data1 |
| 26 | ····DW_AT_decl_column··DW_FORM_data1 | 34 | ····DW_AT_decl_column··DW_FORM_data1 |
| 35 | ····DW_AT_type·········DW_FORM_GNU_ref_alt | ||
| 27 | ····DW_AT_linkage_name·DW_FORM_strp | ||
| 28 | ····DW_AT_accessibility·DW_FORM_data1 | ||
| 29 | ····DW_AT_declaration··DW_FORM_flag_present | 36 | ····DW_AT_declaration··DW_FORM_flag_present |
| 30 | ····DW_AT_object_pointer·DW_FORM_ref_udata | ||
| 31 | ····DW_AT_sibling······DW_FORM_ref_udata | ||
| 32 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 37 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 33 | ··· | 38 | ···7······DW_TAG_namespace····[has·children] |
| 34 | ····DW_AT_name·········DW_FORM_ | 39 | ····DW_AT_name·········DW_FORM_string |
| 35 | ····DW_AT_sibling······DW_FORM_ref_udata | ||
| 36 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 40 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 37 | ··· | 41 | ···8······DW_TAG_subprogram····[has·children] |
| 38 | ····DW_AT_external·····DW_FORM_flag_present | 42 | ····DW_AT_external·····DW_FORM_flag_present |
| 39 | ····DW_AT_name·········DW_FORM_GNU_strp_alt | 43 | ····DW_AT_name·········DW_FORM_GNU_strp_alt |
| 40 | ····DW_AT_decl_file····DW_FORM_data1 | 44 | ····DW_AT_decl_file····DW_FORM_data1 |
| 41 | ····DW_AT_decl_line····DW_FORM_data1 | 45 | ····DW_AT_decl_line····DW_FORM_data1 |
| 42 | ····DW_AT_decl_column··DW_FORM_data1 | 46 | ····DW_AT_decl_column··DW_FORM_data1 |
| 43 | ····DW_AT_linkage_name·DW_FORM_strp | 47 | ····DW_AT_linkage_name·DW_FORM_GNU_strp_alt |
| 44 | ····DW_AT_type·········DW_FORM_ref_udata | ||
| 45 | ····DW_AT_declaration··DW_FORM_flag_present | ||
| 46 | ····DW_AT_deleted······DW_FORM_flag_present | ||
| 47 | ····DW_AT_object_pointer·DW_FORM_ref_udata | ||
| 48 | ····DW_AT_sibling······DW_FORM_ref_udata | ||
| 49 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| 50 | ···7······DW_TAG_partial_unit····[has·children] | ||
| 51 | ····DW_AT_stmt_list····DW_FORM_sec_offset | ||
| 52 | ····DW_AT_comp_dir·····DW_FORM_line_strp | ||
| 53 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| 54 | ···8······DW_TAG_array_type····[has·children] | ||
| 55 | ····DW_AT_type·········DW_FORM_GNU_ref_alt | 48 | ····DW_AT_type·········DW_FORM_GNU_ref_alt |
| 56 | ····DW_AT_ | 49 | ····DW_AT_declaration··DW_FORM_flag_present |
| 57 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 50 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 58 | ···9······DW_TAG_formal_parameter····[no·children] | 51 | ···9······DW_TAG_formal_parameter····[no·children] |
| 52 | ····DW_AT_name·········DW_FORM_strp | ||
| 53 | ····DW_AT_decl_file····DW_FORM_data1 | ||
| 54 | ····DW_AT_decl_line····DW_FORM_data1 | ||
| 55 | ····DW_AT_decl_column··DW_FORM_data1 | ||
| 59 | ····DW_AT_type·········DW_FORM_ | 56 | ····DW_AT_type·········DW_FORM_ref_addr |
| 60 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 57 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 61 | ···10······DW_TAG_template_type_param····[no·children] | 58 | ···10······DW_TAG_template_type_param····[no·children] |
| 62 | ····DW_AT_name·········DW_FORM_string | 59 | ····DW_AT_name·········DW_FORM_string |
| 63 | ····DW_AT_type·········DW_FORM_ref_ | 60 | ····DW_AT_type·········DW_FORM_GNU_ref_alt |
| 64 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 61 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 65 | ···11······DW_TAG_ | 62 | ···11······DW_TAG_subprogram····[has·children] |
| 63 | ····DW_AT_specification·DW_FORM_ref_addr | ||
| 66 | ····DW_AT_ | 64 | ····DW_AT_inline·······DW_FORM_data1 |
| 67 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 65 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 68 | ···12······DW_TAG_ | 66 | ···12······DW_TAG_class_type····[no·children] |
| 69 | ····DW_AT_name·········DW_FORM_strp | 67 | ····DW_AT_name·········DW_FORM_GNU_strp_alt |
| 68 | ····DW_AT_declaration··DW_FORM_flag_present | ||
| 69 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| 70 | ···13······DW_TAG_structure_type····[no·children] | ||
| 71 | ····DW_AT_name·········DW_FORM_GNU_strp_alt | ||
| 72 | ····DW_AT_declaration··DW_FORM_flag_present | ||
| 73 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| 74 | ···14······DW_TAG_variable····[no·children] | ||
| 75 | ····DW_AT_name·········DW_FORM_GNU_strp_alt | ||
| 70 | ····DW_AT_decl_file····DW_FORM_data1 | 76 | ····DW_AT_decl_file····DW_FORM_data1 |
| 71 | ····DW_AT_decl_line····DW_FORM_data1 | 77 | ····DW_AT_decl_line····DW_FORM_data1 |
| 72 | ····DW_AT_decl_column··DW_FORM_data1 | 78 | ····DW_AT_decl_column··DW_FORM_data1 |
| 73 | ····DW_AT_type·········DW_FORM_GNU_ref_alt | 79 | ····DW_AT_type·········DW_FORM_GNU_ref_alt |
| 80 | ····DW_AT_declaration··DW_FORM_flag_present | ||
| 81 | ····DW_AT_const_value··DW_FORM_sdata | ||
| 74 | ····DW_AT_data_member_location·DW_FORM_data1 | ||
| 75 | ····DW_AT_accessibility·DW_FORM_data1 | ||
| 76 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| 77 | ···13······DW_TAG_reference_type····[no·children] | ||
| 78 | ····DW_AT_byte_size····DW_FORM_implicit_const:·4 | ||
| 79 | ····DW_AT_type·········DW_FORM_ref_udata | ||
| 80 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 82 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 81 | ···1 | 83 | ···15······DW_TAG_variable····[no·children] |
| 84 | ····DW_AT_specification·DW_FORM_ref_udata | ||
| 82 | ····DW_AT_type·········DW_FORM_GNU_ref_alt | ||
| 83 | ····DW_AT_artificial···DW_FORM_flag_present | ||
| 84 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 85 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 85 | ···1 | 86 | ···16······DW_TAG_formal_parameter····[no·children] |
| 86 | ····DW_AT_name·········DW_FORM_str | 87 | ····DW_AT_name·········DW_FORM_GNU_strp_alt |
| 87 | ····DW_AT_decl_file····DW_FORM_data1 | 88 | ····DW_AT_decl_file····DW_FORM_data1 |
| 88 | ····DW_AT_decl_line····DW_FORM_data1 | 89 | ····DW_AT_decl_line····DW_FORM_data1 |
| 89 | ····DW_AT_decl_column··DW_FORM_data1 | 90 | ····DW_AT_decl_column··DW_FORM_data1 |
| 90 | ····DW_AT_type·········DW_FORM_GNU_ref_alt | 91 | ····DW_AT_type·········DW_FORM_GNU_ref_alt |
| 91 | ····DW_AT_data_member_location·DW_FORM_data1 | ||
| 92 | ····DW_AT_accessibility·DW_FORM_data1 | ||
| 93 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 92 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 94 | ···16······DW_TAG_subprogram····[has·children] | ||
| 95 | ····DW_A | 93 | ···17······DW_TAG_template_type_param····[no·children] |
| 94 | ····DW_AT_name·········DW_FORM_GNU_strp_alt | ||
| Max diff block lines reached; 4549071/4555710 bytes (99.85%) of diff not shown. | |||
| Offset 1, 947 lines modified | Offset 1, 962 lines modified | ||
| 1 | Contents·of·the·.debug_aranges·section: | 1 | Contents·of·the·.debug_aranges·section: |
| 2 | ··Length:···················3 | 2 | ··Length:···················308 |
| 3 | ··Version:··················2 | 3 | ··Version:··················2 |
| 4 | ··Offset·into·.debug_info:··0x7 | 4 | ··Offset·into·.debug_info:··0x7606c |
| 5 | ··Pointer·Size:·············4 | 5 | ··Pointer·Size:·············4 |
| 6 | ··Segment·Size:·············0 | 6 | ··Segment·Size:·············0 |
| 7 | ····Address····Length | 7 | ····Address····Length |
| 8 | ····0002 | 8 | ····0002b2e0·00002036 |
| 9 | ····0001f0 | 9 | ····0001f0b0·00000191 |
| 10 | ····0002d | 10 | ····0002d320·00000006 |
| 11 | ····0002d | 11 | ····0002d330·000001be |
| 12 | ····0002d | 12 | ····0002d4f0·00000160 |
| 13 | ····0002d | 13 | ····0002d650·00000369 |
| 14 | ····0002d | 14 | ····0002d9c0·000002cc |
| 15 | ····0002d | 15 | ····0002dc90·000003cd |
| 16 | ····0002 | 16 | ····0002e060·000003e2 |
| 17 | ····0002e | 17 | ····0002e450·0000016e |
| 18 | ····0002e | 18 | ····0002e5c0·000004f6 |
| 19 | ····0002e | 19 | ····0002eac0·000000ac |
| 20 | ····0002e | 20 | ····0002eb70·000005b3 |
| 21 | ····0002 | 21 | ····0002f130·00000353 |
| 22 | ····0002f | 22 | ····0002f490·0000054a |
| 23 | ····0002f | 23 | ····0002f9e0·0000008b |
| 24 | ····0002f | 24 | ····0002fa70·00000068 |
| 25 | ····0002f6b0·000001d5 | ||
| 26 | ····0002f | 25 | ····0002fae0·00000068 |
| 27 | ····0002f | 26 | ····0002fb50·00000379 |
| 28 | ····0002f | 27 | ····0002fed0·0000015a |
| 29 | ····0002fe50·00000173 | ||
| 30 | ····0002ffd0·0000003d | ||
| 31 | ····00030010·000003c1 | ||
| 32 | ····00030 | 28 | ····00030030·000001a3 |
| 29 | ····000301e0·0000003d | ||
| 30 | ····00030220·00000320 | ||
| 31 | ····00030540·00000163 | ||
| 33 | ····00030 | 32 | ····000306b0·00000c0e |
| 34 | ····00031 | 33 | ····000312c0·000004ba |
| 35 | ····00031 | 34 | ····00031780·00000204 |
| 36 | ····00031 | 35 | ····00031990·0000051a |
| 37 | ····00031 | 36 | ····00031eb0·000000a2 |
| 38 | ····00031 | 37 | ····00031f60·0000041e |
| 39 | ····000323 | 38 | ····00032380·00000555 |
| 40 | ····00032 | 39 | ····000328e0·00000362 |
| 41 | ····00032 | 40 | ····00032c50·000001d7 |
| 42 | ····00032 | 41 | ····00032e30·0000083d |
| 43 | ····00028 | 42 | ····000289e0·000009c9 |
| 44 | ····00029 | 43 | ····000293b0·00000057 |
| 45 | ····00000000·00000000 | 44 | ····00000000·00000000 |
| 46 | ··Length:···················244 | 45 | ··Length:···················244 |
| 47 | ··Version:··················2 | 46 | ··Version:··················2 |
| 48 | ··Offset·into·.debug_info:··0x11 | 47 | ··Offset·into·.debug_info:··0x1154d0 |
| 49 | ··Pointer·Size:·············4 | 48 | ··Pointer·Size:·············4 |
| 50 | ··Segment·Size:·············0 | 49 | ··Segment·Size:·············0 |
| 51 | ····Address····Length | 50 | ····Address····Length |
| 52 | ····00033 | 51 | ····00033680·00004d8d |
| 53 | ····0001f2 | 52 | ····0001f242·00000334 |
| 54 | ····0002d | 53 | ····0002d320·00000006 |
| 55 | ····00038 | 54 | ····00038410·0000013b |
| 56 | ····00038 | 55 | ····00038550·000001c7 |
| 57 | ····00038 | 56 | ····00038720·000002ab |
| 58 | ····00038 | 57 | ····000389d0·00000708 |
| 59 | ····00039 | 58 | ····000390e0·00000081 |
| 60 | ····00039 | 59 | ····00039170·00000187 |
| 61 | ····00039 | 60 | ····00039300·0000026b |
| 62 | ····00039 | 61 | ····00039570·00000181 |
| 63 | ····00039 | 62 | ····00039700·00000178 |
| 64 | ····00039 | 63 | ····00039880·000001a5 |
| 65 | ····00039 | 64 | ····00039a30·00000064 |
| 66 | ····00039 | 65 | ····00039aa0·000007a2 |
| 67 | ····0003a | 66 | ····0003a250·000002c4 |
| 68 | ····0003a | 67 | ····0003a520·00000172 |
| 69 | ····0003a | 68 | ····0003a6a0·000000d2 |
| 70 | ····0003a | 69 | ····0003a780·0000014a |
| 70 | ····0003a8d0·00000301 | ||
| 71 | ····0003abe0·000002 | 71 | ····0003abe0·0000022e |
| 72 | ····0003aed0·0000022e | ||
| 73 | ····0003 | 72 | ····0003ae10·00000144 |
| 74 | ····0003 | 73 | ····0003af60·000002ef |
| 75 | ····0003b | 74 | ····0003b250·000001b0 |
| 76 | ····0003b | 75 | ····0003b400·000005c5 |
| 77 | ····0003b | 76 | ····0003b9d0·00000140 |
| 78 | ····0003b | 77 | ····0003bb10·0000022e |
| 79 | ····00029 | 78 | ····00029410·00000038 |
| 80 | ····00000000·00000000 | 79 | ····00000000·00000000 |
| 81 | ··Length:···················36 | 80 | ··Length:···················36 |
| 82 | ··Version:··················2 | 81 | ··Version:··················2 |
| 83 | ··Offset·into·.debug_info:··0x17 | 82 | ··Offset·into·.debug_info:··0x17dbbd |
| 84 | ··Pointer·Size:·············4 | 83 | ··Pointer·Size:·············4 |
| 85 | ··Segment·Size:·············0 | 84 | ··Segment·Size:·············0 |
| 86 | ····Address····Length | 85 | ····Address····Length |
| 87 | ····0003 | 86 | ····0003bd50·00000ca4 |
| 88 | ····00029 | 87 | ····00029450·00000038 |
| 89 | ····00000000·00000000 | 88 | ····00000000·00000000 |
| 90 | ··Length:···················68 | 89 | ··Length:···················68 |
| 91 | ··Version:··················2 | 90 | ··Version:··················2 |
| 92 | ··Offset·into·.debug_info:··0x18 | 91 | ··Offset·into·.debug_info:··0x18adf2 |
| 93 | ··Pointer·Size:·············4 | 92 | ··Pointer·Size:·············4 |
| 94 | ··Segment·Size:·············0 | 93 | ··Segment·Size:·············0 |
| 95 | ····Address····Length | 94 | ····Address····Length |
| 96 | ····0003c | 95 | ····0003ca00·00001361 |
| 97 | ····0001f57 | 96 | ····0001f576·00000070 |
| 98 | ····0002d | 97 | ····0002d320·00000006 |
| 99 | ····0003a | 98 | ····0003a250·000002c4 |
| 100 | ····00030 | 99 | ····00030540·00000163 |
| 101 | ····00029 | 100 | ····00029490·00000038 |
| 102 | ····00000000·00000000 | 101 | ····00000000·00000000 |
| 103 | ··Length:···················132 | 102 | ··Length:···················132 |
| 104 | ··Version:··················2 | 103 | ··Version:··················2 |
| 105 | ··Offset·into·.debug_info:··0x1 | 104 | ··Offset·into·.debug_info:··0x19202d |
| 106 | ··Pointer·Size:·············4 | 105 | ··Pointer·Size:·············4 |
| 107 | ··Segment·Size:·············0 | 106 | ··Segment·Size:·············0 |
| 108 | ····Address····Length | 107 | ····Address····Length |
| 109 | ····0003d | 108 | ····0003dd70·000032e8 |
| 110 | ····0001f5e | 109 | ····0001f5e6·00000325 |
| 111 | ····0002d | 110 | ····0002d320·00000006 |
| 112 | ····00041 | 111 | ····00041060·00000156 |
| 113 | ····00041 | 112 | ····000411c0·000000f4 |
| 114 | ····00041 | 113 | ····000412c0·00000334 |
| 115 | ····00041 | 114 | ····00041600·00000164 |
| 116 | ····00041 | 115 | ····00041770·00000172 |
| 117 | ····00041b50·00000192 | ||
| Max diff block lines reached; 33373/38694 bytes (86.25%) of diff not shown. | |||
| Offset 1, 1194266 lines modified | Offset 1, 1215575 lines modified | ||
| 1 | Contents·of·the·.debug_loclists·section: | 1 | Contents·of·the·.debug_loclists·section: |
| 2 | ····Offset···Begin············End··············Expression | 2 | ····Offset···Begin············End··············Expression |
| 3 | ····0000000c·v0000002·v0000000·location·view·pair | 3 | ····0000000c·v0000002·v0000000·location·view·pair |
| 4 | ····0000000e·v0000002·v0000000·views·at·0000000c·for: | 4 | ····0000000e·v0000002·v0000000·views·at·0000000c·for: |
| 5 | ·············00029 | 5 | ·············000293b0·00029401·(DW_OP_lit1;·DW_OP_stack_value) |
| 6 | ····00000017·<End·of·list> | 6 | ····00000017·<End·of·list> |
| 7 | ····00000018·v0000002·v0000000·location·view·pair | 7 | ····00000018·v0000002·v0000000·location·view·pair |
| 8 | ····0000001a·v0000002·v0000000·views·at·00000018·for: | 8 | ····0000001a·v0000002·v0000000·views·at·00000018·for: |
| 9 | ·············00029 | 9 | ·············000293b0·00029401·(DW_OP_const2u:·65535;·DW_OP_stack_value) |
| 10 | ····00000025·<End·of·list> | 10 | ····00000025·<End·of·list> |
| 11 | ····00000026·v000000d·v000000e·location·view·pair | 11 | ····00000026·v000000d·v000000e·location·view·pair |
| 12 | ····00000028·v000000d·v000000e·views·at·00000026·for: | 12 | ····00000028·v000000d·v000000e·views·at·00000026·for: |
| 13 | ·············00029 | 13 | ·············000293e2·000293e2·(DW_OP_lit0;·DW_OP_stack_value) |
| 14 | ····00000031·<End·of·list> | 14 | ····00000031·<End·of·list> |
| 15 | ····00000032·v0000010·v0000011·location·view·pair | 15 | ····00000032·v0000010·v0000011·location·view·pair |
| 16 | ····00000034·v0000010·v0000011·views·at·00000032·for: | 16 | ····00000034·v0000010·v0000011·views·at·00000032·for: |
| 17 | ·············00029 | 17 | ·············000293e2·000293e2·(DW_OP_lit1;·DW_OP_stack_value) |
| 18 | ····0000003d·<End·of·list> | 18 | ····0000003d·<End·of·list> |
| 19 | ····0000003e·v0000013·v0000014·location·view·pair | 19 | ····0000003e·v0000013·v0000014·location·view·pair |
| 20 | ····00000040·v0000013·v0000014·views·at·0000003e·for: | 20 | ····00000040·v0000013·v0000014·views·at·0000003e·for: |
| 21 | ·············00029 | 21 | ·············000293e2·000293e2·(DW_OP_lit2;·DW_OP_stack_value) |
| 22 | ····00000049·<End·of·list> | 22 | ····00000049·<End·of·list> |
| 23 | ····0000004a·v0000016·v0000017·location·view·pair | 23 | ····0000004a·v0000016·v0000017·location·view·pair |
| 24 | ····0000004c·v0000016·v0000017·views·at·0000004a·for: | 24 | ····0000004c·v0000016·v0000017·views·at·0000004a·for: |
| 25 | ·············00029 | 25 | ·············000293e2·000293e2·(DW_OP_lit4;·DW_OP_stack_value) |
| 26 | ····00000055·<End·of·list> | 26 | ····00000055·<End·of·list> |
| 27 | ····00000056·v0000019·v000001a·location·view·pair | 27 | ····00000056·v0000019·v000001a·location·view·pair |
| 28 | ····00000058·v0000019·v000001a·views·at·00000056·for: | 28 | ····00000058·v0000019·v000001a·views·at·00000056·for: |
| 29 | ·············00029 | 29 | ·············000293e2·000293e2·(DW_OP_lit0;·DW_OP_stack_value) |
| 30 | ····00000061·<End·of·list> | 30 | ····00000061·<End·of·list> |
| 31 | ····00000062·v000001c·v000001d·location·view·pair | 31 | ····00000062·v000001c·v000001d·location·view·pair |
| 32 | ····00000064·v000001c·v000001d·views·at·00000062·for: | 32 | ····00000064·v000001c·v000001d·views·at·00000062·for: |
| 33 | ·············00029 | 33 | ·············000293e2·000293e2·(DW_OP_lit1;·DW_OP_stack_value) |
| 34 | ····0000006d·<End·of·list> | 34 | ····0000006d·<End·of·list> |
| 35 | ····0000006e·v000001f·v0000020·location·view·pair | 35 | ····0000006e·v000001f·v0000020·location·view·pair |
| 36 | ····00000070·v000001f·v0000020·views·at·0000006e·for: | 36 | ····00000070·v000001f·v0000020·views·at·0000006e·for: |
| 37 | ·············00029 | 37 | ·············000293e2·000293e2·(DW_OP_lit2;·DW_OP_stack_value) |
| 38 | ····00000079·<End·of·list> | 38 | ····00000079·<End·of·list> |
| 39 | ····0000007a·v0000022·v0000023·location·view·pair | 39 | ····0000007a·v0000022·v0000023·location·view·pair |
| 40 | ····0000007c·v0000022·v0000023·views·at·0000007a·for: | 40 | ····0000007c·v0000022·v0000023·views·at·0000007a·for: |
| 41 | ·············00029 | 41 | ·············000293e2·000293e2·(DW_OP_lit4;·DW_OP_stack_value) |
| 42 | ····00000085·<End·of·list> | 42 | ····00000085·<End·of·list> |
| 43 | ····00000086·v0000025·v0000026·location·view·pair | 43 | ····00000086·v0000025·v0000026·location·view·pair |
| 44 | ····00000088·v0000025·v0000026·views·at·00000086·for: | 44 | ····00000088·v0000025·v0000026·views·at·00000086·for: |
| 45 | ·············00029 | 45 | ·············000293e2·000293e2·(DW_OP_lit8;·DW_OP_stack_value) |
| 46 | ····00000091·<End·of·list> | 46 | ····00000091·<End·of·list> |
| 47 | ····00000092·v0000028·v0000029·location·view·pair | 47 | ····00000092·v0000028·v0000029·location·view·pair |
| 48 | ····00000094·v0000028·v0000029·views·at·00000092·for: | 48 | ····00000094·v0000028·v0000029·views·at·00000092·for: |
| 49 | ·············00029 | 49 | ·············000293e2·000293e2·(DW_OP_lit0;·DW_OP_stack_value) |
| 50 | ····0000009d·<End·of·list> | 50 | ····0000009d·<End·of·list> |
| 51 | ····0000009e·v000002b·v000002c·location·view·pair | 51 | ····0000009e·v000002b·v000002c·location·view·pair |
| 52 | ····000000a0·v000002b·v000002c·views·at·0000009e·for: | 52 | ····000000a0·v000002b·v000002c·views·at·0000009e·for: |
| 53 | ·············00029 | 53 | ·············000293e2·000293e2·(DW_OP_lit1;·DW_OP_stack_value) |
| 54 | ····000000a9·<End·of·list> | 54 | ····000000a9·<End·of·list> |
| 55 | ····000000aa·v000002e·v000002f·location·view·pair | 55 | ····000000aa·v000002e·v000002f·location·view·pair |
| 56 | ····000000ac·v000002e·v000002f·views·at·000000aa·for: | 56 | ····000000ac·v000002e·v000002f·views·at·000000aa·for: |
| 57 | ·············00029 | 57 | ·············000293e2·000293e2·(DW_OP_lit2;·DW_OP_stack_value) |
| 58 | ····000000b5·<End·of·list> | 58 | ····000000b5·<End·of·list> |
| 59 | ····000000b6·v0000031·v0000032·location·view·pair | 59 | ····000000b6·v0000031·v0000032·location·view·pair |
| 60 | ····000000b8·v0000031·v0000032·views·at·000000b6·for: | 60 | ····000000b8·v0000031·v0000032·views·at·000000b6·for: |
| 61 | ·············00029 | 61 | ·············000293e2·000293e2·(DW_OP_lit4;·DW_OP_stack_value) |
| 62 | ····000000c1·<End·of·list> | 62 | ····000000c1·<End·of·list> |
| 63 | ····000000c2·v0000034·v0000035·location·view·pair | 63 | ····000000c2·v0000034·v0000035·location·view·pair |
| 64 | ····000000c4·v0000034·v0000035·views·at·000000c2·for: | 64 | ····000000c4·v0000034·v0000035·views·at·000000c2·for: |
| 65 | ·············00029 | 65 | ·············000293e2·000293e2·(DW_OP_lit8;·DW_OP_stack_value) |
| 66 | ····000000cd·<End·of·list> | 66 | ····000000cd·<End·of·list> |
| 67 | ····000000ce·v0000037·v0000038·location·view·pair | 67 | ····000000ce·v0000037·v0000038·location·view·pair |
| 68 | ····000000d0·v0000037·v0000038·views·at·000000ce·for: | 68 | ····000000d0·v0000037·v0000038·views·at·000000ce·for: |
| 69 | ·············00029 | 69 | ·············000293e2·000293e2·(DW_OP_lit16;·DW_OP_stack_value) |
| 70 | ····000000d9·<End·of·list> | 70 | ····000000d9·<End·of·list> |
| 71 | ····000000da·v000003a·v000003b·location·view·pair | 71 | ····000000da·v000003a·v000003b·location·view·pair |
| 72 | ····000000dc·v000003a·v000003b·views·at·000000da·for: | 72 | ····000000dc·v000003a·v000003b·views·at·000000da·for: |
| 73 | ·············00029 | 73 | ·············000293e2·000293e2·(DW_OP_lit0;·DW_OP_stack_value) |
| 74 | ····000000e5·<End·of·list> | 74 | ····000000e5·<End·of·list> |
| 75 | ····000000e6·v000003d·v000003e·location·view·pair | 75 | ····000000e6·v000003d·v000003e·location·view·pair |
| 76 | ····000000e8·v000003d·v000003e·views·at·000000e6·for: | 76 | ····000000e8·v000003d·v000003e·views·at·000000e6·for: |
| 77 | ·············00029 | 77 | ·············000293e2·000293e2·(DW_OP_lit1;·DW_OP_stack_value) |
| 78 | ····000000f1·<End·of·list> | 78 | ····000000f1·<End·of·list> |
| 79 | ····000000f2·v0000040·v0000041·location·view·pair | 79 | ····000000f2·v0000040·v0000041·location·view·pair |
| 80 | ····000000f4·v0000040·v0000041·views·at·000000f2·for: | 80 | ····000000f4·v0000040·v0000041·views·at·000000f2·for: |
| 81 | ·············00029 | 81 | ·············000293e2·000293e2·(DW_OP_lit2;·DW_OP_stack_value) |
| 82 | ····000000fd·<End·of·list> | 82 | ····000000fd·<End·of·list> |
| 83 | ····000000fe·v0000043·v0000044·location·view·pair | 83 | ····000000fe·v0000043·v0000044·location·view·pair |
| 84 | ····00000100·v0000043·v0000044·views·at·000000fe·for: | 84 | ····00000100·v0000043·v0000044·views·at·000000fe·for: |
| Max diff block lines reached; 94534036/94539775 bytes (99.99%) of diff not shown. | |||
| Offset 1, 947 lines modified | Offset 1, 962 lines modified | ||
| 1 | Contents·of·the·.debug_aranges·section: | 1 | Contents·of·the·.debug_aranges·section: |
| 2 | ··Length:···················3 | 2 | ··Length:···················308 |
| 3 | ··Version:··················2 | 3 | ··Version:··················2 |
| 4 | ··Offset·into·.debug_info:··0x7 | 4 | ··Offset·into·.debug_info:··0x7606c |
| 5 | ··Pointer·Size:·············4 | 5 | ··Pointer·Size:·············4 |
| 6 | ··Segment·Size:·············0 | 6 | ··Segment·Size:·············0 |
| 7 | ····Address····Length | 7 | ····Address····Length |
| 8 | ····0002 | 8 | ····0002b2e0·00002036 |
| 9 | ····0001f0 | 9 | ····0001f0b0·00000191 |
| 10 | ····0002d | 10 | ····0002d320·00000006 |
| 11 | ····0002d | 11 | ····0002d330·000001be |
| 12 | ····0002d | 12 | ····0002d4f0·00000160 |
| 13 | ····0002d | 13 | ····0002d650·00000369 |
| 14 | ····0002d | 14 | ····0002d9c0·000002cc |
| 15 | ····0002d | 15 | ····0002dc90·000003cd |
| 16 | ····0002 | 16 | ····0002e060·000003e2 |
| 17 | ····0002e | 17 | ····0002e450·0000016e |
| 18 | ····0002e | 18 | ····0002e5c0·000004f6 |
| 19 | ····0002e | 19 | ····0002eac0·000000ac |
| 20 | ····0002e | 20 | ····0002eb70·000005b3 |
| 21 | ····0002 | 21 | ····0002f130·00000353 |
| 22 | ····0002f | 22 | ····0002f490·0000054a |
| 23 | ····0002f | 23 | ····0002f9e0·0000008b |
| 24 | ····0002f | 24 | ····0002fa70·00000068 |
| 25 | ····0002f6b0·000001d5 | ||
| 26 | ····0002f | 25 | ····0002fae0·00000068 |
| 27 | ····0002f | 26 | ····0002fb50·00000379 |
| 28 | ····0002f | 27 | ····0002fed0·0000015a |
| 29 | ····0002fe50·00000173 | ||
| 30 | ····0002ffd0·0000003d | ||
| 31 | ····00030010·000003c1 | ||
| 32 | ····00030 | 28 | ····00030030·000001a3 |
| 29 | ····000301e0·0000003d | ||
| 30 | ····00030220·00000320 | ||
| 31 | ····00030540·00000163 | ||
| 33 | ····00030 | 32 | ····000306b0·00000c0e |
| 34 | ····00031 | 33 | ····000312c0·000004ba |
| 35 | ····00031 | 34 | ····00031780·00000204 |
| 36 | ····00031 | 35 | ····00031990·0000051a |
| 37 | ····00031 | 36 | ····00031eb0·000000a2 |
| 38 | ····00031 | 37 | ····00031f60·0000041e |
| 39 | ····000323 | 38 | ····00032380·00000555 |
| 40 | ····00032 | 39 | ····000328e0·00000362 |
| 41 | ····00032 | 40 | ····00032c50·000001d7 |
| 42 | ····00032 | 41 | ····00032e30·0000083d |
| 43 | ····00028 | 42 | ····000289e0·000009c9 |
| 44 | ····00029 | 43 | ····000293b0·00000057 |
| 45 | ····00000000·00000000 | 44 | ····00000000·00000000 |
| 46 | ··Length:···················244 | 45 | ··Length:···················244 |
| 47 | ··Version:··················2 | 46 | ··Version:··················2 |
| 48 | ··Offset·into·.debug_info:··0x11 | 47 | ··Offset·into·.debug_info:··0x1154d0 |
| 49 | ··Pointer·Size:·············4 | 48 | ··Pointer·Size:·············4 |
| 50 | ··Segment·Size:·············0 | 49 | ··Segment·Size:·············0 |
| 51 | ····Address····Length | 50 | ····Address····Length |
| 52 | ····00033 | 51 | ····00033680·00004d8d |
| 53 | ····0001f2 | 52 | ····0001f242·00000334 |
| 54 | ····0002d | 53 | ····0002d320·00000006 |
| 55 | ····00038 | 54 | ····00038410·0000013b |
| 56 | ····00038 | 55 | ····00038550·000001c7 |
| 57 | ····00038 | 56 | ····00038720·000002ab |
| 58 | ····00038 | 57 | ····000389d0·00000708 |
| 59 | ····00039 | 58 | ····000390e0·00000081 |
| 60 | ····00039 | 59 | ····00039170·00000187 |
| 61 | ····00039 | 60 | ····00039300·0000026b |
| 62 | ····00039 | 61 | ····00039570·00000181 |
| 63 | ····00039 | 62 | ····00039700·00000178 |
| 64 | ····00039 | 63 | ····00039880·000001a5 |
| 65 | ····00039 | 64 | ····00039a30·00000064 |
| 66 | ····00039 | 65 | ····00039aa0·000007a2 |
| 67 | ····0003a | 66 | ····0003a250·000002c4 |
| 68 | ····0003a | 67 | ····0003a520·00000172 |
| 69 | ····0003a | 68 | ····0003a6a0·000000d2 |
| 70 | ····0003a | 69 | ····0003a780·0000014a |
| 70 | ····0003a8d0·00000301 | ||
| 71 | ····0003abe0·000002 | 71 | ····0003abe0·0000022e |
| 72 | ····0003aed0·0000022e | ||
| 73 | ····0003 | 72 | ····0003ae10·00000144 |
| 74 | ····0003 | 73 | ····0003af60·000002ef |
| 75 | ····0003b | 74 | ····0003b250·000001b0 |
| 76 | ····0003b | 75 | ····0003b400·000005c5 |
| 77 | ····0003b | 76 | ····0003b9d0·00000140 |
| 78 | ····0003b | 77 | ····0003bb10·0000022e |
| 79 | ····00029 | 78 | ····00029410·00000038 |
| 80 | ····00000000·00000000 | 79 | ····00000000·00000000 |
| 81 | ··Length:···················36 | 80 | ··Length:···················36 |
| 82 | ··Version:··················2 | 81 | ··Version:··················2 |
| 83 | ··Offset·into·.debug_info:··0x17 | 82 | ··Offset·into·.debug_info:··0x17dbbd |
| 84 | ··Pointer·Size:·············4 | 83 | ··Pointer·Size:·············4 |
| 85 | ··Segment·Size:·············0 | 84 | ··Segment·Size:·············0 |
| 86 | ····Address····Length | 85 | ····Address····Length |
| 87 | ····0003 | 86 | ····0003bd50·00000ca4 |
| 88 | ····00029 | 87 | ····00029450·00000038 |
| 89 | ····00000000·00000000 | 88 | ····00000000·00000000 |
| 90 | ··Length:···················68 | 89 | ··Length:···················68 |
| 91 | ··Version:··················2 | 90 | ··Version:··················2 |
| 92 | ··Offset·into·.debug_info:··0x18 | 91 | ··Offset·into·.debug_info:··0x18adf2 |
| 93 | ··Pointer·Size:·············4 | 92 | ··Pointer·Size:·············4 |
| 94 | ··Segment·Size:·············0 | 93 | ··Segment·Size:·············0 |
| 95 | ····Address····Length | 94 | ····Address····Length |
| 96 | ····0003c | 95 | ····0003ca00·00001361 |
| 97 | ····0001f57 | 96 | ····0001f576·00000070 |
| 98 | ····0002d | 97 | ····0002d320·00000006 |
| 99 | ····0003a | 98 | ····0003a250·000002c4 |
| 100 | ····00030 | 99 | ····00030540·00000163 |
| 101 | ····00029 | 100 | ····00029490·00000038 |
| 102 | ····00000000·00000000 | 101 | ····00000000·00000000 |
| 103 | ··Length:···················132 | 102 | ··Length:···················132 |
| 104 | ··Version:··················2 | 103 | ··Version:··················2 |
| 105 | ··Offset·into·.debug_info:··0x1 | 104 | ··Offset·into·.debug_info:··0x19202d |
| 106 | ··Pointer·Size:·············4 | 105 | ··Pointer·Size:·············4 |
| 107 | ··Segment·Size:·············0 | 106 | ··Segment·Size:·············0 |
| 108 | ····Address····Length | 107 | ····Address····Length |
| 109 | ····0003d | 108 | ····0003dd70·000032e8 |
| 110 | ····0001f5e | 109 | ····0001f5e6·00000325 |
| 111 | ····0002d | 110 | ····0002d320·00000006 |
| 112 | ····00041 | 111 | ····00041060·00000156 |
| 113 | ····00041 | 112 | ····000411c0·000000f4 |
| 114 | ····00041 | 113 | ····000412c0·00000334 |
| 115 | ····00041 | 114 | ····00041600·00000164 |
| 116 | ····00041 | 115 | ····00041770·00000172 |
| 117 | ····00041b50·00000192 | ||
| Max diff block lines reached; 33373/38694 bytes (86.25%) of diff not shown. | |||
| Offset 1, 1794 lines modified | Offset 1, 1873 lines modified | Diff chunk too large, falling back to line-by-line diff (1449 lines added, 1407 lines removed) | |
| 1 | GCC:·(Debian·12.2.0-14)·12.2.0 | 1 | GCC:·(Debian·12.2.0-14)·12.2.0 |
| 2 | 2 | 2*.m@3pi?k | |
| 3 | 3 | 3x'K(p.z' | |
| 4 | 4 | t7E",fe% | |
| 5 | 5 | zrha,;UDO | |
| 6 | 6 | h']g$J/E | |
| 7 | 7 | )T)k~nemdf( | |
| 8 | 8 | [>qS9RT1.6 | |
| 9 | 9 | }&1)mxT{ | |
| 10 | 10 | (YH|d5%SZJ | |
| 11 | 11 | n1$@Oo8()h | |
| 12 | 12 | fw:)vZ,J | |
| 13 | 13 | 7<(4*u\* | |
| 14 | 14 | r/9dIJM8.O» | |
| 15 | 15 | ,alwZZTvg | |
| 16 | 16 | J9_0%» N0 | |
| 17 | 17 | d?F2P?tj | |
| 18 | 18 | 5N4r{Dp#·x | |
| 19 | 19 | 14Z([CIg_" | |
| 20 | 20 | NuHpluDO | |
| 21 | 21 | _wF]V3jMx | |
| 22 | 22 | I;\zyF(Z | |
| 23 | 23 | lm~%Xq,T | |
| 24 | 24 | mWlvMBJM | |
| 25 | 25 | ><)?tJ\g | |
| 26 | 26 | p'Wp=Kg8!: | |
| 27 | 27 | k3[FBU#W | |
| 28 | 28 | 2@y_!4g.tb | |
| 29 | 29 | 'I·~k#Q» | |
| 30 | 30 | sUZY[h!'rN | |
| 31 | 31 | rT^9Sn!q | |
| 32 | 32 | +WoKdNn- | |
| 33 | 33 | !Ub» xW"m | |
| 34 | 34 | LOGjG)5U | |
| 35 | 35 | nqy]rRnq | |
| 36 | 36 | U'J]&8·5 | |
| 37 | 37 | A/c=#3H! | |
| 38 | 38 | =T» !}Q_O. | |
| 39 | 39 | _:x)v6z8 | |
| 40 | 40 | *I+\"G]ul | |
| 41 | 41 | LZN(4a·u | |
| 42 | 42 | =W"A(Y(TM0Q | |
| 43 | 43 | 1AFgj%SLs; | |
| 44 | 44 | C&1920b· | |
| 45 | 45 | |x@Z~;Sk | |
| 46 | 46 | sW+RL_11 | |
| 47 | 47 | H'm"qIj»..1 | |
| 48 | 48 | fD1:Dz&=D: | |
| 49 | 49 | V[uk[&^T | |
| 50 | 50 | W)tZNK*9;~9 | |
| 51 | 51 | K3~6A?+|Z | |
| 52 | 52 | OB3/*Uk?Ez-y | |
| 53 | 53 | %^]?:» s» 4 | |
| 54 | 54 | W-^U;<rT | |
| 55 | 55 | fXM[l^*I | |
| 56 | 56 | =u,e$$`% | |
| 57 | 57 | z~QRAtW" | |
| 58 | 58 | 1]U}z'^T | |
| 59 | 59 | rD\L4*9@ | |
| 60 | 60 | ZW'8s-#I | |
| 61 | 61 | ;5<vVDlj | |
| 62 | 62 | iplJHm8> | |
| 63 | 63 | acy?rCO,C | |
| 64 | 64 | 53JuF@E%v | |
| 65 | 65 | -!H?IlF] | |
| 66 | 66 | )X7drJb' | |
| 67 | 67 | B4:CmZW7 | |
| 68 | 68 | VS9gWR_>` | |
| 69 | 69 | Hcur?lj1 | |
| 70 | 70 | avPgojU) | |
| 71 | 71 | {» \0L94] | |
| 72 | 72 | @Z-4NQ)_n | |
| 73 | 73 | >@Y» Xe\& | |
| 74 | 74 | .zVb;[,q | |
| 75 | 75 | -zzI?TW} | |
| 76 | 76 | zzf".MTe | |
| 77 | 77 | ·]_CvqPd | |
| 78 | 78 | F"&,XE~Z | |
| 79 | 79 | JTXmpVXm | |
| 80 | 80 | v,+1YX-· | |
| 81 | 81 | x\`*f7Lcv | |
| 82 | 82 | =Cw7RiRSO3 | |
| 83 | 83 | UdBb2[an | |
| 84 | 84 | =E>myMl' | |
| 85 | 85 | 7@/1W.PY | |
| 86 | 86 | oJsE~;)+H | |
| 87 | 87 | nZ$-Yv]V | |
| 88 | 88 | %BD=v*'/+N% | |
| 89 | 89 | P10T#/oE | |
| 90 | 90 | v:pk/H[5@ | |
| 91 | 91 | MFIsgN6Igul | |
| 92 | 92 | oP?-2J8» | |
| 93 | 93 | +2]Pw]*W | |
| 94 | 94 | !@@+"=h_ | |
| 95 | 95 | 1!4S,R2R6R | |
| 96 | 96 | c}X<[*n»Q | |
| 97 | 97 | iOL87!4U1.J | |
| 98 | 98 | M4&}$3ZR | |
| 99 | 99 | _/]%|C_'j· | |
| 100 | 100 | "z.6BPhD | |
| 101 | 101 | Z`,R?jCH | |
| 102 | 102 | ~&.(» uQFv | |
| 103 | 103 | ywm^@*#y | |
| 104 | 104 | %$.·h_>3 | |
| 105 | 105 | W·]V"<{# | |
| 106 | 106 | nLU<2-O. | |
| 107 | 107 | 2Ux7Q/Dz | |
| 108 | 108 | $fU(V|VyvTsG | |
| 109 | @ | 109 | @/FNge(V|n |
| 110 | 110 | C*|d-sQ3u | |
| 111 | 111 | }'SyWP:! | |
| 112 | 112 | 2@yH]2%M{ | |
| 113 | 113 | w» EjTw1E | |
| 114 | 114 | SQ1+ZM1[ | |
| 115 | 115 | ;,A[EA[e | |
| 116 | 116 | BL» BQe*S | |
| 117 | ) | 117 | )O+EP^:% |
| 118 | 118 | k%?(ke><s | |
| 119 | 119 | PcosjUZ{ | |
| 120 | 120 | UyxS.Pl\e | |
| 121 | 121 | E@%T~w·@ | |
| 122 | 122 | DxWlbq"` | |
| 123 | q | 123 | qEw+m>·= |
| 124 | 124 | Wb|ZIo%q | |
| 125 | 125 | 7)*U2~hT | |
| 126 | 126 | dPBa9DW$ | |
| Max diff block lines reached; 40892/71227 bytes (57.41%) of diff not shown. | |||
| Offset 1, 7 lines modified | Offset 1, 7 lines modified | ||
| 1 | Disassembly·of·section·.plt.got: | 1 | Disassembly·of·section·.plt.got: |
| 2 | 0001f0 | 2 | 0001f0a0·<.plt.got>: |
| 3 | » ... | 3 | » ... |
| Offset 1, 5036 lines modified | Offset 1, 5114 lines modified | ||
| 1 | Disassembly·of·section·.text: | 1 | Disassembly·of·section·.text: |
| 2 | 0001f0 | 2 | 0001f0b0·<main.cold>: |
| 3 | » ... | 3 | » ... |
| 4 | 0001f | 4 | 0001f203·<VariantCallerWorker(void*)·[clone·.cold]>: |
| 5 | » ... | 5 | » ... |
| 6 | 0001f2 | 6 | 0001f242·<myorder(BamTools::BamAlignment*,·BamTools::BamAlignment*)·[clone·.cold]>: |
| 7 | » ... | 7 | » ... |
| 8 | 0001f25 | 8 | 0001f256·<std::pair<std::_Rb_tree_iterator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·bool>·std::_Rb_tree<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::_Identity<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>::_M_insert_unique<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>(std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&)·[clone·.isra.0]·[clone·.cold]>: |
| 9 | » ... | 9 | » ... |
| 10 | 0001f28 | 10 | 0001f28a·<std::_Rb_tree_node<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·unsigned·int>·>*·std::_Rb_tree<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·unsigned·int>,·std::_Select1st<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·unsigned·int>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·unsigned·int>·>·>::_M_copy<false,·std::_Rb_tree<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·unsigned·int>,·std::_Select1st<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·unsigned·int>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·unsigned·int>·>·>::_Alloc_node>(std::_Rb_tree_node<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·unsigned·int>·>*,·std::_Rb_tree_node_base*,·std::_Rb_tree<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·unsigned·int>,·std::_Select1st<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·unsigned·int>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·unsigned·int>·>·>::_Alloc_node&)·[clone·.isra.0]·[clone·.cold]>: |
| 11 | » ... | 11 | » ... |
| 12 | 0001f31 | 12 | 0001f316·<BAMWalkerEngine::SaveAlignments(Alignment*)·[clone·.cold]>: |
| 13 | » ... | 13 | » ... |
| 14 | 0001f35 | 14 | 0001f356·<BAMWalkerEngine::RequestReadProcessingTask(Alignment*&)·[clone·.cold]>: |
| 15 | » ... | 15 | » ... |
| 16 | 0001f3c | 16 | 0001f3ca·<BAMWalkerEngine::FinishPositionProcessingTask(std::_List_iterator<PositionInProgress>&)·[clone·.cold]>: |
| 17 | » ... | 17 | » ... |
| 18 | 0001f3 | 18 | 0001f3e0·<BAMWalkerEngine::BAMWalkerEngine()·[clone·.cold]>: |
| 19 | » ... | 19 | » ... |
| 20 | 0001f4a | 20 | 0001f4a6·<BAMWalkerEngine::InitializeBAMs(ReferenceReader·const&,·std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·const&)·[clone·.cold]>: |
| 21 | » ... | 21 | » ... |
| 22 | 0001f53 | 22 | 0001f53a·<BAMWalkerEngine::Initialize(ReferenceReader·const&,·TargetsManager&,·std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·const&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·int)·[clone·.cold]>: |
| 23 | » ... | 23 | » ... |
| 24 | 0001f57 | 24 | 0001f576·<SampleManager::IdentifySample(BamTools::BamAlignment·const&,·int&,·bool&)·const·[clone·.cold]>: |
| 25 | » ... | 25 | » ... |
| 26 | 0001f59 | 26 | 0001f59c·<std::_Rb_tree_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·int>·>·std::_Rb_tree<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·int>,·std::_Select1st<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·int>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·int>·>·>::_M_emplace_hint_unique<std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>,·std::tuple<>·>(std::_Rb_tree_const_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·int>·>,·std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>&&,·std::tuple<>&&)·[clone·.isra.0]·[clone·.cold]>: |
| 27 | » ... | 27 | » ... |
| 28 | 0001f5 | 28 | 0001f5d0·<SampleManager::Initialize(BamTools::SamHeader·const&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&)·[clone·.cold]>: |
| 29 | » ... | 29 | » ... |
| 30 | 0001f5e | 30 | 0001f5e6·<TargetsManager::AddExtraTrim(TargetsManager::UnmergedTarget&,·char*,·int)·[clone·.cold]>: |
| 31 | » ... | 31 | » ... |
| 32 | 0001f64 | 32 | 0001f64e·<TargetsManager::LoadRawTargets(ReferenceReader·const&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·std::__cxx11::list<TargetsManager::UnmergedTarget,·std::allocator<TargetsManager::UnmergedTarget>·>&)·[clone·.cold]>: |
| 33 | » ... | 33 | » ... |
| 34 | 0001f69 | 34 | 0001f694·<TargetsManager::TrimAmpliseqPrimers(Alignment*,·int)·const·[clone·.cold]>: |
| 35 | » ... | 35 | » ... |
| 36 | 0001f85 | 36 | 0001f854·<TargetsManager::Initialize(ReferenceReader·const&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·bool)·[clone·.cold]>: |
| 37 | » ... | 37 | » ... |
| 38 | 0001f | 38 | 0001f90c·<void·arma::arma_stop_bad_alloc<char·[39]>(char·const·(&)·[39])·[clone·.constprop.0]>: |
| 39 | » ... | 39 | » ... |
| 40 | 0001f9 | 40 | 0001f942·<void·arma::arma_stop_logic_error<char·const*>(char·const*·const&)>: |
| 41 | » ... | 41 | » ... |
| 42 | 0001fa | 42 | 0001fa64·<SummarizeInfoFieldsFromEnsemble(EnsembleEval&,·vcf::Variant&,·int)·[clone·.cold]>: |
| 43 | » ... | 43 | » ... |
| 44 | 0001fb | 44 | 0001fb60·<GlueOutputVariant(EnsembleEval&,·VariantCandidate&,·ExtendParameters·const&,·int)·[clone·.cold]>: |
| 45 | » ... | 45 | » ... |
| 46 | 0001f | 46 | 0001fc0e·<EnsembleEval::SpliceAllelesIntoReads(PersistingThreadObjects&,·InputStructures·const&,·ExtendParameters·const&,·ReferenceReader·const&,·int)·[clone·.cold]>: |
| 47 | » ... | 47 | » ... |
| 48 | 0001fc | 48 | 0001fca3·<EnsembleProcessOneVariant(PersistingThreadObjects&,·VariantCallerContext&,·VariantCandidate&,·PositionInProgress·const&)·[clone·.cold]>: |
| 49 | » ... | 49 | » ... |
| 50 | 0001fc | 50 | 0001fcba·<HotspotReader::~HotspotReader()·[clone·.cold]>: |
| 51 | » ... | 51 | » ... |
| 52 | 0001fc | 52 | 0001fcd2·<HotspotReader::HotspotReader()·[clone·.cold]>: |
| 53 | » ... | 53 | » ... |
| 54 | 0001fe | 54 | 0001fe64·<HotspotReader::MakeHintQueue(std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&)·[clone·.cold]>: |
| 55 | » ... | 55 | » ... |
| 56 | 0001ff | 56 | 0001ff60·<HotspotReader::FetchNextVariant()·[clone·.cold]>: |
| 57 | » ... | 57 | » ... |
| 58 | 000200 | 58 | 00020064·<HotspotReader::Initialize(ReferenceReader·const&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&)·[clone·.cold]>: |
| 59 | » ... | 59 | » ... |
| 60 | 000200 | 60 | 000200ac·<MetricsManager::FinalizeAndSave(std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&)·[clone·.cold]>: |
| 61 | » ... | 61 | » ... |
| 62 | 000202 | 62 | 000202a4·<intToString[abi:cxx11](int,·int)·[clone·.cold]>: |
| 63 | » ... | 63 | » ... |
| 64 | 000203 | 64 | 000203b4·<ProgramControlSettings::ProgramControlSettings()·[clone·.cold]>: |
| 65 | » ... | 65 | » ... |
| 66 | 000203 | 66 | 000203c9·<RetrieveParameterInt(OptArgs&,·Json::Value&,·char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·int)·[clone·.cold]>: |
| 67 | » ... | 67 | » ... |
| 68 | 000203 | 68 | 000203e6·<RetrieveParameterDouble(OptArgs&,·Json::Value&,·char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·double)·[clone·.cold]>: |
| 69 | » ... | 69 | » ... |
| 70 | 00020 | 70 | 00020403·<RetrieveParameterBool(OptArgs&,·Json::Value&,·char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·bool)·[clone·.cold]>: |
| 71 | » ... | 71 | » ... |
| 72 | 00020 | 72 | 00020420·<EnsembleEvalTuningParameters::SetOpts(OptArgs&,·Json::Value&)·[clone·.cold]>: |
| 73 | » ... | 73 | » ... |
| 74 | 000205 | 74 | 00020570·<EnsembleEvalTuningParameters::CheckParameterLimits()·[clone·.cold]>: |
| 75 | » ... | 75 | » ... |
| 76 | 000206 | 76 | 000206c0·<ClassifyFilters::SetOpts(OptArgs&,·Json::Value&)·[clone·.cold]>: |
| 77 | » ... | 77 | » ... |
| 78 | 000207 | 78 | 00020768·<ClassifyFilters::CheckParameterLimits()·[clone·.cold]>: |
| 79 | » ... | 79 | » ... |
| 80 | 000207 | 80 | 000207d2·<ControlCallAndFilters::CheckParameterLimits()·[clone·.cold]>: |
| 81 | » ... | 81 | » ... |
| 82 | 00020a | 82 | 00020a5e·<ControlCallAndFilters::SetOpts(OptArgs&,·Json::Value&)·[clone·.cold]>: |
| 83 | » ... | 83 | » ... |
| Max diff block lines reached; 700564/718267 bytes (97.54%) of diff not shown. | |||
| Offset 1, 7 lines modified | Offset 1, 7 lines modified | ||
| 1 | Disassembly·of·section·.fini: | 1 | Disassembly·of·section·.fini: |
| 2 | 000 | 2 | 000f4324·<_fini>: |
| 3 | » ... | 3 | » ... |
| Offset 2, 22034 lines modified | Offset 2, 22429 lines modified | ||
| 2 | String·dump·of·section·'.debug_str': | 2 | String·dump·of·section·'.debug_str': |
| 3 | ··[·····0]··operator/ | 3 | ··[·····0]··operator/ |
| 4 | ··[·····a]··base36to10 | 4 | ··[·····a]··base36to10 |
| 5 | ··[····15]··acc0 | 5 | ··[····15]··acc0 |
| 6 | ··[····1a]··_ZNSt10_Head_baseILj0ERK6AlleleLb0EEC4ESt15allocator_arg_tSt13__uses_alloc0 | 6 | ··[····1a]··_ZNSt10_Head_baseILj0ERK6AlleleLb0EEC4ESt15allocator_arg_tSt13__uses_alloc0 |
| 7 | ··[····66]··_ZNSt10_Head_baseILj0EO6AlleleLb0EEC4ESt15allocator_arg_tSt13__uses_alloc0 | 7 | ··[····66]··_ZNSt10_Head_baseILj0EO6AlleleLb0EEC4ESt15allocator_arg_tSt13__uses_alloc0 | Diff chunk too large, falling back to line-by-line diff (22421 lines added, 22026 lines removed) |
| 8 | ··[····b1]··position0 | 8 | ··[····b1]··position0 |
| 9 | ··[····bb]·· | 9 | ··[····bb]··__q0 |
| 10 | ··[····c | 10 | ··[····c0]··error_message_1 |
| 11 | ··[····d | 11 | ··[····d0]··__fill_a1 |
| 12 | ··[····da]·· | 12 | ··[····da]··acc1 |
| 13 | ··[····df]·· | 13 | ··[····df]··src1 |
| 14 | ··[····e | 14 | ··[····e4]··nuc1 |
| 15 | ··[···· | 15 | ··[····e9]··aux_slice1 |
| 16 | ··[··· | 16 | ··[····f4]··nuc_ensemble1 |
| 17 | ··[···10 | 17 | ··[···102]··scalar_type1 |
| 18 | ··[···1 | 18 | ··[···10f]··val1 |
| 19 | ··[···11 | 19 | ··[···114]··aux_col1 |
| 20 | ··[···1 | 20 | ··[···11d]··A_n1 |
| 21 | ··[···12 | 21 | ··[···122]··my_reason1 |
| 22 | ··[···1 | 22 | ··[···12d]··tmp1 |
| 23 | ··[···1 | 23 | ··[···132]··__q1 |
| 24 | ··[···1 | 24 | ··[···137]··set_stream_err1 |
| 25 | ··[···1 | 25 | ··[···147]··aux_row1 |
| 26 | ··[···1 | 26 | ··[···150]··penalty1 |
| 27 | ··[···1 | 27 | ··[···159]··__value32 |
| 28 | ··[···16 | 28 | ··[···163]··_mm_sub_epi32 |
| 29 | ··[···17 | 29 | ··[···171]··_mm_add_epi32 |
| 30 | ··[···1 | 30 | ··[···17f]··_mm_shuffle_epi32 |
| 31 | ··[···1 | 31 | ··[···191]··_mm_srai_epi32 |
| 32 | ··[···1 | 32 | ··[···1a0]··_mm_cmpeq_epi32 |
| 33 | ··[···1 | 33 | ··[···1b0]··_mm_set_epi32 |
| 34 | ··[···1 | 34 | ··[···1be]··error_message_2 |
| 35 | ··[···1 | 35 | ··[···1ce]··acc2 |
| 36 | ··[···1 | 36 | ··[···1d3]··src2 |
| 37 | ··[···1 | 37 | ··[···1d8]··nuc2 |
| 38 | ··[···1d | 38 | ··[···1dd]··nuc_ensemble2 |
| 39 | ··[···1e | 39 | ··[···1eb]··val2 |
| 40 | ··[···1 | 40 | ··[···1f0]··A_n2 |
| 41 | ··[···1f | 41 | ··[···1f5]··tmp2 |
| 42 | ··[··· | 42 | ··[···1fa]··__q2 |
| 43 | ··[··· | 43 | ··[···1ff]··set_stream_err2 |
| 44 | ··[··· | 44 | ··[···20f]··error_message_3 |
| 45 | ··[··· | 45 | ··[···21f]··acc3 |
| 46 | ··[··· | 46 | ··[···224]··__q3 |
| 47 | ··[··· | 47 | ··[···229]··__value64 |
| 48 | ··[··· | 48 | ··[···233]··error_message_4 |
| 49 | ··[··· | 49 | ··[···243]··ts_NextNuc4 |
| 50 | ··[·· | 50 | ··[···24f]··advanceState4 |
| 51 | ··[·· | 51 | ··[···25d]··ts_Transition4 |
| 52 | ··[·· | 52 | ··[···26c]··_mm_min_epi16 |
| 53 | ··[·· | 53 | ··[···27a]··_Float16 |
| 54 | ··[·· | 54 | ··[···283]··base10to36 |
| 55 | ··[·· | 55 | ··[···28e]··_mm_cvtsi32_si128 |
| 56 | ··[·· | 56 | ··[···2a0]··_mm_load_si128 |
| 57 | ··[·· | 57 | ··[···2af]··_mm_store_si128 |
| 58 | ··[·· | 58 | ··[···2bf]··_mm_setzero_si128 |
| 59 | ··[·· | 59 | ··[···2d1]··_mm_or_si128 |
| 60 | ··[·· | 60 | ··[···2de]··_mm_castps_si128 |
| 61 | ··[·· | 61 | ··[···2ef]··__m128 |
| 62 | ··[·· | 62 | ··[···2f6]··operator%= |
| 63 | ··[·· | 63 | ··[···301]··operator*= |
| 64 | ··[·· | 64 | ··[···30c]··operator/= |
| 65 | ··[·· | 65 | ··[···317]··operator^= |
| 66 | ··[·· | 66 | ··[···322]··reverse_iterator<__gnu_cxx::__normal_iterator<const·std::vector<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>,·std::allocator<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>·>·>*,·std::vector<std::vector<std::vector<LinearFit[·...·truncated·by·diffoscope;·len:·279,·SHA:·1862c104dc5f537272a7130282a17d97e4372328e0d833f920e51f4086bff41a·...·]>·>·>·>·>·> |
| 67 | ··[·· | 67 | ··[···53e]··reverse_iterator<__gnu_cxx::__normal_iterator<std::vector<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>,·std::allocator<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>·>·>*,·std::vector<std::vector<std::vector<LinearFitCell,·[·...·truncated·by·diffoscope;·len:·273,·SHA:·3ff563741b7c4dd725c3bad625a7cd57d1722ac5113e22b7c6b837e3c3cdac64·...·]>·>·>·>·>·> |
| 68 | ··[·· | 68 | ··[···754]··reverse_iterator<__gnu_cxx::__normal_iterator<const·std::vector<std::vector<float,·std::allocator<float>·>,·std::allocator<std::vector<float,·std::allocator<float>·>·>·>*,·std::vector<std::vector<std::vector<float,·std::allocator<float>·>,·std::allo[·...·truncated·by·diffoscope;·len:·183,·SHA:·2322410720a51e092a5c866b89764600b2e67e9dff7edc99cdacf2fcd00f70fc·...·]>·>·>·>·>·> |
| 69 | ··[·· | 69 | ··[···910]··reverse_iterator<__gnu_cxx::__normal_iterator<std::vector<std::vector<float,·std::allocator<float>·>,·std::allocator<std::vector<float,·std::allocator<float>·>·>·>*,·std::vector<std::vector<std::vector<float,·std::allocator<float>·>,·std::allocator<[·...·truncated·by·diffoscope;·len:·177,·SHA:·09faa15faaf2e13c44a06bb3c28e73d28f60fed501d3e001b9cabccb8784ebd2·...·]>·>·>·>·>·> |
| 70 | ··[·· | 70 | ··[···ac6]··__normal_iterator<const·std::vector<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>,·std::allocator<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>·>·>*,·std::vector<std::vector<std::vector<LinearFitCell,·std::allocator<LinearF[·...·truncated·by·diffoscope;·len:·251,·SHA:·fe1de50bfeec31a43c93e35f4cc9894fa2dbdf40532a538c885ebbce716aea0d·...·]>·>·>·>·> |
| 71 | ··[·· | 71 | ··[···cc4]··__normal_iterator<std::vector<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>,·std::allocator<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>·>·>*,·std::vector<std::vector<std::vector<LinearFitCell,·std::allocator<LinearFitCell[·...·truncated·by·diffoscope;·len:·245,·SHA:·d1454354bb5dc6df21f8574705707f03fe105fa8fd0036e4bd74637fc5612e02·...·]>·>·>·>·> |
| 72 | ··[·· | 72 | ··[···ebc]··__normal_iterator<const·std::vector<std::vector<float,·std::allocator<float>·>,·std::allocator<std::vector<float,·std::allocator<float>·>·>·>*,·std::vector<std::vector<std::vector<float,·std::allocator<float>·>,·std::allocator<std::vector<float,·std[·...·truncated·by·diffoscope;·len:·155,·SHA:·598481b311e66b9c3629d7a2a0ab4190dce7e4e12655065a9ecc652f04a09488·...·]>·>·>·>·> |
| 73 | ··[·· | 73 | ··[··105a]··__normal_iterator<std::vector<std::vector<float,·std::allocator<float>·>,·std::allocator<std::vector<float,·std::allocator<float>·>·>·>*,·std::vector<std::vector<std::vector<float,·std::allocator<float>·>,·std::allocator<std::vector<float,·std::allo[·...·truncated·by·diffoscope;·len:·149,·SHA:·df406eb7a1e9a994e89ce292835f5087809023cf62a244e192ba3f3e5fff2bb6·...·]>·>·>·>·> |
| 74 | ··[·· | 74 | ··[··11f2]··reverse_iterator<__gnu_cxx::__normal_iterator<const·std::vector<double,·std::allocator<double>·>*,·std::vector<std::vector<double,·std::allocator<double>·>,·std::allocator<std::vector<double,·std::allocator<double>·>·>·>·>·> |
| 75 | ··[·· | 75 | ··[··12d3]··reverse_iterator<__gnu_cxx::__normal_iterator<std::vector<double,·std::allocator<double>·>*,·std::vector<std::vector<double,·std::allocator<double>·>,·std::allocator<std::vector<double,·std::allocator<double>·>·>·>·>·> |
| 76 | ··[·· | 76 | ··[··13ae]··reverse_iterator<__gnu_cxx::__normal_iterator<const·std::vector<HotspotAllele,·std::allocator<HotspotAllele>·>*,·std::vector<std::vector<HotspotAllele,·std::allocator<HotspotAllele>·>,·std::allocator<std::vector<HotspotAllele,·std::allocator<Hotspot[·...·truncated·by·diffoscope;·len:·8,·SHA:·09418116a6abb1607ab1701cdf393774a96a1348b1f84a0f90a0c2bb6a561a13·...·]>·>·>·>·> |
| 77 | ··[·· | 77 | ··[··14b9]··reverse_iterator<__gnu_cxx::__normal_iterator<std::vector<HotspotAllele,·std::allocator<HotspotAllele>·>*,·std::vector<std::vector<HotspotAllele,·std::allocator<HotspotAllele>·>,·std::allocator<std::vector<HotspotAllele,·std::allocator<HotspotAllele[·...·truncated·by·diffoscope;·len:·2,·SHA:·ec4f8e3d1f7cafbdb86e908b6ad83e407ac36a9b3efabd8e24b56d80228be429·...·]>·>·>·>·> |
| 78 | ··[·· | 78 | ··[··15be]··reverse_iterator<__gnu_cxx::__normal_iterator<const·std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>*,·std::vector<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>,·std::allocator<std::vector<LinearFitCell,·std::allocator<LinearF[·...·truncated·by·diffoscope;·len:·8,·SHA:·aba7fd2d2d1bfb50e1f991e14ef9a1691b9b283cbc11ab7d47e4863b2ddb56f8·...·]>·>·>·>·> |
| 79 | ··[·· | 79 | ··[··16c9]··reverse_iterator<__gnu_cxx::__normal_iterator<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>*,·std::vector<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>,·std::allocator<std::vector<LinearFitCell,·std::allocator<LinearFitCell[·...·truncated·by·diffoscope;·len:·2,·SHA:·ec4f8e3d1f7cafbdb86e908b6ad83e407ac36a9b3efabd8e24b56d80228be429·...·]>·>·>·>·> |
| 80 | ··[·· | 80 | ··[··17ce]··_Vector_base<std::vector<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>,·std::allocator<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>·>·>,·std::allocator<std::vector<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>[·...·truncated·by·diffoscope;·len:·74,·SHA:·5e926c3328f438718579bafcfcfef5d30b139769f564622792711da39e753b68·...·]>·>·>·>·> |
| 81 | ··[·· | 81 | ··[··191b]··vector<std::vector<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>,·std::allocator<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>·>·>,·std::allocator<std::vector<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>,·std:[·...·truncated·by·diffoscope;·len:·68,·SHA:·985b247a119f0e99fe2efa29724d8e79a391ff07738424a71e3dc9982f515dc7·...·]>·>·>·>·> |
| 82 | ··[·· | 82 | ··[··1a62]··allocator_traits<std::allocator<std::vector<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>,·std::allocator<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>·>·>·>·> |
| 83 | ··[·· | 83 | ··[··1b1c]··__type_identity<std::allocator<std::vector<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>,·std::allocator<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>·>·>·>·> |
| 84 | ··[·· | 84 | ··[··1bd5]··reverse_iterator<__gnu_cxx::__normal_iterator<const·std::vector<AlignmentCell,·std::allocator<AlignmentCell>·>*,·std::vector<std::vector<AlignmentCell,·std::allocator<AlignmentCell>·>,·std::allocator<std::vector<AlignmentCell,·std::allocator<Alignme[·...·truncated·by·diffoscope;·len:·8,·SHA:·267fa65f68a1e7bc3e9ab49104a71fc6bedfb5c7e8913fb95870a1fa78d5711c·...·]>·>·>·>·> |
| 85 | ··[·· | 85 | ··[··1ce0]··reverse_iterator<__gnu_cxx::__normal_iterator<std::vector<AlignmentCell,·std::allocator<AlignmentCell>·>*,·std::vector<std::vector<AlignmentCell,·std::allocator<AlignmentCell>·>,·std::allocator<std::vector<AlignmentCell,·std::allocator<AlignmentCell[·...·truncated·by·diffoscope;·len:·2,·SHA:·ec4f8e3d1f7cafbdb86e908b6ad83e407ac36a9b3efabd8e24b56d80228be429·...·]>·>·>·>·> |
| 86 | ··[·· | 86 | ··[··1de5]··destroy<std::pair<const·std::__cxx11::basic_string<char>,·std::map<std::__cxx11::basic_string<char>,·std::vector<std::__cxx11::basic_string<char>,·std::allocator<std::__cxx11::basic_string<char>·>·>·>·>·> |
| 87 | ··[·· | 87 | ··[··1eb2]··reverse_iterator<__gnu_cxx::__normal_iterator<const·std::vector<float,·std::allocator<float>·>*,·std::vector<std::vector<float,·std::allocator<float>·>,·std::allocator<std::vector<float,·std::allocator<float>·>·>·>·>·> |
| 88 | ··[·· | 88 | ··[··1f8d]··reverse_iterator<__gnu_cxx::__normal_iterator<std::vector<float,·std::allocator<float>·>*,·std::vector<std::vector<float,·std::allocator<float>·>,·std::allocator<std::vector<float,·std::allocator<float>·>·>·>·>·> |
| 89 | ··[·· | 89 | ··[··2062]··_Vector_base<std::vector<std::vector<float,·std::allocator<float>·>,·std::allocator<std::vector<float,·std::allocator<float>·>·>·>,·std::allocator<std::vector<std::vector<float,·std::allocator<float>·>,·std::allocator<std::vector<float,·std::allocat[·...·truncated·by·diffoscope;·len:·10,·SHA:·2132034f561d139d90d93b6e544af6edd7cba309bb6e3b43d8526d935a955fc7·...·]>·>·>·>·> |
| 90 | ··[·· | 90 | ··[··216f]··vector<std::vector<std::vector<float,·std::allocator<float>·>,·std::allocator<std::vector<float,·std::allocator<float>·>·>·>,·std::allocator<std::vector<std::vector<float,·std::allocator<float>·>,·std::allocator<std::vector<float,·std::allocator<flo[·...·truncated·by·diffoscope;·len:·4,·SHA:·00c3a3d6dc23895d5deb35d7282bfe30cd93b3a3ce6530dca2001ace70373548·...·]>·>·>·>·> |
| 91 | ··[·· | 91 | ··[··2276]··allocator_traits<std::allocator<std::vector<std::vector<float,·std::allocator<float>·>,·std::allocator<std::vector<float,·std::allocator<float>·>·>·>·>·> |
| 92 | ··[·· | 92 | ··[··2310]··__type_identity<std::allocator<std::vector<std::vector<float,·std::allocator<float>·>,·std::allocator<std::vector<float,·std::allocator<float>·>·>·>·>·> |
| 93 | ··[·· | 93 | ··[··23a9]··_Node_insert_return<std::_Rb_tree_iterator<std::pair<const·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::pair<int,·int>·>·>,·std::_Node_handle<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allo[·...·truncated·by·diffoscope;·len:·286,·SHA:·8ca33cdb075c6e61abab211cc6045ac03514fa60ab5f70eee7222c056642bbe9·...·]>·>·>·>·> |
| 94 | ··[·· | 94 | ··[··25ca]··_Node_insert_return<std::_Rb_tree_iterator<std::pair<unsigned·int·const,·TMetaData>·>,·std::_Node_handle<unsigned·int,·std::pair<unsigned·int·const,·TMetaData>,·std::allocator<std::_Rb_tree_node<std::pair<unsigned·int·const,·TMetaData>·>·>·>·> |
| 95 | ··[·· | 95 | ··[··26be]··_Node_insert_return<std::_Rb_tree_iterator<std::pair<unsigned·int·const,·double>·>,·std::_Node_handle<unsigned·int,·std::pair<unsigned·int·const,·double>,·std::allocator<std::_Rb_tree_node<std::pair<unsigned·int·const,·double>·>·>·>·> |
| 96 | ··[·· | 96 | ··[··27a9]··__normal_iterator<const·std::vector<double,·std::allocator<double>·>*,·std::vector<std::vector<double,·std::allocator<double>·>,·std::allocator<std::vector<double,·std::allocator<double>·>·>·>·> |
| 97 | ··[·· | 97 | ··[··286c]··__normal_iterator<std::vector<double,·std::allocator<double>·>*,·std::vector<std::vector<double,·std::allocator<double>·>,·std::allocator<std::vector<double,·std::allocator<double>·>·>·>·> |
| 98 | ··[·· | 98 | ··[··2929]··__normal_iterator<const·std::vector<HotspotAllele,·std::allocator<HotspotAllele>·>*,·std::vector<std::vector<HotspotAllele,·std::allocator<HotspotAllele>·>,·std::allocator<std::vector<HotspotAllele,·std::allocator<HotspotAllele>·>·>·>·> |
| 99 | ··[·· | 99 | ··[··2a16]··__normal_iterator<std::vector<HotspotAllele,·std::allocator<HotspotAllele>·>*,·std::vector<std::vector<HotspotAllele,·std::allocator<HotspotAllele>·>,·std::allocator<std::vector<HotspotAllele,·std::allocator<HotspotAllele>·>·>·>·> |
| 100 | ··[·· | 100 | ··[··2afd]··_Node_insert_return<std::_Rb_tree_iterator<std::pair<const·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·LinearCalibrationModel>·>,·std::_Node_handle<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::al[·...·truncated·by·diffoscope;·len:·294,·SHA:·d390b020efb4647ff1085ee0c5db5577284fa5dab8f63933b8f6c09bab8cab99·...·]>·>·>·> |
| 101 | ··[·· | 101 | ··[··2d24]··__normal_iterator<const·std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>*,·std::vector<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>,·std::allocator<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>·>·>·> |
| 102 | ··[·· | 102 | ··[··2e11]··__normal_iterator<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>*,·std::vector<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>,·std::allocator<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>·>·>·> |
| 103 | ··[·· | 103 | ··[··2ef8]··__alloc_traits<std::allocator<std::vector<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>,·std::allocator<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>·>·>·>,·std::vector<std::vector<LinearFitCell,·std::allocator<LinearFitCel[·...·truncated·by·diffoscope;·len:·78,·SHA:·37fda8cfcbad19f8ad20e8b22c209567e662d3199ebd1e4fae8e6ccff570b6c3·...·]>·>·>·> |
| 104 | ··[·· | 104 | ··[··3047]··construct<std::vector<std::vector<LinearFitCell>·>,·std::vector<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>,·std::allocator<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>·>·>·> |
| 105 | ··[·· | 105 | ··[··3113]··rebind<std::vector<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>,·std::allocator<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>·>·>·> |
| 106 | ··[·· | 106 | ··[··31b2]··__new_allocator<std::vector<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>,·std::allocator<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>·>·>·> |
| 107 | ··[·· | 107 | ··[··325a]··initializer_list<std::vector<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>,·std::allocator<std::vector<LinearFitCell,·std::allocator<LinearFitCell>·>·>·>·> |
| 108 | ··[·· | 108 | ··[··3303]··__normal_iterator<const·std::vector<AlignmentCell,·std::allocator<AlignmentCell>·>*,·std::vector<std::vector<AlignmentCell,·std::allocator<AlignmentCell>·>,·std::allocator<std::vector<AlignmentCell,·std::allocator<AlignmentCell>·>·>·>·> |
| 109 | ··[·· | 109 | ··[··33f0]··__normal_iterator<std::vector<AlignmentCell,·std::allocator<AlignmentCell>·>*,·std::vector<std::vector<AlignmentCell,·std::allocator<AlignmentCell>·>,·std::allocator<std::vector<AlignmentCell,·std::allocator<AlignmentCell>·>·>·>·> |
| 110 | ··[·· | 110 | ··[··34d7]··destroy<std::pair<const·std::__cxx11::basic_string<char>,·std::vector<std::__cxx11::basic_string<char>,·std::allocator<std::__cxx11::basic_string<char>·>·>·>·> |
| 111 | ··[·· | 111 | ··[··3577]··_Node_insert_return<std::_Rb_tree_iterator<std::pair<const·Allele,·AlleleDetails>·>,·std::_Node_handle<Allele,·std::pair<const·Allele,·AlleleDetails>,·std::allocator<std::_Rb_tree_node<std::pair<const·Allele,·AlleleDetails>·>·>·>·> |
| 112 | ··[·· | 112 | ··[··365f]··reverse_iterator<__gnu_cxx::__normal_iterator<const·std::pair<int,·float>*,·std::vector<std::pair<int,·float>,·std::allocator<std::pair<int,·float>·>·>·>·> |
| 113 | ··[·· | 113 | ··[··36fb]··reverse_iterator<__gnu_cxx::__normal_iterator<std::pair<int,·float>*,·std::vector<std::pair<int,·float>,·std::allocator<std::pair<int,·float>·>·>·>·> |
| 114 | ··[·· | 114 | ··[··3791]··__normal_iterator<const·std::vector<float,·std::allocator<float>·>*,·std::vector<std::vector<float,·std::allocator<float>·>,·std::allocator<std::vector<float,·std::allocator<float>·>·>·>·> |
| 115 | ··[·· | 115 | ··[··384e]··__normal_iterator<std::vector<float,·std::allocator<float>·>*,·std::vector<std::vector<float,·std::allocator<float>·>,·std::allocator<std::vector<float,·std::allocator<float>·>·>·>·> |
| 116 | ··[·· | 116 | ··[··3905]··__alloc_traits<std::allocator<std::vector<std::vector<float,·std::allocator<float>·>,·std::allocator<std::vector<float,·std::allocator<float>·>·>·>·>,·std::vector<std::vector<float,·std::allocator<float>·>,·std::allocator<std::vector<float,·std::all[·...·truncated·by·diffoscope;·len:·14,·SHA:·3423d9e9142a7c0cb0b354c7c92c235b6fece8daea48b0342c320d9e70e0f186·...·]>·>·>·> |
| 117 | ··[·· | 117 | ··[··3a14]··construct<std::vector<std::vector<float>·>,·std::vector<std::vector<float,·std::allocator<float>·>,·std::allocator<std::vector<float,·std::allocator<float>·>·>·>·> |
| 118 | ··[·· | 118 | ··[··3ab8]··rebind<std::vector<std::vector<float,·std::allocator<float>·>,·std::allocator<std::vector<float,·std::allocator<float>·>·>·>·> |
| 119 | ··[·· | 119 | ··[··3b37]··__new_allocator<std::vector<std::vector<float,·std::allocator<float>·>,·std::allocator<std::vector<float,·std::allocator<float>·>·>·>·> |
| 120 | ··[·· | 120 | ··[··3bbf]··initializer_list<std::vector<std::vector<float,·std::allocator<float>·>,·std::allocator<std::vector<float,·std::allocator<float>·>·>·>·> |
| 121 | ··[·· | 121 | ··[··3c48]··_Node_handle<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::pair<const·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::pair<int,·int>·>,·std::allocator<std::_Rb_tree_node<s[·...·truncated·by·diffoscope;·len:·116,·SHA:·a0d9b696a774e0acf59bc985c14bf526d964217af1ae9f91f49ed725268b1501·...·]>·>·>·> |
| 122 | ··[·· | 122 | ··[··3dbd]··_Node_handle_common<std::pair<const·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::pair<int,·int>·>,·std::allocator<std::_Rb_tree_node<std::pair<const·std::__cxx11::basic_string<char,·std::char_traits<char>,·st[·...·truncated·by·diffoscope;·len:·42,·SHA:·d79f7d73ab42cf67f861da483ab61e595546f1ed96a4bb8cd7b8bf201486df41·...·]>·>·>·> |
| 123 | ··[·· | 123 | ··[··3ee8]··allocator_traits<std::allocator<std::_Rb_tree_node<std::pair<const·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::pair<int,·int>·>·>·>·> |
| 124 | ··[·· | 124 | ··[··3f98]··reverse_iterator<__gnu_cxx::__normal_iterator<double**,·std::vector<double*,·std::allocator<double*>·>·>·> |
| 125 | ··[··4 | 125 | ··[··4003]··reverse_iterator<__gnu_cxx::__normal_iterator<double*·const*,·std::vector<double*,·std::allocator<double*>·>·>·> |
| 126 | ··[··4 | 126 | ··[··4074]··reverse_iterator<__gnu_cxx::__normal_iterator<BamTools::BamReader**,·std::vector<BamTools::BamReader*,·std::allocator<BamTools::BamReader*>·>·>·> |
| 127 | ··[··4 | 127 | ··[··4106]··reverse_iterator<__gnu_cxx::__normal_iterator<BamTools::BamReader*·const*,·std::vector<BamTools::BamReader*,·std::allocator<BamTools::BamReader*>·>·>·> |
| Max diff block lines reached; 0/3167184 bytes (0.00%) of diff not shown. | |||
| Offset 4, 19 lines modified | Offset 4, 19 lines modified | ||
| 4 | ··[····15]··./VariantCaller/VariantCaller.cpp | 4 | ··[····15]··./VariantCaller/VariantCaller.cpp |
| 5 | ··[····37]··./VariantCaller | 5 | ··[····37]··./VariantCaller |
| 6 | ··[····47]··/usr/include/c++/12/bits | 6 | ··[····47]··/usr/include/c++/12/bits |
| 7 | ··[····60]··/usr/include/c++/12 | 7 | ··[····60]··/usr/include/c++/12 |
| 8 | ··[····74]··./Util | 8 | ··[····74]··./Util |
| 9 | ··[····7b]··./Calibration | 9 | ··[····7b]··./Calibration |
| 10 | ··[····89]··./external/vcflib | 10 | ··[····89]··./external/vcflib |
| 11 | ··[····9b]··./realignment | ||
| 12 | ··[····a9]··/usr/include/armadillo_bits | ||
| 13 | ··[···· | 11 | ··[····9b]··./VariantCaller/Bookkeeping |
| 12 | ··[····b7]··./BaseCaller | ||
| 13 | ··[····c4]··./realignment | ||
| 14 | ··[····d2]··/usr/include/armadillo_bits | ||
| 14 | ··[····e | 15 | ··[····ee]··./VariantCaller/Bookkeeping/../Splice |
| 15 | ··[···107]··./BaseCaller | ||
| 16 | ··[···114]··/usr/include/c++/12/ext | 16 | ··[···114]··/usr/include/c++/12/ext |
| 17 | ··[···12c]··/usr/include/i386-linux-gnu/bits | 17 | ··[···12c]··/usr/include/i386-linux-gnu/bits |
| 18 | ··[···14d]··/usr/lib/gcc/i686-linux-gnu/12/include | 18 | ··[···14d]··/usr/lib/gcc/i686-linux-gnu/12/include |
| 19 | ··[···174]··/usr/include/i386-linux-gnu/bits/types | 19 | ··[···174]··/usr/include/i386-linux-gnu/bits/types |
| 20 | ··[···19b]··/usr/include/i386-linux-gnu/c++/12/bits | 20 | ··[···19b]··/usr/include/i386-linux-gnu/c++/12/bits |
| 21 | ··[···1c3]··/usr/include/c++/12/debug | 21 | ··[···1c3]··/usr/include/c++/12/debug |
| 22 | ··[···1dd]··/usr/include | 22 | ··[···1dd]··/usr/include |
| Offset 50, 320 lines modified | Offset 50, 325 lines modified | ||
| 50 | ··[···3e3]··stl_map.h | 50 | ··[···3e3]··stl_map.h |
| 51 | ··[···3ed]··OptArgs.h | 51 | ··[···3ed]··OptArgs.h |
| 52 | ··[···3f7]··LinearCalibrationModel.h | 52 | ··[···3f7]··LinearCalibrationModel.h |
| 53 | ··[···410]··fstream | 53 | ··[···410]··fstream |
| 54 | ··[···418]··streambuf | 54 | ··[···418]··streambuf |
| 55 | ··[···422]··istream | 55 | ··[···422]··istream |
| 56 | ··[···42a]··ReferenceReader.h | 56 | ··[···42a]··ReferenceReader.h |
| 57 | ··[···43c]··Realigner.h | ||
| 58 | ··[···448]··SampleManager.h | ||
| 59 | ··[···458]··OrderedVCFWriter.h | ||
| 60 | ··[···46b]··ios_base.h | ||
| 61 | ··[···476]··debug.hpp | ||
| 62 | ··[···480]··ExtendParameters.h | ||
| 63 | ··[···4 | 57 | ··[···43c]··InputStructures.h |
| 58 | ··[···44e]··TreephaserSSE.h | ||
| 64 | ··[···4a5]··stl_multimap.h | ||
| 65 | ··[···4b4]··ErrorMotifs.h | ||
| 66 | ··[···4 | 59 | ··[···45e]··BaseCallerUtils.h |
| 67 | ··[···4 | 60 | ··[···470]··DPTreephaser.h |
| 61 | ··[···47f]··Realigner.h | ||
| 62 | ··[···48b]··SampleManager.h | ||
| 63 | ··[···49b]··OrderedVCFWriter.h | ||
| 64 | ··[···4ae]··ios_base.h | ||
| 65 | ··[···4b9]··debug.hpp | ||
| 66 | ··[···4c3]··ExtendParameters.h | ||
| 67 | ··[···4d6]··stl_multimap.h | ||
| 68 | ··[···4e5]··ErrorMotifs.h | ||
| 68 | ··[···4 | 69 | ··[···4f3]··vector.tcc |
| 69 | ··[···4 | 70 | ··[···4fe]··stl_iterator.h |
| 70 | ··[··· | 71 | ··[···50d]··stl_uninitialized.h |
| 71 | ··[···5 | 72 | ··[···521]··list.tcc |
| 72 | ··[···5 | 73 | ··[···52a]··stl_list.h |
| 73 | ··[···5 | 74 | ··[···535]··move.h |
| 74 | ··[···5 | 75 | ··[···53c]··stl_function.h |
| 75 | ··[···5 | 76 | ··[···54b]··fcntl2.h |
| 76 | ··[···5 | 77 | ··[···554]··stdio2.h |
| 77 | ··[···5 | 78 | ··[···55d]··tuple |
| 78 | ··[···5 | 79 | ··[···563]··stl_heap.h |
| 79 | ··[···5 | 80 | ··[···56e]··predefined_ops.h |
| 80 | ··[···5 | 81 | ··[···57f]··OrderedBAMWriter.h |
| 81 | ··[···5 | 82 | ··[···592]··stl_queue.h |
| 82 | ··[···5 | 83 | ··[···59e]··BAMWalkerEngine.h |
| 83 | ··[···5 | 84 | ··[···5b0]··MetricsManager.h |
| 84 | ··[···5 | 85 | ··[···5c1]··aligned_buffer.h |
| 85 | ··[···5 | 86 | ··[···5d2]··iostream |
| 86 | ··[···5 | 87 | ··[···5db]··fill.hpp |
| 87 | ··[···5 | 88 | ··[···5e4]··hdf5_name.hpp |
| 88 | ··[···5 | 89 | ··[···5f2]··csv_name.hpp |
| 89 | ··[···5 | 90 | ··[···5ff]··op_inv_gen_bones.hpp |
| 90 | ··[···6 | 91 | ··[···614]··glue_solve_bones.hpp |
| 91 | ··[···6 | 92 | ··[···629]··gmm_misc_bones.hpp |
| 92 | ··[···6 | 93 | ··[···63c]··constants.hpp |
| 93 | ··[···6 | 94 | ··[···64a]··stddef.h |
| 94 | ··[···6 | 95 | ··[···653]··stdarg.h |
| 95 | ··[···6 | 96 | ··[···65c]··wint_t.h |
| 96 | ··[···6 | 97 | ··[···665]··__mbstate_t.h |
| 97 | ··[···6 | 98 | ··[···673]··__FILE.h |
| 98 | ··[···6 | 99 | ··[···67c]··struct_FILE.h |
| 99 | ··[···6 | 100 | ··[···68a]··cwchar |
| 100 | ··[···6 | 101 | ··[···691]··type_traits |
| 101 | ··[···6 | 102 | ··[···69d]··c++config.h |
| 102 | ··[···6 | 103 | ··[···6a9]··postypes.h |
| 103 | ··[···6 | 104 | ··[···6b4]··cstdint |
| 104 | ··[···6 | 105 | ··[···6bc]··clocale |
| 105 | ··[···6 | 106 | ··[···6c4]··stl_iterator_base_types.h |
| 106 | ··[···6 | 107 | ··[···6de]··debug.h |
| 107 | ··[···6 | 108 | ··[···6e6]··string_view |
| 108 | ··[···6 | 109 | ··[···6f2]··cstdlib |
| 109 | ··[···6 | 110 | ··[···6fa]··cstdio |
| 110 | ··[··· | 111 | ··[···701]··initializer_list |
| 111 | ··[···7 | 112 | ··[···712]··stringfwd.h |
| 112 | ··[···7 | 113 | ··[···71e]··stl_bvector.h |
| 113 | ··[···7 | 114 | ··[···72c]··cstddef |
| 114 | ··[···7 | 115 | ··[···734]··cstring |
| 115 | ··[···7 | 116 | ··[···73c]··cmath |
| 116 | ··[···7 | 117 | ··[···742]··ctime |
| 117 | ··[···7 | 118 | ··[···748]··exception_ptr.h |
| 118 | ··[···7 | 119 | ··[···758]··locale_classes.h |
| 119 | ··[···7 | 120 | ··[···769]··cwctype |
| 120 | ··[···7 | 121 | ··[···771]··ostream.tcc |
| 121 | ··[···7 | 122 | ··[···77d]··streambuf.tcc |
| 122 | ··[···7 | 123 | ··[···78b]··iosfwd |
| 123 | ··[···7 | 124 | ··[···792]··basic_file.h |
| 124 | ··[···7 | 125 | ··[···79f]··c++io.h |
| 125 | ··[···7 | 126 | ··[···7a7]··uses_allocator.h |
| 126 | ··[···7 | 127 | ··[···7b8]··utility.h |
| 128 | ··[···7c2]··std_abs.h | ||
| 127 | ··[···7 | 129 | ··[···7cc]··functional |
| 128 | ··[···7 | 130 | ··[···7d7]··chrono.h |
| 129 | ··[···7 | 131 | ··[···7e0]··system_error |
| 130 | ··[···7 | 132 | ··[···7ed]··basic_ios.tcc |
| 131 | ··[···7e1]··std_abs.h | ||
| 132 | ··[···7 | 133 | ··[···7fb]··shared_ptr_base.h |
| 133 | ··[··· | 134 | ··[···80d]··ptr_traits.h |
| 134 | ··[···8 | 135 | ··[···81a]··unique_ptr.h |
| 135 | ··[···8 | 136 | ··[···827]··node_handle.h |
| 136 | ··[···8 | 137 | ··[···835]··functexcept.h |
| 137 | ··[···8 | 138 | ··[···843]··ostream_insert.h |
| 138 | ··[···8 | 139 | ··[···854]··fstream.tcc |
| 139 | ··[···8 | 140 | ··[···860]··cpp_type_traits.h |
| 140 | ··[···8 | 141 | ··[···872]··wchar2.h |
| 141 | ··[···8 | 142 | ··[···87b]··struct_tm.h |
| 142 | ··[···8 | 143 | ··[···887]··concurrence.h |
| 143 | ··[···8 | 144 | ··[···895]··stdint-intn.h |
| Max diff block lines reached; 0/20166 bytes (0.00%) of diff not shown. | |||
| Offset 1, 8 lines modified | Offset 1, 8 lines modified | ||
| 1 | Hex·dump·of·section·'.gnu_debugaltlink': | 1 | Hex·dump·of·section·'.gnu_debugaltlink': |
| 2 | ··0x00000000·2f757372·2f6c6962·2f646562·75672f2e·/usr/lib/debug/. | 2 | ··0x00000000·2f757372·2f6c6962·2f646562·75672f2e·/usr/lib/debug/. |
| 3 | ··0x00000010·64777a2f·69333836·2d6c696e·75782d67·dwz/i386-linux-g | 3 | ··0x00000010·64777a2f·69333836·2d6c696e·75782d67·dwz/i386-linux-g |
| 4 | ··0x00000020·6e752f74·76632e64·65627567·00 | 4 | ··0x00000020·6e752f74·76632e64·65627567·00baab79·nu/tvc.debug...y |
| 5 | ··0x00000030· | 5 | ··0x00000030·896f6c2f·e012d0a5·f1bd009f·e4175a15·.ol/..........Z. |
| 6 | ··0x00000040· | 6 | ··0x00000040·a6··································. |
| Offset 83, 29 lines modified | Offset 83, 29 lines modified | ||
| 83 | ··0x00000500·73654550·53743133·5f52625f·74726565·seEPSt13_Rb_tree | 83 | ··0x00000500·73654550·53743133·5f52625f·74726565·seEPSt13_Rb_tree |
| 84 | ··0x00000510·5f6e6f64·65495341·5f452e69·7372612e·_nodeISA_E.isra. | 84 | ··0x00000510·5f6e6f64·65495341·5f452e69·7372612e·_nodeISA_E.isra. |
| 85 | ··0x00000520·30005f5a·4e537438·5f52625f·74726565·0._ZNSt8_Rb_tree | 85 | ··0x00000520·30005f5a·4e537438·5f52625f·74726565·0._ZNSt8_Rb_tree |
| 86 | ··0x00000530·494e5374·375f5f63·78783131·31326261·INSt7__cxx1112ba | 86 | ··0x00000530·494e5374·375f5f63·78783131·31326261·INSt7__cxx1112ba |
| 87 | ··0x00000540·7369635f·73747269·6e674963·53743131·sic_stringIcSt11 | 87 | ··0x00000540·7369635f·73747269·6e674963·53743131·sic_stringIcSt11 |
| 88 | ··0x00000550·63686172·5f747261·69747349·63455361·char_traitsIcESa | 88 | ··0x00000550·63686172·5f747261·69747349·63455361·char_traitsIcESa |
| 89 | ··0x00000560·49634545·45537434·70616972·494b5335·IcEEESt4pairIKS5 | 89 | ··0x00000560·49634545·45537434·70616972·494b5335·IcEEESt4pairIKS5 |
| 90 | ··0x00000570·5f624553·7431305f·53656c65·63743173·_bESt10_Select1s | ||
| 91 | ··0x00000580·74495338·5f455374·346c6573·73495335·tIS8_ESt4lessIS5 | ||
| 92 | ··0x00000590·5f455361·4953385f·4545385f·4d5f6572·_ESaIS8_EE8_M_er | ||
| 93 | ··0x000005a0·61736545·50537431·335f5262·5f747265·aseEPSt13_Rb_tre | ||
| 94 | ··0x000005b0·655f6e6f·64654953·385f452e·69737261·e_nodeIS8_E.isra | ||
| 95 | ··0x000005c0·2e30005f·5a4e5374·385f5262·5f747265·.0._ZNSt8_Rb_tre | ||
| 96 | ··0x000005d0·65494e53·74375f5f·63787831·31313262·eINSt7__cxx1112b | ||
| 97 | ··0x000005e0·61736963·5f737472·696e6749·63537431·asic_stringIcSt1 | ||
| 98 | ··0x000005f0·31636861·725f7472·61697473·49634553·1char_traitsIcES | ||
| 99 | ··0x00000600·61496345·45455374·34706169·72494b53·aIcEEESt4pairIKS | ||
| 100 | ··0x00000 | 90 | ··0x00000570·5f53365f·49696945·45537431·305f5365·_S6_IiiEESt10_Se |
| 91 | ··0x00000580·6c656374·31737449·53395f45·5374346c·lect1stIS9_ESt4l | ||
| 92 | ··0x00000590·65737349·53355f45·53614953·395f4545·essIS5_ESaIS9_EE | ||
| 93 | ··0x000005a0·385f4d5f·65726173·65455053·7431335f·8_M_eraseEPSt13_ | ||
| 94 | ··0x000005b0·52625f74·7265655f·6e6f6465·4953395f·Rb_tree_nodeIS9_ | ||
| 95 | ··0x000005c0·452e6973·72612e30·005f5a4e·5374385f·E.isra.0._ZNSt8_ | ||
| 96 | ··0x000005d0·52625f74·72656549·4e537437·5f5f6378·Rb_treeINSt7__cx | ||
| 97 | ··0x000005e0·78313131·32626173·69635f73·7472696e·x1112basic_strin | ||
| 98 | ··0x000005f0·67496353·74313163·6861725f·74726169·gIcSt11char_trai | ||
| 99 | ··0x00000600·74734963·45536149·63454545·53743470·tsIcESaIcEEESt4p | ||
| 100 | ··0x00000610·61697249·4b53355f·62455374·31305f53·airIKS5_bESt10_S | ||
| 101 | ··0x00000620·656c6563·74317374·49533 | 101 | ··0x00000620·656c6563·74317374·4953385f·45537434·elect1stIS8_ESt4 |
| 102 | ··0x00000630·6c657373·4953355f·45536149·533 | 102 | ··0x00000630·6c657373·4953355f·45536149·53385f45·lessIS5_ESaIS8_E |
| 103 | ··0x00000640·45385f4d·5f657261·73654550·53743133·E8_M_eraseEPSt13 | 103 | ··0x00000640·45385f4d·5f657261·73654550·53743133·E8_M_eraseEPSt13 |
| 104 | ··0x00000650·5f52625f·74726565·5f6e6f64·6549533 | 104 | ··0x00000650·5f52625f·74726565·5f6e6f64·65495338·_Rb_tree_nodeIS8 |
| 105 | ··0x00000660·5f452e69·7372612e·30005f5a·4e537438·_E.isra.0._ZNSt8 | 105 | ··0x00000660·5f452e69·7372612e·30005f5a·4e537438·_E.isra.0._ZNSt8 |
| 106 | ··0x00000670·5f52625f·74726565·494e5374·375f5f63·_Rb_treeINSt7__c | 106 | ··0x00000670·5f52625f·74726565·494e5374·375f5f63·_Rb_treeINSt7__c |
| 107 | ··0x00000680·78783131·31326261·7369635f·73747269·xx1112basic_stri | 107 | ··0x00000680·78783131·31326261·7369635f·73747269·xx1112basic_stri |
| 108 | ··0x00000690·6e674963·53743131·63686172·5f747261·ngIcSt11char_tra | 108 | ··0x00000690·6e674963·53743131·63686172·5f747261·ngIcSt11char_tra |
| 109 | ··0x000006a0·69747349·63455361·49634545·45537434·itsIcESaIcEEESt4 | 109 | ··0x000006a0·69747349·63455361·49634545·45537434·itsIcESaIcEEESt4 |
| 110 | ··0x000006b0·70616972·494b5335·5f53355f·45537431·pairIKS5_S5_ESt1 | 110 | ··0x000006b0·70616972·494b5335·5f53355f·45537431·pairIKS5_S5_ESt1 |
| 111 | ··0x000006c0·305f5365·6c656374·31737449·53385f45·0_Select1stIS8_E | 111 | ··0x000006c0·305f5365·6c656374·31737449·53385f45·0_Select1stIS8_E |
| Offset 135, 25 lines modified | Offset 135, 25 lines modified | ||
| 135 | ··0x00000840·4c4f4241·4c5f5f73·75625f49·5f5f5a32·LOBAL__sub_I__Z2 | 135 | ··0x00000840·4c4f4241·4c5f5f73·75625f49·5f5f5a32·LOBAL__sub_I__Z2 |
| 136 | ··0x00000850·35546865·53696c65·6e63654f·66546865·5TheSilenceOfThe | 136 | ··0x00000850·35546865·53696c65·6e63654f·66546865·5TheSilenceOfThe |
| 137 | ··0x00000860·41726d61·64696c6c·6f735253·74313462·ArmadillosRSt14b | 137 | ··0x00000860·41726d61·64696c6c·6f735253·74313462·ArmadillosRSt14b |
| 138 | ··0x00000870·61736963·5f6f6673·74726561·6d496353·asic_ofstreamIcS | 138 | ··0x00000870·61736963·5f6f6673·74726561·6d496353·asic_ofstreamIcS |
| 139 | ··0x00000880·74313163·6861725f·74726169·74734963·t11char_traitsIc | 139 | ··0x00000880·74313163·6861725f·74726169·74734963·t11char_traitsIc |
| 140 | ··0x00000890·4545005f·5a53744c·385f5f69·6f696e69·EE._ZStL8__ioini | 140 | ··0x00000890·4545005f·5a53744c·385f5f69·6f696e69·EE._ZStL8__ioini |
| 141 | ··0x000008a0·74004241·4d57616c·6b657245·6e67696e·t.BAMWalkerEngin | 141 | ··0x000008a0·74004241·4d57616c·6b657245·6e67696e·t.BAMWalkerEngin |
| 142 | ··0x000008b0·652e6370·70005f5a·4e53743 | 142 | ··0x000008b0·652e6370·70005f5a·4e537437·5f5f6378·e.cpp._ZNSt7__cx |
| 143 | ··0x000008c0·78313131·32626173·69635f73·7472696e·x1112basic_strin | ||
| 144 | ··0x000008d0·67496353·74313163·6861725f·74726169·gIcSt11char_trai | ||
| 145 | ··0x000008e0·74734963·45536149·63454531·325f4d5f·tsIcESaIcEE12_M_ | ||
| 146 | ··0x000008f0·636f6e73·74727563·7449504b·63454576·constructIPKcEEv | ||
| 147 | ··0x00000900·545f5338·5f537432·30666f72·77617264·T_S8_St20forward | ||
| 148 | ··0x00000910·5f697465·7261746f·725f7461·672e6973·_iterator_tag.is | ||
| 149 | ··0x00000920·72612e30·005f5a4e·53743676·6563746f·ra.0._ZNSt6vecto | ||
| 143 | ··0x00000 | 150 | ··0x00000930·72494e38·42616d54·6f6f6c73·37436967·rIN8BamTools7Cig |
| 144 | ··0x00000 | 151 | ··0x00000940·61724f70·45536149·53315f45·45615345·arOpESaIS1_EEaSE |
| 145 | ··0x00000 | 152 | ··0x00000950·524b5333·5f2e6973·72612e30·005f5a4c·RKS3_.isra.0._ZL |
| 146 | ··0x000008f0·4e537437·5f5f6378·78313131·32626173·NSt7__cxx1112bas | ||
| 147 | ··0x00000900·69635f73·7472696e·67496353·74313163·ic_stringIcSt11c | ||
| 148 | ··0x00000910·6861725f·74726169·74734963·45536149·har_traitsIcESaI | ||
| 149 | ··0x00000920·63454531·325f4d5f·636f6e73·74727563·cEE12_M_construc | ||
| 150 | ··0x00000930·7449504b·63454576·545f5338·5f537432·tIPKcEEvT_S8_St2 | ||
| 151 | ··0x00000940·30666f72·77617264·5f697465·7261746f·0forward_iterato | ||
| 152 | ··0x00000950·725f7461·672e6973·72612e30·005f5a4c·r_tag.isra.0._ZL | ||
| 153 | ··0x00000960·376d796f·72646572·504e3842·616d546f·7myorderPN8BamTo | 153 | ··0x00000960·376d796f·72646572·504e3842·616d546f·7myorderPN8BamTo |
| 154 | ··0x00000970·6f6c7331·3242616d·416c6967·6e6d656e·ols12BamAlignmen | 154 | ··0x00000970·6f6c7331·3242616d·416c6967·6e6d656e·ols12BamAlignmen |
| 155 | ··0x00000980·74455331·5f005f5a·4c313570·72656669·tES1_._ZL15prefi | 155 | ··0x00000980·74455331·5f005f5a·4c313570·72656669·tES1_._ZL15prefi |
| 156 | ··0x00000990·785f6578·636c7564·655f005f·5a4c376d·x_exclude_._ZL7m | 156 | ··0x00000990·785f6578·636c7564·655f005f·5a4c376d·x_exclude_._ZL7m |
| 157 | ··0x000009a0·796f7264·6572504e·3842616d·546f6f6c·yorderPN8BamTool | 157 | ··0x000009a0·796f7264·6572504e·3842616d·546f6f6c·yorderPN8BamTool |
| 158 | ··0x000009b0·73313242·616d416c·69676e6d·656e7445·s12BamAlignmentE | 158 | ··0x000009b0·73313242·616d416c·69676e6d·656e7445·s12BamAlignmentE |
| 159 | ··0x000009c0·53315f2e·636f6c64·005f5a4e·5374385f·S1_.cold._ZNSt8_ | 159 | ··0x000009c0·53315f2e·636f6c64·005f5a4e·5374385f·S1_.cold._ZNSt8_ |
| Offset 179, 57 lines modified | Offset 179, 57 lines modified | ||
| 179 | ··0x00000b00·45455374·34706169·72495374·31375f52·EESt4pairISt17_R | 179 | ··0x00000b00·45455374·34706169·72495374·31375f52·EESt4pairISt17_R |
| 180 | ··0x00000b10·625f7472·65655f69·74657261·746f7249·b_tree_iteratorI | 180 | ··0x00000b10·625f7472·65655f69·74657261·746f7249·b_tree_iteratorI |
| 181 | ··0x00000b20·53355f45·62454f54·5f2e6973·72612e30·S5_EbEOT_.isra.0 | 181 | ··0x00000b20·53355f45·62454f54·5f2e6973·72612e30·S5_EbEOT_.isra.0 |
| 182 | ··0x00000b30·2e636f6c·64005f5a·4e537438·5f52625f·.cold._ZNSt8_Rb_ | 182 | ··0x00000b30·2e636f6c·64005f5a·4e537438·5f52625f·.cold._ZNSt8_Rb_ |
| 183 | ··0x00000b40·74726565·494e5374·375f5f63·78783131·treeINSt7__cxx11 | 183 | ··0x00000b40·74726565·494e5374·375f5f63·78783131·treeINSt7__cxx11 |
| 184 | ··0x00000b50·31326261·7369635f·73747269·6e674963·12basic_stringIc | 184 | ··0x00000b50·31326261·7369635f·73747269·6e674963·12basic_stringIc |
| 185 | ··0x00000b60·53743131·63686172·5f747261·69747349·St11char_traitsI | 185 | ··0x00000b60·53743131·63686172·5f747261·69747349·St11char_traitsI |
| 186 | ··0x00000b70·63455361·49634545·4553 | 186 | ··0x00000b70·63455361·49634545·4553355f·5374395f·cESaIcEEES5_St9_ |
| 187 | ··0x00000b80·4964656e·74697479·4953355f·45537434·IdentityIS5_ESt4 | ||
| 187 | ··0x00000b80·494b5335·5f6a4553·7431305f·53656c65·IKS5_jESt10_Sele | ||
| 188 | ··0x00000b90·63743173·74495338·5f455374·346c6573·ct1stIS8_ESt4les | ||
| 189 | ··0x00000b | 188 | ··0x00000b90·6c657373·4953355f·45536149·53355f45·lessIS5_ESaIS5_E |
| 190 | ··0x00000b | 189 | ··0x00000ba0·45385f4d·5f657261·73654550·53743133·E8_M_eraseEPSt13 |
| 191 | ··0x00000b | 190 | ··0x00000bb0·5f52625f·74726565·5f6e6f64·65495335·_Rb_tree_nodeIS5 |
| 192 | ··0x00000b | 191 | ··0x00000bc0·5f452e69·7372612e·30005f5a·4e537438·_E.isra.0._ZNSt8 |
| 193 | ··0x00000be0·5f747265·65494e53·74375f5f·63787831·_treeINSt7__cxx1 | ||
| 194 | ··0x00000bf0·31313262·61736963·5f737472·696e6749·112basic_stringI | ||
| 195 | ··0x00000c00·63537431·31636861·725f7472·61697473·cSt11char_traits | ||
| 196 | ··0x00000c10·49634553·61496345·45455374·34706169·IcESaIcEEESt4pai | ||
| 197 | ··0x00000c20·72494b53·355f6a45·53743130·5f53656c·rIKS5_jESt10_Sel | ||
| 198 | ··0x00000c30·65637431·73744953·385f4553·74346c65·ect1stIS8_ESt4le | ||
| 199 | ··0x00000c40·73734953·355f4553·61495338·5f454537·ssIS5_ESaIS8_EE7 | ||
| 200 | ··0x00000c50·5f4d5f63·6f707949·4c623045·4e53455f·_M_copyILb0ENSE_ | ||
| 201 | ··0x00000c60·31315f41·6c6c6f63·5f6e6f64·65454545·11_Alloc_nodeEEE | ||
| 202 | ··0x00000c70·50537431·335f5262·5f747265·655f6e6f·PSt13_Rb_tree_no | ||
| 203 | ··0x00000c80·64654953·385f4553·4a5f5053·7431385f·deIS8_ESJ_PSt18_ | ||
| 204 | ··0x00000c90·52625f74·7265655f·6e6f6465·5f626173·Rb_tree_node_bas | ||
| 205 | ··0x00000ca0·65525430·5f2e6973·72612e30·005f5a4e·eRT0_.isra.0._ZN | ||
| 206 | ··0x00000cb0·5374385f·52625f74·72656549·4e537437·St8_Rb_treeINSt7 | ||
| 207 | ··0x00000cc0·5f5f6378·78313131·32626173·69635f73·__cxx1112basic_s | ||
| 208 | ··0x00000cd0·7472696e·67496353·74313163·6861725f·tringIcSt11char_ | ||
| 209 | ··0x00000ce0·74726169·74734963·45536149·63454545·traitsIcESaIcEEE | ||
| 210 | ··0x00000cf0·53743470·61697249·4b53355f·6a455374·St4pairIKS5_jESt | ||
| 211 | ··0x00000d00·31305f53·656c6563·74317374·4953385f·10_Select1stIS8_ | ||
| 212 | ··0x00000d10·45537434·6c657373·4953355f·45536149·ESt4lessIS5_ESaI | ||
| 213 | ··0x00000d20·53385f45·45375f4d·5f636f70·79494c62·S8_EE7_M_copyILb | ||
| 214 | ··0x00000d30·30454e53·455f3131·5f416c6c·6f635f6e·0ENSE_11_Alloc_n | ||
| 215 | ··0x00000d40·6f646545·45455053·7431335f·52625f74·odeEEEPSt13_Rb_t | ||
| 216 | ··0x00000d50·7265655f·6e6f6465·4953385f·45534a5f·ree_nodeIS8_ESJ_ | ||
| 217 | ··0x00000d60·50537431·385f5262·5f747265·655f6e6f·PSt18_Rb_tree_no | ||
| 218 | ··0x00000d70·64655f62·61736552·54305f2e·69737261·de_baseRT0_.isra | ||
| 219 | ··0x00000d80·2e302e63·6f6c6400·5f5a4e53·74385f52·.0.cold._ZNSt8_R | ||
| 220 | ··0x00000 | 192 | ··0x00000bd0·5f52625f·74726565·494e5374·375f5f63·_Rb_treeINSt7__c |
| 221 | ··0x00000 | 193 | ··0x00000be0·78783131·31326261·7369635f·73747269·xx1112basic_stri |
| 222 | ··0x00000 | 194 | ··0x00000bf0·6e674963·53743131·63686172·5f747261·ngIcSt11char_tra |
| 223 | ··0x00000dc0·73496345·53614963·45454553·355f5374·sIcESaIcEEES5_St | ||
| 224 | ··0x00000 | 195 | ··0x00000c00·69747349·63455361·49634545·45537434·itsIcESaIcEEESt4 |
| 196 | ··0x00000c10·70616972·494b5335·5f6a4553·7431305f·pairIKS5_jESt10_ | ||
| 197 | ··0x00000c20·53656c65·63743173·74495338·5f455374·Select1stIS8_ESt | ||
| 198 | ··0x00000c30·346c6573·73495335·5f455361·4953385f·4lessIS5_ESaIS8_ | ||
| 199 | ··0x00000c40·4545385f·4d5f6572·61736545·50537431·EE8_M_eraseEPSt1 | ||
| 200 | ··0x00000c50·335f5262·5f747265·655f6e6f·64654953·3_Rb_tree_nodeIS | ||
| 201 | ··0x00000c60·385f452e·69737261·2e30005f·5a4e5374·8_E.isra.0._ZNSt | ||
| 202 | ··0x00000c70·385f5262·5f747265·65494e53·74375f5f·8_Rb_treeINSt7__ | ||
| Max diff block lines reached; 741229/752884 bytes (98.45%) of diff not shown. | |||
| Offset 4, 17 lines modified | Offset 4, 17 lines modified | ||
| 4 | ··Data:······························2's·complement,·little·endian | 4 | ··Data:······························2's·complement,·little·endian |
| 5 | ··Version:···························1·(current) | 5 | ··Version:···························1·(current) |
| 6 | ··OS/ABI:····························UNIX·-·System·V | 6 | ··OS/ABI:····························UNIX·-·System·V |
| 7 | ··ABI·Version:·······················0 | 7 | ··ABI·Version:·······················0 |
| 8 | ··Type:······························DYN·(Shared·object·file) | 8 | ··Type:······························DYN·(Shared·object·file) |
| 9 | ··Machine:···························Intel·80386 | 9 | ··Machine:···························Intel·80386 |
| 10 | ··Version:···························0x1 | 10 | ··Version:···························0x1 |
| 11 | ··Entry·point·address:···············0xa3 | 11 | ··Entry·point·address:···············0xa390 |
| 12 | ··Start·of·program·headers:··········52·(bytes·into·file) | 12 | ··Start·of·program·headers:··········52·(bytes·into·file) |
| 13 | ··Start·of·section·headers:··········8 | 13 | ··Start·of·section·headers:··········833408·(bytes·into·file) |
| 14 | ··Flags:·····························0x0 | 14 | ··Flags:·····························0x0 |
| 15 | ··Size·of·this·header:···············52·(bytes) | 15 | ··Size·of·this·header:···············52·(bytes) |
| 16 | ··Size·of·program·headers:···········32·(bytes) | 16 | ··Size·of·program·headers:···········32·(bytes) |
| 17 | ··Number·of·program·headers:·········11 | 17 | ··Number·of·program·headers:·········11 |
| 18 | ··Size·of·section·headers:···········40·(bytes) | 18 | ··Size·of·section·headers:···········40·(bytes) |
| 19 | ··Number·of·section·headers:·········40 | 19 | ··Number·of·section·headers:·········40 |
| 20 | ··Section·header·string·table·index:·39 | 20 | ··Section·header·string·table·index:·39 |
| Offset 1, 25 lines modified | Offset 1, 25 lines modified | ||
| 1 | Elf·file·type·is·DYN·(Shared·object·file) | 1 | Elf·file·type·is·DYN·(Shared·object·file) |
| 2 | Entry·point·0xa3 | 2 | Entry·point·0xa390 |
| 3 | There·are·11·program·headers,·starting·at·offset·52 | 3 | There·are·11·program·headers,·starting·at·offset·52 |
| 4 | Program·Headers: | 4 | Program·Headers: |
| 5 | ··Type···········Offset···VirtAddr···PhysAddr···FileSiz·MemSiz··Flg·Align | 5 | ··Type···········Offset···VirtAddr···PhysAddr···FileSiz·MemSiz··Flg·Align |
| 6 | ··PHDR···········0x000034·0x00000034·0x00000034·0x00160·0x00160·R···0x4 | 6 | ··PHDR···········0x000034·0x00000034·0x00000034·0x00160·0x00160·R···0x4 |
| 7 | ··INTERP·········0x000194·0x00000194·0x00000194·0x00000·0x00013·R···0x1 | 7 | ··INTERP·········0x000194·0x00000194·0x00000194·0x00000·0x00013·R···0x1 |
| 8 | ··LOAD···········0x000000·0x00000000·0x00000000·0x001ec·0x07 | 8 | ··LOAD···········0x000000·0x00000000·0x00000000·0x001ec·0x07788·R···0x1000 |
| 9 | ··LOAD···········0x000000·0x00008000·0x00008000·0x00000·0x2 | 9 | ··LOAD···········0x000000·0x00008000·0x00008000·0x00000·0x23a58·R·E·0x1000 |
| 10 | ··LOAD···········0x000000·0x0002 | 10 | ··LOAD···········0x000000·0x0002c000·0x0002c000·0x00000·0x09281·R···0x1000 |
| 11 | ··LOAD···········0x000e6c·0x0003 | 11 | ··LOAD···········0x000e6c·0x00036e6c·0x00036e6c·0x00000·0x00424·RW··0x1000 |
| 12 | ··DYNAMIC········0x000e6c·0x0003 | 12 | ··DYNAMIC········0x000e6c·0x00036e88·0x00036e88·0x00000·0x00110·RW··0x4 |
| 13 | ··NOTE···········0x0001a8·0x000001a8·0x000001a8·0x00044·0x00044·R···0x4 | 13 | ··NOTE···········0x0001a8·0x000001a8·0x000001a8·0x00044·0x00044·R···0x4 |
| 14 | ··GNU_EH_FRAME···0x001000·0x0002 | 14 | ··GNU_EH_FRAME···0x001000·0x0002e398·0x0002e398·0x00000·0x00814·R···0x4 |
| 15 | ··GNU_STACK······0x000000·0x00000000·0x00000000·0x00000·0x00000·RW··0x10 | 15 | ··GNU_STACK······0x000000·0x00000000·0x00000000·0x00000·0x00000·RW··0x10 |
| 16 | ··GNU_RELRO······0x000e6c·0x0003 | 16 | ··GNU_RELRO······0x000e6c·0x00036e6c·0x00036e6c·0x00000·0x00194·R···0x1 |
| 17 | ·Section·to·Segment·mapping: | 17 | ·Section·to·Segment·mapping: |
| 18 | ··Segment·Sections... | 18 | ··Segment·Sections... |
| 19 | ···00····· | 19 | ···00····· |
| 20 | ···01·····.interp· | 20 | ···01·····.interp· |
| 21 | ···02·····.interp·.note.gnu.build-id·.note.ABI-tag·.gnu.hash·.dynsym·.dynstr·.gnu.version·.gnu.version_r·.rel.dyn·.rel.plt· | 21 | ···02·····.interp·.note.gnu.build-id·.note.ABI-tag·.gnu.hash·.dynsym·.dynstr·.gnu.version·.gnu.version_r·.rel.dyn·.rel.plt· |
| 22 | ···03·····.init·.plt·.plt.got·.text·.fini· | 22 | ···03·····.init·.plt·.plt.got·.text·.fini· |
| Offset 1, 49 lines modified | Offset 1, 49 lines modified | ||
| 1 | There·are·40·section·headers,·starting·at·offset·0xc | 1 | There·are·40·section·headers,·starting·at·offset·0xcb780: |
| 2 | Section·Headers: | 2 | Section·Headers: |
| 3 | ··[Nr]·Name··············Type············Addr·····Off····Size···ES·Flg·Lk·Inf·Al | 3 | ··[Nr]·Name··············Type············Addr·····Off····Size···ES·Flg·Lk·Inf·Al |
| 4 | ··[·0]···················NULL············00000000·000000·000000·00······0···0··0 | 4 | ··[·0]···················NULL············00000000·000000·000000·00······0···0··0 |
| 5 | ··[·1]·.interp···········NOBITS··········00000194·000194·000013·00···A··0···0··1 | 5 | ··[·1]·.interp···········NOBITS··········00000194·000194·000013·00···A··0···0··1 |
| 6 | ··[·2]·.note.gnu.build-id·NOTE············000001a8·0001a8·000024·00···A··0···0··4 | 6 | ··[·2]·.note.gnu.build-id·NOTE············000001a8·0001a8·000024·00···A··0···0··4 |
| 7 | ··[·3]·.note.ABI-tag·····NOTE············000001cc·0001cc·000020·00···A··0···0··4 | 7 | ··[·3]·.note.ABI-tag·····NOTE············000001cc·0001cc·000020·00···A··0···0··4 |
| 8 | ··[·4]·.gnu.hash·········NOBITS··········000001ec·0001ec·00073 | 8 | ··[·4]·.gnu.hash·········NOBITS··········000001ec·0001ec·00073c·04···A··5···0··4 |
| 9 | ··[·5]·.dynsym···········NOBITS··········0000092 | 9 | ··[·5]·.dynsym···········NOBITS··········00000928·0001ec·0017d0·10···A··6···1··4 |
| 10 | ··[·6]·.dynstr···········NOBITS··········00002 | 10 | ··[·6]·.dynstr···········NOBITS··········000020f8·0001ec·004c2b·00···A··0···0··1 |
| 11 | ··[·7]·.gnu.version······NOBITS··········00006 | 11 | ··[·7]·.gnu.version······NOBITS··········00006d24·0001ec·0002fa·02···A··5···0··2 |
| 12 | ··[·8]·.gnu.version_r····NOBITS··········00007 | 12 | ··[·8]·.gnu.version_r····NOBITS··········00007020·0001ec·000170·00···A··6···3··4 |
| 13 | ··[·9]·.rel.dyn··········NOBITS··········00007 | 13 | ··[·9]·.rel.dyn··········NOBITS··········00007190·0001ec·000100·08···A··5···0··4 |
| 14 | ··[10]·.rel.plt··········NOBITS··········00007 | 14 | ··[10]·.rel.plt··········NOBITS··········00007290·0001ec·0004f8·08···A··5··24··4 |
| 15 | ··[11]·.init·············NOBITS··········00008000·001000·000020·00··AX··0···0··4 | 15 | ··[11]·.init·············NOBITS··········00008000·001000·000020·00··AX··0···0··4 |
| 16 | ··[12]·.plt··············NOBITS··········00008020·001000·000a | 16 | ··[12]·.plt··············NOBITS··········00008020·001000·000a00·04··AX··0···0·16 |
| 17 | ··[13]·.plt.got··········NOBITS··········00008a | 17 | ··[13]·.plt.got··········NOBITS··········00008a20·001000·000008·08··AX··0···0··8 |
| 18 | ··[14]·.text·············NOBITS··········00008a | 18 | ··[14]·.text·············NOBITS··········00008a30·001000·023014·00··AX··0···0·16 |
| 19 | ··[15]·.fini·············NOBITS··········0002 | 19 | ··[15]·.fini·············NOBITS··········0002ba44·001000·000014·00··AX··0···0··4 |
| 20 | ··[16]·.rodata···········NOBITS··········0002 | 20 | ··[16]·.rodata···········NOBITS··········0002c000·001000·002396·00···A··0···0·16 |
| 21 | ··[17]·.eh_frame_hdr·····NOBITS··········0002 | 21 | ··[17]·.eh_frame_hdr·····NOBITS··········0002e398·001000·000814·00···A··0···0··4 |
| 22 | ··[18]·.eh_frame·········NOBITS··········0002 | 22 | ··[18]·.eh_frame·········NOBITS··········0002ebac·001000·0054b0·00···A··0···0··4 |
| 23 | ··[19]·.gcc_except_table·NOBITS··········00034 | 23 | ··[19]·.gcc_except_table·NOBITS··········0003405c·001000·001225·00···A··0···0··4 |
| 24 | ··[20]·.init_array·······NOBITS··········0003 | 24 | ··[20]·.init_array·······NOBITS··········00036e6c·000e6c·000018·04··WA··0···0··4 |
| 25 | ··[21]·.fini_array·······NOBITS··········0003 | 25 | ··[21]·.fini_array·······NOBITS··········00036e84·000e6c·000004·04··WA··0···0··4 |
| 26 | ··[22]·.dynamic··········NOBITS··········0003 | 26 | ··[22]·.dynamic··········NOBITS··········00036e88·000e6c·000110·08··WA··6···0··4 |
| 27 | ··[23]·.got··············NOBITS··········0003 | 27 | ··[23]·.got··············NOBITS··········00036f98·000e6c·00005c·04··WA··0···0··4 |
| 28 | ··[24]·.got.plt··········NOBITS··········0003 | 28 | ··[24]·.got.plt··········NOBITS··········00036ff4·000e6c·000288·04··WA··0···0··4 |
| 29 | ··[25]·.data·············NOBITS··········0003 | 29 | ··[25]·.data·············NOBITS··········0003727c·000e6c·00000c·00··WA··0···0··4 |
| 30 | ··[26]·.bss··············NOBITS··········0003 | 30 | ··[26]·.bss··············NOBITS··········00037288·000e6c·000008·00··WA··0···0··1 |
| 31 | ··[27]·.comment··········PROGBITS········00000000·0001ec·00001f·01··MS··0···0··1 | 31 | ··[27]·.comment··········PROGBITS········00000000·0001ec·00001f·01··MS··0···0··1 |
| 32 | ··[28]·.debug_aranges····PROGBITS········00000000·00020c·00029 | 32 | ··[28]·.debug_aranges····PROGBITS········00000000·00020c·000296·00···C··0···0··4 |
| 33 | ··[29]·.debug_info·······PROGBITS········00000000·0004a | 33 | ··[29]·.debug_info·······PROGBITS········00000000·0004a4·07ef46·00···C··0···0··4 |
| 34 | ··[30]·.debug_abbrev·····PROGBITS········00000000·0 | 34 | ··[30]·.debug_abbrev·····PROGBITS········00000000·07f3ec·001e32·00···C··0···0··4 |
| 35 | ··[31]·.debug_line·······PROGBITS········00000000·08 | 35 | ··[31]·.debug_line·······PROGBITS········00000000·081220·012727·00···C··0···0··4 |
| 36 | ··[32]·.debug_str········PROGBITS········00000000·09 | 36 | ··[32]·.debug_str········PROGBITS········00000000·093948·0035a6·01·MSC··0···0··4 |
| 37 | ··[33]·.debug_line_str···PROGBITS········00000000·09 | 37 | ··[33]·.debug_line_str···PROGBITS········00000000·096ef0·0003e4·01·MSC··0···0··4 |
| 38 | ··[34]·.debug_loclists···PROGBITS········00000000·09 | 38 | ··[34]·.debug_loclists···PROGBITS········00000000·0972d4·022bf7·00···C··0···0··4 |
| 39 | ··[35]·.debug_rnglists···PROGBITS········00000000·0b | 39 | ··[35]·.debug_rnglists···PROGBITS········00000000·0b9ecc·00861b·00···C··0···0··4 |
| 40 | ··[36]·.gnu_debugaltlink·PROGBITS········00000000·0c | 40 | ··[36]·.gnu_debugaltlink·PROGBITS········00000000·0c24e7·000041·00······0···0··1 |
| 41 | ··[37]·.symtab···········SYMTAB··········00000000·0c | 41 | ··[37]·.symtab···········SYMTAB··········00000000·0c2528·001f50·10·····38·121··4 |
| 42 | ··[38]·.strtab···········STRTAB··········00000000·0c | 42 | ··[38]·.strtab···········STRTAB··········00000000·0c4478·00716c·00······0···0··1 |
| 43 | ··[39]·.shstrtab·········STRTAB··········00000000·0c | 43 | ··[39]·.shstrtab·········STRTAB··········00000000·0cb5e4·000199·00······0···0··1 |
| 44 | Key·to·Flags: | 44 | Key·to·Flags: |
| 45 | ··W·(write),·A·(alloc),·X·(execute),·M·(merge),·S·(strings),·I·(info), | 45 | ··W·(write),·A·(alloc),·X·(execute),·M·(merge),·S·(strings),·I·(info), |
| 46 | ··L·(link·order),·O·(extra·OS·processing·required),·G·(group),·T·(TLS), | 46 | ··L·(link·order),·O·(extra·OS·processing·required),·G·(group),·T·(TLS), |
| 47 | ··C·(compressed),·x·(unknown),·o·(OS·specific),·E·(exclude), | 47 | ··C·(compressed),·x·(unknown),·o·(OS·specific),·E·(exclude), |
| 48 | ··D·(mbind),·p·(processor·specific) | 48 | ··D·(mbind),·p·(processor·specific) |
| Offset 1, 505 lines modified | Offset 1, 504 lines modified | ||
| 1 | Symbol·table·'.symtab'·contains·50 | 1 | Symbol·table·'.symtab'·contains·501·entries: |
| 2 | ···Num:····Value··Size·Type····Bind···Vis······Ndx·Name | 2 | ···Num:····Value··Size·Type····Bind···Vis······Ndx·Name |
| 3 | ·····0:·00000000·····0·NOTYPE··LOCAL··DEFAULT··UND· | 3 | ·····0:·00000000·····0·NOTYPE··LOCAL··DEFAULT··UND· |
| 4 | ·····1:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·Scrt1.o | 4 | ·····1:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·Scrt1.o |
| 5 | ·····2:·000001cc····32·OBJECT··LOCAL··DEFAULT····3·__abi_tag | 5 | ·····2:·000001cc····32·OBJECT··LOCAL··DEFAULT····3·__abi_tag |
| 6 | ·····3:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·IndelAssembly.cpp | 6 | ·····3:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·IndelAssembly.cpp |
| 7 | ·····4:·0000a | 7 | ·····4:·0000a4c0····57·FUNC····LOCAL··DEFAULT···14·_ZNKSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE7compareERKS4_.isra.0 |
| 8 | ·····5:·0000a5 | 8 | ·····5:·0000a500···138·FUNC····LOCAL··DEFAULT···14·_ZNSt15_Deque_iteratorIN13IndelAssembly8CoverageERS1_PS1_EpLEi.isra.0 |
| 9 | ·····6:·0000a5 | 9 | ·····6:·0000a590···167·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12_M_constructIPcEEvT_S7_St20forward_iterator_tag.isra.0 |
| 10 | ·····7:·0000a6 | 10 | ·····7:·0000a640···117·FUNC····LOCAL··DEFAULT···14·_ZSt4endlIcSt11char_traitsIcEERSt13basic_ostreamIT_T0_ES6_.isra.0 |
| 11 | ·····8:·0000a | 11 | ·····8:·0000a6c0···181·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEaSEOS4_.isra.0 |
| 12 | ·····9:·0000a7 | 12 | ·····9:·0000a780···167·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12_M_constructIPKcEEvT_S8_St20forward_iterator_tag.isra.0 |
| 13 | ····10:·0000a8 | 13 | ····10:·0000a830···313·FUNC····LOCAL··DEFAULT···14·_ZNSt6vectorIiSaIiEEaSERKS1_.isra.0 |
| 14 | ····11:·0000be | 14 | ····11:·0000be20···230·FUNC····LOCAL··DEFAULT···14·_ZSt22__uninitialized_move_aISt15_Deque_iteratorIN13IndelAssembly8CoverageERS2_PS2_ES5_SaIS2_EET0_T_S8_S7_RT1_.isra.0 |
| 15 | ····12:·0000a9 | 15 | ····12:·0000a970···145·FUNC····LOCAL··DEFAULT···14·_ZNSt3tr110_HashtableINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES6_SaIS6_ESt9_IdentityIS6_ESt8equal_toIS6_ENS_4hashIS6_EENS_8__detail18_Mod_range_hashingENSE_20_Default_ranged_hashENSE_20_Prime_rehash_policyELb0ELb1ELb1EE19_M_deallocate_nodesEPPNSE_10_Hash_nodeIS6_Lb0EEEj.isra.0 |
| 16 | ····13:·0000aa | 16 | ····13:·0000aa10···216·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEC2IS3_EEPKcRKS3_.constprop.0 |
| 17 | ····14:·0000bf | 17 | ····14:·0000bf10···134·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_N8Spectrum5TKmerEESt10_Select1stISA_ESt4lessIS5_ESaISA_EE8_M_eraseEPSt13_Rb_tree_nodeISA_E.isra.0 |
| 18 | ····15:·0000 | 18 | ····15:·0000bfa0···716·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_jESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE8_M_eraseEPSt13_Rb_tree_nodeIS8_E.isra.0 |
| 19 | ····16:·0000a | 19 | ····16:·0000aaf0···352·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_11OptArgumentESt10_Select1stIS9_ESt4lessIS5_ESaIS9_EE8_M_eraseEPSt13_Rb_tree_nodeIS9_E.isra.0 |
| 20 | ····17:·0000ac | 20 | ····17:·0000ac50···716·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_iESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE8_M_eraseEPSt13_Rb_tree_nodeIS8_E.isra.0 |
| 21 | ····18:·0000af | 21 | ····18:·0000af20··1383·FUNC····LOCAL··DEFAULT···14·_ZNSt5dequeIN8BamTools12BamAlignmentESaIS1_EE19_M_destroy_data_auxESt15_Deque_iteratorIS1_RS1_PS1_ES7_.isra.0 |
| 22 | ····19:·00008a | 22 | ····19:·00008a30····29·FUNC····LOCAL··DEFAULT···14·_Z20RetrieveParameterIntR7OptArgsRN4Json5ValueEcRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEi.cold |
| 23 | ····20:·00008a | 23 | ····20:·00008a4d····29·FUNC····LOCAL··DEFAULT···14·_Z23RetrieveParameterDoubleR7OptArgsRN4Json5ValueEcRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEd.cold |
| 24 | ····21:·0000b | 24 | ····21:·0000bcc0···333·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_N8Spectrum5TKmerEESt10_Select1stISA_ESt4lessIS5_ESaISA_EE22_M_emplace_hint_uniqueIJRKSt21piecewise_construct_tSt5tupleIJRS7_EESL_IJEEEEESt17_Rb_tree_iteratorISA_ESt23_Rb_tree_const_iteratorISA_EDpOT_.isra.0 |
| 25 | ····22:·00008a | 25 | ····22:·00008a6a····47·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_N8Spectrum5TKmerEESt10_Select1stISA_ESt4lessIS5_ESaISA_EE22_M_emplace_hint_uniqueIJRKSt21piecewise_construct_tSt5tupleIJRS7_EESL_IJEEEEESt17_Rb_tree_iteratorISA_ESt23_Rb_tree_const_iteratorISA_EDpOT_.isra.0.cold |
| 26 | ····23:·00008a | 26 | ····23:·00008a99···258·FUNC····LOCAL··DEFAULT···14·main.cold |
| 27 | ····24:·0000a2 | 27 | ····24:·0000a250····56·FUNC····LOCAL··DEFAULT···14·_GLOBAL__sub_I__Z17IndelAssemblyHelpv |
| 28 | ····25:·0003 | 28 | ····25:·00037289·····1·OBJECT··LOCAL··DEFAULT···26·_ZStL8__ioinit |
| 29 | ····26:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·TargetsManager.cpp | 29 | ····26:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·TargetsManager.cpp |
| 30 | ····27:·0001 | 30 | ····27:·0001c250···117·FUNC····LOCAL··DEFAULT···14·_ZSt4endlIcSt11char_traitsIcEERSt13basic_ostreamIT_T0_ES6_.isra.0 |
| 31 | ····28:·0001 | 31 | ····28:·0001c2d0···167·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12_M_constructIPcEEvT_S7_St20forward_iterator_tag.isra.0 |
| 32 | ····29:·00008b | 32 | ····29:·00008b9c···103·FUNC····LOCAL··DEFAULT···14·_ZN14TargetsManager12AddExtraTrimERNS_14UnmergedTargetEPci.cold |
| 33 | ····30:·00008c | 33 | ····30:·00008c04····69·FUNC····LOCAL··DEFAULT···14·_ZN14TargetsManager14LoadRawTargetsERK15ReferenceReaderRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERNS3_4listINS_14UnmergedTargetESaISC_EEE.cold |
| 34 | ····31:·00008c | 34 | ····31:·00008c4a···448·FUNC····LOCAL··DEFAULT···14·_ZNK14TargetsManager19TrimAmpliseqPrimersEP9Alignmenti.cold |
| 35 | ····32:·00008e | 35 | ····32:·00008e0a···183·FUNC····LOCAL··DEFAULT···14·_ZN14TargetsManager10InitializeERK15ReferenceReaderRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEb.cold |
| 36 | ····33:·0000a2 | 36 | ····33:·0000a290····56·FUNC····LOCAL··DEFAULT···14·_GLOBAL__sub_I__ZN14TargetsManagerC2Ev |
| 37 | ····34:·0003 | 37 | ····34:·0003728a·····1·OBJECT··LOCAL··DEFAULT···26·_ZStL8__ioinit |
| 38 | ····35:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·SampleManager.cpp | 38 | ····35:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·SampleManager.cpp |
| 39 | ····36:·0002 | 39 | ····36:·000204c0···117·FUNC····LOCAL··DEFAULT···14·_ZSt4endlIcSt11char_traitsIcEERSt13basic_ostreamIT_T0_ES6_.isra.0 |
| 40 | ····37:·0002 | 40 | ····37:·00020540···167·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12_M_constructIPcEEvT_S7_St20forward_iterator_tag.isra.0 |
| 41 | ····38:·00008e | 41 | ····38:·00008ec2····37·FUNC····LOCAL··DEFAULT···14·_ZNK13SampleManager14IdentifySampleERKN8BamTools12BamAlignmentERiRb.cold |
| 42 | ····39:·0002 | 42 | ····39:·00020880···945·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_iESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE22_M_emplace_hint_uniqueIJRKSt21piecewise_construct_tSt5tupleIJRS7_EESJ_IJEEEEESt17_Rb_tree_iteratorIS8_ESt23_Rb_tree_const_iteratorIS8_EDpOT_.isra.0 |
| 43 | ····40:·00008 | 43 | ····40:·00008ee8····51·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_iESt10_Select1stIS8_ESt4lessIS5_ESaIS8_EE22_M_emplace_hint_uniqueIJRKSt21piecewise_construct_tSt5tupleIJRS7_EESJ_IJEEEEESt17_Rb_tree_iteratorIS8_ESt23_Rb_tree_const_iteratorIS8_EDpOT_.isra.0.cold |
| 44 | ····41:·00008f | 44 | ····41:·00008f1c····22·FUNC····LOCAL··DEFAULT···14·_ZN13SampleManager10InitializeERKN8BamTools9SamHeaderERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERKS9_.cold |
| 45 | ····42:·0000a | 45 | ····42:·0000a2d0····56·FUNC····LOCAL··DEFAULT···14·_GLOBAL__sub_I__ZN13SampleManager10InitializeERKN8BamTools9SamHeaderERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERKS9_ |
| 46 | ····43:·0003 | 46 | ····43:·0003728b·····1·OBJECT··LOCAL··DEFAULT···26·_ZStL8__ioinit |
| 47 | ····44:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·OptArgs.cpp | 47 | ····44:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·OptArgs.cpp |
| 48 | ····45:·00021b00···116·FUNC····LOCAL··DEFAULT···14·_ZSt4endlIcSt11char_traitsIcEERSt13basic_ostreamIT_T0_ES6_.isra.0 | ||
| 49 | ····46:·00021b80····68·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs5AbortERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE.constprop.0 | ||
| 48 | ····4 | 50 | ····47:·00021bd0···167·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12_M_constructIPcEEvT_S7_St20forward_iterator_tag.isra.0 |
| 49 | ····4 | 51 | ····48:·00021c80···159·FUNC····LOCAL··DEFAULT···14·_ZStplIcSt11char_traitsIcESaIcEENSt7__cxx1112basic_stringIT_T0_T1_EEOS8_RKS8_.isra.0 |
| 50 | ····47:·00022aa0····68·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs5AbortERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE.constprop.0 | ||
| 51 | ····4 | 52 | ····49:·00021d20···772·FUNC····LOCAL··DEFAULT···14·_ZNSt6vectorINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS5_EEaSERKS7_.isra.0 |
| 52 | ···· | 53 | ····50:·00008f32···178·FUNC····LOCAL··DEFAULT···14·_ZNSt6vectorINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS5_EEaSERKS7_.isra.0.cold |
| 53 | ····5 | 54 | ····51:·00008fe4····78·FUNC····LOCAL··DEFAULT···14·_ZN11OptArgumentC2Ev.cold |
| 54 | ····5 | 55 | ····52:·00009032···191·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs16CheckNoLeftoversEv.cold |
| 55 | ····5 | 56 | ····53:·000090f2····77·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs17StringToIntVectorERSt6vectorIiSaIiEERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESB_c.cold |
| 56 | ····5 | 57 | ····54:·00009140····92·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs20StringToDoubleVectorERSt6vectorIdSaIdEERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESB_c.cold |
| 57 | ····5 | 58 | ····55:·00023120··1153·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_11OptArgumentESt10_Select1stIS9_ESt4lessIS5_ESaIS9_EE22_M_emplace_hint_uniqueIJRKSt21piecewise_construct_tSt5tupleIJRS7_EESK_IJEEEEESt17_Rb_tree_iteratorIS9_ESt23_Rb_tree_const_iteratorIS9_EDpOT_.isra.0 |
| 58 | ····5 | 59 | ····56:·0000919c····69·FUNC····LOCAL··DEFAULT···14·_ZNSt8_Rb_treeINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESt4pairIKS5_11OptArgumentESt10_Select1stIS9_ESt4lessIS5_ESaIS9_EE22_M_emplace_hint_uniqueIJRKSt21piecewise_construct_tSt5tupleIJRS7_EESK_IJEEEEESt17_Rb_tree_iteratorIS9_ESt23_Rb_tree_const_iteratorIS9_EDpOT_.isra.0.cold |
| 59 | ····5 | 60 | ····57:·000091e2···173·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs14GetOptArgumentEcRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES7_.cold |
| 60 | ····5 | 61 | ····58:·00009290····62·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs9GetOptionERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERKS5_cS8_.cold |
| 61 | ····5 | 62 | ····59:·000092ce····84·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs9GetOptionERbRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcS8_.cold |
| 62 | ····59:·0000933a···113·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs9GetOptionERdRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcS8_.cold | ||
| 63 | ····60:·000093 | 63 | ····60:·00009322···112·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs9GetOptionERdRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcS8_.cold |
| 64 | ····61:·00009392···116·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs9GetOptionERlRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcS8_.cold | ||
| 64 | ····6 | 65 | ····62:·00009406····59·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs9GetOptionERSt6vectorIdSaIdEERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcSB_c.cold |
| 65 | ····6 | 66 | ····63:·00009442····59·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs9GetOptionERSt6vectorIiSaIiEERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcSB_c.cold |
| 66 | ····6 | 67 | ····64:·0000947e···134·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs9GetOptionERSt6vectorIjSaIjEERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcSB_c.cold |
| 67 | ····6 | 68 | ····65:·00009504····62·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs9GetOptionERSt6vectorINSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEESaIS6_EERKS6_cSB_c.cold |
| 68 | ····6 | 69 | ····66:·00009542···116·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs9GetOptionERiRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcS8_.cold |
| 69 | ····6 | 70 | ····67:·000095b6···116·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs9GetOptionERjRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcS8_.cold |
| 70 | ····6 | 71 | ····68:·0000962a····58·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs15GetFirstBooleanEcRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEb.cold |
| 71 | ····6 | 72 | ····69:·00009664····58·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs15GetFirstBooleanEcRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEPKc.cold |
| 72 | ···· | 73 | ····70:·0000969e····19·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs14GetFirstStringEcRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES7_.cold |
| 73 | ····7 | 74 | ····71:·000096b2····39·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs20GetFirstStringVectorEcRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES7_c.cold |
| 74 | ····7 | 75 | ····72:·000096da···123·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs14GetFirstDoubleEcRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEd.cold |
| 75 | ····7 | 76 | ····73:·00009756····58·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs20GetFirstDoubleVectorEcRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES7_c.cold |
| 76 | ····7 | 77 | ····74:·00009790···123·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs11GetFirstIntEcRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEi.cold |
| 77 | ····7 | 78 | ····75:·0000980c····58·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs17GetFirstIntVectorEcRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES7_c.cold |
| 78 | ····7 | 79 | ····76:·00009846···236·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs17HandleShortOptionERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERiiPPKc.cold |
| 79 | ····7 | 80 | ····77:·00009932···165·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs16HandleLongOptionERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERiiPPKc.cold |
| 80 | ····7 | 81 | ····78:·000099d8····60·FUNC····LOCAL··DEFAULT···14·_ZN7OptArgs12ParseCmdLineEiPPKc.cold |
| 81 | ····7 | 82 | ····79:·0000a310····56·FUNC····LOCAL··DEFAULT···14·_GLOBAL__sub_I__ZN11OptArgumentC2Ev |
| 82 | ···· | 83 | ····80:·0003728c·····1·OBJECT··LOCAL··DEFAULT···26·_ZStL8__ioinit |
| 83 | ····8 | 84 | ····81:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·Utils.cpp |
| 85 | ····82:·00028360···167·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12_M_constructIPcEEvT_S7_St20forward_iterator_tag.isra.0 | ||
| 84 | ····8 | 86 | ····83:·00028410···167·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12_M_constructIPKcEEvT_S8_St20forward_iterator_tag.isra.0 |
| 85 | ····82:·00029240···167·FUNC····LOCAL··DEFAULT···14·_ZNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEE12_M_constructIPcEEvT_S7_St20forward_iterator_tag.isra.0 | ||
| 86 | ····8 | 87 | ····84:·00009a14····22·FUNC····LOCAL··DEFAULT···14·_Z10count_charNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEc.cold |
| 87 | ····8 | 88 | ····85:·00009a2a···184·FUNC····LOCAL··DEFAULT···14·_Z9isNumericPKci.cold |
| 88 | ····8 | 89 | ····86:·00009ae2···181·FUNC····LOCAL··DEFAULT···14·_Z8ToDoublePKc.cold |
| 89 | ····8 | 90 | ····87:·00009b97···395·FUNC····LOCAL··DEFAULT···14·_Z18uintVectorToStringRSt6vectorIjSaIjEERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES9_c.cold |
| 90 | ····8 | 91 | ····88:·00009d22····22·FUNC····LOCAL··DEFAULT···14·_Z5splitRKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEEcRSt6vectorIS4_SaIS4_EE.cold |
| 91 | ····8 | 92 | ····89:·0000a350····56·FUNC····LOCAL··DEFAULT···14·_GLOBAL__sub_I__Z8readlineP8_IO_FILE |
| 92 | ···· | 93 | ····90:·0003728d·····1·OBJECT··LOCAL··DEFAULT···26·_ZStL8__ioinit |
| 93 | ····9 | 94 | ····91:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·IonVersion.cpp |
| 94 | ····9 | 95 | ····92:·00009d38····20·FUNC····LOCAL··DEFAULT···14·_ZN10IonVersion14GetFullVersionENSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE.cold |
| 95 | ····9 | 96 | ····93:·00009d4c····20·FUNC····LOCAL··DEFAULT···14·_ZN10IonVersion10GetVersionB5cxx11Ev.cold |
| 96 | ····9 | 97 | ····94:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·crtstuff.c |
| 98 | ····95:·0000a3d0·····0·FUNC····LOCAL··DEFAULT···14·deregister_tm_clones | ||
| 97 | ····9 | 99 | ····96:·0000a410·····0·FUNC····LOCAL··DEFAULT···14·register_tm_clones |
| 98 | ····95:·0000a450·····0·FUNC····LOCAL··DEFAULT···14·register_tm_clones | ||
| 99 | ····9 | 100 | ····97:·0000a460·····0·FUNC····LOCAL··DEFAULT···14·__do_global_dtors_aux |
| 100 | ····9 | 101 | ····98:·00037288·····1·OBJECT··LOCAL··DEFAULT···26·completed.0 |
| 101 | ····9 | 102 | ····99:·00036e84·····0·OBJECT··LOCAL··DEFAULT···21·__do_global_dtors_aux_fini_array_entry |
| 102 | ··· | 103 | ···100:·0000a4b0·····0·FUNC····LOCAL··DEFAULT···14·frame_dummy |
| 103 | ···10 | 104 | ···101:·00036e6c·····0·OBJECT··LOCAL··DEFAULT···20·__frame_dummy_init_array_entry |
| 104 | ···10 | 105 | ···102:·00000000·····0·FILE····LOCAL··DEFAULT··ABS·crtstuff.c |
| 105 | ···10 | 106 | ···103:·00034058·····0·OBJECT··LOCAL··DEFAULT···18·__FRAME_END__ |
| 106 | ···10 | 107 | ···104:·00000000·····0·FILE····LOCAL··DEFAULT··ABS· |
| 107 | ···10 | 108 | ···105:·0001c1f2·····0·FUNC····LOCAL··DEFAULT···14·__x86.get_pc_thunk.ax |
| 108 | ···10 | 109 | ···106:·0002e398·····0·NOTYPE··LOCAL··DEFAULT···17·__GNU_EH_FRAME_HDR |
| 109 | ···10 | 110 | ···107:·0001c1f6·····0·FUNC····LOCAL··DEFAULT···14·__x86.get_pc_thunk.cx |
| 110 | ···10 | 111 | ···108:·0002ba30····20·FUNC····LOCAL··DEFAULT···14·__stack_chk_fail_local |
| 111 | ···10 | 112 | ···109:·00037280·····0·OBJECT··LOCAL··DEFAULT···25·__dso_handle |
| 112 | ···1 | 113 | ···110:·00037284·····4·OBJECT··LOCAL··DEFAULT···25·DW.ref.__gxx_personality_v0 |
| 113 | ···11 | 114 | ···111:·0002ba44·····0·FUNC····LOCAL··DEFAULT···15·_fini |
| 114 | ···11 | 115 | ···112:·0000a3c0·····4·FUNC····LOCAL··DEFAULT···14·__x86.get_pc_thunk.bx |
| 115 | ···11 | 116 | ···113:·0002b48f·····0·FUNC····LOCAL··DEFAULT···14·__x86.get_pc_thunk.bp |
| 116 | ···11 | 117 | ···114:·00008000·····0·FUNC····LOCAL··DEFAULT···11·_init |
| 117 | ···11 | 118 | ···115:·00036e88·····0·OBJECT··LOCAL··DEFAULT···22·_DYNAMIC |
| 118 | ···11 | 119 | ···116:·00037288·····0·OBJECT··LOCAL··DEFAULT···25·__TMC_END__ |
| 119 | ···11 | 120 | ···117:·0001c1fe·····0·FUNC····LOCAL··DEFAULT···14·__x86.get_pc_thunk.di |
| 120 | ···11 | 121 | ···118:·0000a4b5·····0·FUNC····LOCAL··DEFAULT···14·__x86.get_pc_thunk.dx |
| 121 | ···11 | 122 | ···119:·00036ff4·····0·OBJECT··LOCAL··DEFAULT···24·_GLOBAL_OFFSET_TABLE_ |
| Max diff block lines reached; 63403/106603 bytes (59.48%) of diff not shown. | |||
| Offset 1, 8 lines modified | Offset 1, 8 lines modified | ||
| 1 | Displaying·notes·found·in:·.note.gnu.build-id | 1 | Displaying·notes·found·in:·.note.gnu.build-id |
| 2 | ··Owner················Data·size·» Description | 2 | ··Owner················Data·size·» Description |
| 3 | ··GNU··················0x00000014» NT_GNU_BUILD_ID·(unique·build·ID·bitstring)» ····Build·ID:· | 3 | ··GNU··················0x00000014» NT_GNU_BUILD_ID·(unique·build·ID·bitstring)» ····Build·ID:·7f881d3d0ddd19d7d9be275b50257cc1b12b65cc |
| 4 | Displaying·notes·found·in:·.note.ABI-tag | 4 | Displaying·notes·found·in:·.note.ABI-tag |
| 5 | ··Owner················Data·size·» Description | 5 | ··Owner················Data·size·» Description |
| 6 | ··GNU··················0x00000010» NT_GNU_ABI_TAG·(ABI·version·tag)» ····OS:·Linux,·ABI:·3.2.0 | 6 | ··GNU··················0x00000010» NT_GNU_ABI_TAG·(ABI·version·tag)» ····OS:·Linux,·ABI:·3.2.0 |
| Offset 1, 11 lines modified | Offset 1, 11 lines modified | ||
| 1 | Raw·dump·of·debug·contents·of·section·.debug_line: | 1 | Raw·dump·of·debug·contents·of·section·.debug_line: |
| 2 | ··Offset:······················0 | 2 | ··Offset:······················0 |
| 3 | ··Length:······················13 | 3 | ··Length:······················131589 |
| 4 | ··DWARF·Version:···············5 | 4 | ··DWARF·Version:···············5 |
| 5 | ··Address·size·(bytes):········4 | 5 | ··Address·size·(bytes):········4 |
| 6 | ··Segment·selector·(bytes):····0 | 6 | ··Segment·selector·(bytes):····0 |
| 7 | ··Prologue·Length:·············835 | 7 | ··Prologue·Length:·············835 |
| 8 | ··Minimum·Instruction·Length:··1 | 8 | ··Minimum·Instruction·Length:··1 |
| 9 | ··Maximum·Ops·per·Instruction:·1 | 9 | ··Maximum·Ops·per·Instruction:·1 |
| 10 | ··Initial·value·of·'is_stmt':··1 | 10 | ··Initial·value·of·'is_stmt':··1 |
| Offset 196, 77419 lines modified | Offset 196, 75440 lines modified | ||
| 196 | ··142» (udata)» 18» (line_strp)»(offset:·0x83b):·mman.h | 196 | ··142» (udata)» 18» (line_strp)»(offset:·0x83b):·mman.h |
| 197 | ··143» (udata)» 18» (line_strp)»(offset:·0x808):·stat.h | 197 | ··143» (udata)» 18» (line_strp)»(offset:·0x808):·stat.h |
| 198 | ··144» (udata)» 10» (line_strp)»(offset:·0x842):·errno.h | 198 | ··144» (udata)» 10» (line_strp)»(offset:·0x842):·errno.h |
| 199 | ··145» (udata)» 3» (line_strp)» (offset:·0x84a):·system_error | 199 | ··145» (udata)» 3» (line_strp)» (offset:·0x84a):·system_error |
| 200 | ·Line·Number·Statements: | 200 | ·Line·Number·Statements: |
| 201 | ··[0x0000034f]··Set·column·to·7 | 201 | ··[0x0000034f]··Set·column·to·7 |
| 202 | ··[0x00000351]··Extended·opcode·2:·set·Address·to·0xbe | 202 | ··[0x00000351]··Extended·opcode·2:·set·Address·to·0xbe10 |
| 203 | ··[0x00000358]··Advance·Line·by·1091·to·1092 | 203 | ··[0x00000358]··Advance·Line·by·1091·to·1092 |
| 204 | ··[0x0000035b]··Copy | 204 | ··[0x0000035b]··Copy |
| 205 | ··[0x0000035c]··Set·column·to·9 | 205 | ··[0x0000035c]··Set·column·to·9 |
| 206 | ··[0x0000035e]··Special·opcode·6:·advance·Address·by·0·to·0xbe | 206 | ··[0x0000035e]··Special·opcode·6:·advance·Address·by·0·to·0xbe10·and·Line·by·1·to·1093·(view·1) |
| 207 | ··[0x0000035f]··Set·column·to·21 | 207 | ··[0x0000035f]··Set·column·to·21 |
| 208 | ··[0x00000361]··Set·is_stmt·to·0 | 208 | ··[0x00000361]··Set·is_stmt·to·0 |
| 209 | ··[0x00000362]··Copy·(view·2) | 209 | ··[0x00000362]··Copy·(view·2) |
| 210 | ··[0x00000363]··Advance·PC·by·6·to·0xbe | 210 | ··[0x00000363]··Advance·PC·by·6·to·0xbe16 |
| 211 | ··[0x00000365]··Extended·opcode·1:·End·of·Sequence | 211 | ··[0x00000365]··Extended·opcode·1:·End·of·Sequence |
| 212 | ··[0x00000368]··Set·File·Name·to·entry·2·in·the·File·Name·Table | 212 | ··[0x00000368]··Set·File·Name·to·entry·2·in·the·File·Name·Table |
| 213 | ··[0x0000036a]··Set·column·to·7 | 213 | ··[0x0000036a]··Set·column·to·7 |
| 214 | ··[0x0000036c]··Extended·opcode·2:·set·Address·to·0xa | 214 | ··[0x0000036c]··Extended·opcode·2:·set·Address·to·0xa4c0 |
| 215 | ··[0x00000373]··Advance·Line·by·3141·to·3142 | 215 | ··[0x00000373]··Advance·Line·by·3141·to·3142 |
| 216 | ··[0x00000376]··Copy | 216 | ··[0x00000376]··Copy |
| 217 | ··[0x00000377]··Set·is_stmt·to·0 | 217 | ··[0x00000377]··Set·is_stmt·to·0 |
| 218 | ··[0x00000378]··Copy·(view·1) | 218 | ··[0x00000378]··Copy·(view·1) |
| 219 | ··[0x00000379]··Special·opcode·75:·advance·Address·by·5·to·0xa | 219 | ··[0x00000379]··Special·opcode·75:·advance·Address·by·5·to·0xa4c5·and·Line·by·0·to·3142 |
| 220 | ··[0x0000037a]··Set·File·Name·to·entry·3·in·the·File·Name·Table | 220 | ··[0x0000037a]··Set·File·Name·to·entry·3·in·the·File·Name·Table |
| 221 | ··[0x0000037c]··Set·is_stmt·to·1 | 221 | ··[0x0000037c]··Set·is_stmt·to·1 |
| 222 | ··[0x0000037d]··Advance·Line·by·-2772·to·370 | 222 | ··[0x0000037d]··Advance·Line·by·-2772·to·370 |
| 223 | ··[0x00000380]··Advance·PC·by·constant·17·to·0xa | 223 | ··[0x00000380]··Advance·PC·by·constant·17·to·0xa4d6 |
| 224 | ··[0x00000381]··Special·opcode·75:·advance·Address·by·5·to·0xa | 224 | ··[0x00000381]··Special·opcode·75:·advance·Address·by·5·to·0xa4db·and·Line·by·0·to·370 |
| 225 | ··[0x00000382]··Set·column·to·2 | 225 | ··[0x00000382]··Set·column·to·2 |
| 226 | ··[0x00000384]··Special·opcode·7:·advance·Address·by·0·to·0xa | 226 | ··[0x00000384]··Special·opcode·7:·advance·Address·by·0·to·0xa4db·and·Line·by·2·to·372·(view·1) |
| 227 | ··[0x00000385]··Special·opcode·64:·advance·Address·by·4·to·0xa | 227 | ··[0x00000385]··Special·opcode·64:·advance·Address·by·4·to·0xa4df·and·Line·by·3·to·375 |
| 228 | ··[0x00000386]··Advance·Line·by·10·to·385 | 228 | ··[0x00000386]··Advance·Line·by·10·to·385 |
| 229 | ··[0x00000388]··Copy·(view·1) | 229 | ··[0x00000388]··Copy·(view·1) |
| 230 | ··[0x00000389]··Set·column·to·25 | 230 | ··[0x00000389]··Set·column·to·25 |
| 231 | ··[0x0000038b]··Set·is_stmt·to·0 | 231 | ··[0x0000038b]··Set·is_stmt·to·0 |
| 232 | ··[0x0000038c]··Copy·(view·2) | 232 | ··[0x0000038c]··Copy·(view·2) |
| 233 | ··[0x0000038d]··Special·opcode·159:·advance·Address·by·11·to·0xa | 233 | ··[0x0000038d]··Special·opcode·159:·advance·Address·by·11·to·0xa4ea·and·Line·by·0·to·385 |
| 234 | ··[0x0000038e]··Special·opcode·47:·advance·Address·by·3·to·0xa | 234 | ··[0x0000038e]··Special·opcode·47:·advance·Address·by·3·to·0xa4ed·and·Line·by·0·to·385 |
| 235 | ··[0x0000038f]··Set·File·Name·to·entry·2·in·the·File·Name·Table | 235 | ··[0x0000038f]··Set·File·Name·to·entry·2·in·the·File·Name·Table |
| 236 | ··[0x00000391]··Set·column·to·2 | 236 | ··[0x00000391]··Set·column·to·2 |
| 237 | ··[0x00000393]··Advance·Line·by·2764·to·3149 | 237 | ··[0x00000393]··Advance·Line·by·2764·to·3149 |
| 238 | ··[0x00000396]··Copy·(view·1) | 238 | ··[0x00000396]··Copy·(view·1) |
| 239 | ··[0x00000397]··Set·column·to·7 | 239 | ··[0x00000397]··Set·column·to·7 |
| 240 | ··[0x00000399]··Set·is_stmt·to·1 | 240 | ··[0x00000399]··Set·is_stmt·to·1 |
| 241 | ··[0x0000039a]··Advance·Line·by·-2668·to·481 | 241 | ··[0x0000039a]··Advance·Line·by·-2668·to·481 |
| 242 | ··[0x0000039d]··Special·opcode·61:·advance·Address·by·4·to·0xa | 242 | ··[0x0000039d]··Special·opcode·61:·advance·Address·by·4·to·0xa4f1·and·Line·by·0·to·481 |
| 243 | ··[0x0000039e]··Set·column·to·51 | 243 | ··[0x0000039e]··Set·column·to·51 |
| 244 | ··[0x000003a0]··Set·is_stmt·to·0 | 244 | ··[0x000003a0]··Set·is_stmt·to·0 |
| 245 | ··[0x000003a1]··Special·opcode·7:·advance·Address·by·0·to·0xa | 245 | ··[0x000003a1]··Special·opcode·7:·advance·Address·by·0·to·0xa4f1·and·Line·by·2·to·483·(view·1) |
| 246 | ··[0x000003a2]··Special·opcode·61:·advance·Address·by·4·to·0xa | 246 | ··[0x000003a2]··Special·opcode·61:·advance·Address·by·4·to·0xa4f5·and·Line·by·0·to·483 |
| 247 | ··[0x000003a3]··Set·column·to·7 | 247 | ··[0x000003a3]··Set·column·to·7 |
| 248 | ··[0x000003a5]··Advance·Line·by·2669·to·3152 | 248 | ··[0x000003a5]··Advance·Line·by·2669·to·3152 |
| 249 | ··[0x000003a8]··Copy·(view·1) | 249 | ··[0x000003a8]··Copy·(view·1) |
| 250 | ··[0x000003a9]··Set·File·Name·to·entry·4·in·the·File·Name·Table | 250 | ··[0x000003a9]··Set·File·Name·to·entry·4·in·the·File·Name·Table |
| 251 | ··[0x000003ab]··Set·is_stmt·to·1 | 251 | ··[0x000003ab]··Set·is_stmt·to·1 |
| 252 | ··[0x000003ac]··Advance·Line·by·-2922·to·230 | 252 | ··[0x000003ac]··Advance·Line·by·-2922·to·230 |
| 253 | ··[0x000003af]··Special·opcode·159:·advance·Address·by·11·to·0xa5 | 253 | ··[0x000003af]··Special·opcode·159:·advance·Address·by·11·to·0xa500·and·Line·by·0·to·230 |
| 254 | ··[0x000003b0]··Set·is_stmt·to·0 | 254 | ··[0x000003b0]··Set·is_stmt·to·0 |
| 255 | ··[0x000003b1]··Copy·(view·1) | 255 | ··[0x000003b1]··Copy·(view·1) |
| 256 | ··[0x000003b2]··Special·opcode·33:·advance·Address·by·2·to·0xa5 | 256 | ··[0x000003b2]··Special·opcode·33:·advance·Address·by·2·to·0xa502·and·Line·by·0·to·230 |
| 257 | ··[0x000003b3]··Set·column·to·42 | 257 | ··[0x000003b3]··Set·column·to·42 |
| 258 | ··[0x000003b5]··Special·opcode·35:·advance·Address·by·2·to·0xa5 | 258 | ··[0x000003b5]··Special·opcode·35:·advance·Address·by·2·to·0xa504·and·Line·by·2·to·232 |
| 259 | ··[0x000003b6]··Set·column·to·49 | 259 | ··[0x000003b6]··Set·column·to·49 |
| 260 | ··[0x000003b8]··Special·opcode·33:·advance·Address·by·2·to·0xa5 | 260 | ··[0x000003b8]··Special·opcode·33:·advance·Address·by·2·to·0xa506·and·Line·by·0·to·232 |
| 261 | ··[0x000003b9]··Set·column·to·20 | 261 | ··[0x000003b9]··Set·column·to·20 |
| 262 | ··[0x000003bb]··Special·opcode·202:·advance·Address·by·14·to·0xa5 | 262 | ··[0x000003bb]··Special·opcode·202:·advance·Address·by·14·to·0xa514·and·Line·by·1·to·233 |
| 263 | ··[0x000003bc]··Special·opcode·33:·advance·Address·by·2·to·0xa5 | 263 | ··[0x000003bc]··Special·opcode·33:·advance·Address·by·2·to·0xa516·and·Line·by·0·to·233 |
| 264 | ··[0x000003bd]··Set·column·to·21 | 264 | ··[0x000003bd]··Set·column·to·21 |
| 265 | ··[0x000003bf]··Special·opcode·108:·advance·Address·by·7·to·0xa5 | 265 | ··[0x000003bf]··Special·opcode·108:·advance·Address·by·7·to·0xa51d·and·Line·by·5·to·238 |
| 266 | ··[0x000003c0]··Special·opcode·103:·advance·Address·by·7·to·0xa5 | 266 | ··[0x000003c0]··Special·opcode·103:·advance·Address·by·7·to·0xa524·and·Line·by·0·to·238 |
| 267 | ··[0x000003c1]··Set·column·to·17 | 267 | ··[0x000003c1]··Set·column·to·17 |
| 268 | ··[0x000003c3]··Special·opcode·134:·advance·Address·by·9·to·0xa5 | 268 | ··[0x000003c3]··Special·opcode·134:·advance·Address·by·9·to·0xa52d·and·Line·by·3·to·241 |
| 269 | ··[0x000003c4]··Set·column·to·7 | 269 | ··[0x000003c4]··Set·column·to·7 |
| 270 | ··[0x000003c6]··Set·is_stmt·to·1 | 270 | ··[0x000003c6]··Set·is_stmt·to·1 |
| 271 | ··[0x000003c7]··Advance·Line·by·22·to·263 | 271 | ··[0x000003c7]··Advance·Line·by·22·to·263 |
| 272 | ··[0x000003c9]··Special·opcode·89:·advance·Address·by·6·to·0xa5 | 272 | ··[0x000003c9]··Special·opcode·89:·advance·Address·by·6·to·0xa533·and·Line·by·0·to·263 |
| 273 | ··[0x000003ca]··Set·column·to·11 | 273 | ··[0x000003ca]··Set·column·to·11 |
| 274 | ··[0x000003cc]··Set·is_stmt·to·0 | 274 | ··[0x000003cc]··Set·is_stmt·to·0 |
| 275 | ··[0x000003cd]··Special·opcode·8:·advance·Address·by·0·to·0xa5 | 275 | ··[0x000003cd]··Special·opcode·8:·advance·Address·by·0·to·0xa533·and·Line·by·3·to·266·(view·1) |
| 276 | ··[0x000003ce]··Set·column·to·10 | 276 | ··[0x000003ce]··Set·column·to·10 |
| 277 | ··[0x000003d0]··Special·opcode·32:·advance·Address·by·2·to·0xa5 | 277 | ··[0x000003d0]··Special·opcode·32:·advance·Address·by·2·to·0xa535·and·Line·by·-1·to·265 |
| 278 | ··[0x000003d1]··Set·column·to·21 | 278 | ··[0x000003d1]··Set·column·to·21 |
| 279 | ··[0x000003d3]··Special·opcode·49:·advance·Address·by·3·to·0xa5 | 279 | ··[0x000003d3]··Special·opcode·49:·advance·Address·by·3·to·0xa538·and·Line·by·2·to·267 |
| 280 | ··[0x000003d4]··Set·column·to·11 | 280 | ··[0x000003d4]··Set·column·to·11 |
| 281 | ··[0x000003d6]··Special·opcode·88:·advance·Address·by·6·to·0xa5 | 281 | ··[0x000003d6]··Special·opcode·88:·advance·Address·by·6·to·0xa53e·and·Line·by·-1·to·266 |
| 282 | ··[0x000003d7]··Set·column·to·21 | ||
| 283 | ··[0x000003d9]··Special·opcode·48:·advance·Address·by·3·to·0xa581·and·Line·by·1·to·267 | ||
| 284 | ··[0x000003da]··Special·opcode·47:·advance·Address·by·3·to·0xa584·and·Line·by·0·to·267 | ||
| 285 | ··[0x000003d | 282 | ··[0x000003d7]··Set·column·to·6 |
| 286 | ··[0x000003d | 283 | ··[0x000003d9]··Advance·Line·by·-23·to·243 |
| 287 | ··[0x000003d | 284 | ··[0x000003db]··Special·opcode·117:·advance·Address·by·8·to·0xa546·and·Line·by·0·to·243 |
| 285 | ··[0x000003dc]··Set·column·to·11 | ||
| 286 | ··[0x000003de]··Advance·Line·by·23·to·266 | ||
| 287 | ··[0x000003e0]··Special·opcode·89:·advance·Address·by·6·to·0xa54c·and·Line·by·0·to·266 | ||
| 288 | ··[0x000003e | 288 | ··[0x000003e1]··Set·column·to·36 |
| 289 | ··[0x000003e3]··Advance·Line·by·-24·to·242 | ||
| 289 | ··[0x000003e2]··Special·opcode·88:·advance·Address·by·6·to·0xa58a·and·Line·by·-1·to·242 | ||
| 290 | ··[0x000003e3]··Set·column·to·24 | ||
| 291 | ··[0x000003e5]··Special·opcode· | 290 | ··[0x000003e5]··Special·opcode·61:·advance·Address·by·4·to·0xa550·and·Line·by·0·to·242 |
| 292 | ··[0x000003e6]··Set·column·to·11 | 291 | ··[0x000003e6]··Set·column·to·11 |
| 293 | ··[0x000003e8]··Advance·Line·by· | 292 | ··[0x000003e8]··Advance·Line·by·24·to·266 |
| 294 | ··[0x000003ea]··Special·opcode·89:·advance·Address·by·6·to·0xa592·and·Line·by·0·to·234 | ||
| 295 | ··[0x000003e | 293 | ··[0x000003ea]··Special·opcode·33:·advance·Address·by·2·to·0xa552·and·Line·by·0·to·266 |
| 294 | ··[0x000003eb]··Special·opcode·75:·advance·Address·by·5·to·0xa557·and·Line·by·0·to·266 | ||
| 296 | ··[0x000003ec]··Set·column·to· | 295 | ··[0x000003ec]··Set·column·to·24 |
| 297 | ··[0x000003ee]··Advance·Line·by· | 296 | ··[0x000003ee]··Advance·Line·by·-24·to·242 |
| 298 | ··[0x000003f0]··Copy·(view·1) | 297 | ··[0x000003f0]··Copy·(view·1) |
| 299 | ··[0x000003f1]··Special·opcode·19:·advance·Address·by·1·to·0xa595·and·Line·by·0·to·246 | ||
| 300 | ··[0x000003f | 298 | ··[0x000003f1]··Set·column·to·11 |
| 299 | ··[0x000003f3]··Advance·Line·by·-8·to·234 | ||
| 300 | ··[0x000003f5]··Special·opcode·89:·advance·Address·by·6·to·0xa55d·and·Line·by·0·to·234 | ||
| 301 | ··[0x000003f6]··Special·opcode·33:·advance·Address·by·2·to·0xa55f·and·Line·by·0·to·234 | ||
| Max diff block lines reached; 13963305/13979953 bytes (99.88%) of diff not shown. | |||
| Offset 1, 20 lines modified | Offset 1, 20 lines modified | ||
| 1 | Contents·of·the·.debug_info·section: | 1 | Contents·of·the·.debug_info·section: |
| 2 | ··Compilation·Unit·@·offset·0: | 2 | ··Compilation·Unit·@·offset·0: |
| 3 | ···Length:········0xc | 3 | ···Length:········0xc7·(32-bit) |
| 4 | ···Version:·······5 | 4 | ···Version:·······5 |
| 5 | ···Unit·Type:·····DW_UT_partial·(3) | 5 | ···Unit·Type:·····DW_UT_partial·(3) |
| 6 | ···Abbrev·Offset:·0 | 6 | ···Abbrev·Offset:·0 |
| 7 | ···Pointer·Size:··4 | 7 | ···Pointer·Size:··4 |
| 8 | ·<0><c>:·Abbrev·Number:·3·(DW_TAG_partial_unit) | 8 | ·<0><c>:·Abbrev·Number:·3·(DW_TAG_partial_unit) |
| 9 | ····<d>···DW_AT_stmt_list···:·(sec_offset)·0 | 9 | ····<d>···DW_AT_stmt_list···:·(sec_offset)·0 |
| 10 | ····<11>···DW_AT_comp_dir····:·(line_strp)·(offset:·0):·./obj-i686-linux-gnu | 10 | ····<11>···DW_AT_comp_dir····:·(line_strp)·(offset:·0):·./obj-i686-linux-gnu |
| 11 | ·<1><15>:·Abbrev·Number:·2·(DW_TAG_imported_unit) | 11 | ·<1><15>:·Abbrev·Number:·2·(DW_TAG_imported_unit) |
| 12 | ····<16>···DW_AT_import······:·(GNU_ref_alt)·<0xa5 | 12 | ····<16>···DW_AT_import······:·(GNU_ref_alt)·<0xa51f7> |
| 13 | ·<1><1a>:·Abbrev·Number:·2·(DW_TAG_imported_unit) | 13 | ·<1><1a>:·Abbrev·Number:·2·(DW_TAG_imported_unit) |
| 14 | ····<1b>···DW_AT_import······:·(GNU_ref_alt)·<0xc> | 14 | ····<1b>···DW_AT_import······:·(GNU_ref_alt)·<0xc> |
| 15 | ·<1><1f>:·Abbrev·Number:·2·(DW_TAG_imported_unit) | 15 | ·<1><1f>:·Abbrev·Number:·2·(DW_TAG_imported_unit) |
| 16 | ····<20>···DW_AT_import······:·(GNU_ref_alt)·<0x221> | 16 | ····<20>···DW_AT_import······:·(GNU_ref_alt)·<0x221> |
| 17 | ·<1><24>:·Abbrev·Number:·2·(DW_TAG_imported_unit) | 17 | ·<1><24>:·Abbrev·Number:·2·(DW_TAG_imported_unit) |
| 18 | ····<25>···DW_AT_import······:·(GNU_ref_alt)·<0x26e> | 18 | ····<25>···DW_AT_import······:·(GNU_ref_alt)·<0x26e> |
| 19 | ·<1><29>:·Abbrev·Number:·2·(DW_TAG_imported_unit) | 19 | ·<1><29>:·Abbrev·Number:·2·(DW_TAG_imported_unit) |
| Offset 26, 447033 lines modified | Offset 26, 443616 lines modified | ||
| 26 | ·<1><38>:·Abbrev·Number:·2·(DW_TAG_imported_unit) | 26 | ·<1><38>:·Abbrev·Number:·2·(DW_TAG_imported_unit) |
| 27 | ····<39>···DW_AT_import······:·(GNU_ref_alt)·<0x1555> | 27 | ····<39>···DW_AT_import······:·(GNU_ref_alt)·<0x1555> |
| 28 | ·<1><3d>:·Abbrev·Number:·2·(DW_TAG_imported_unit) | 28 | ·<1><3d>:·Abbrev·Number:·2·(DW_TAG_imported_unit) |
| 29 | ····<3e>···DW_AT_import······:·(GNU_ref_alt)·<0x17dd> | 29 | ····<3e>···DW_AT_import······:·(GNU_ref_alt)·<0x17dd> |
| 30 | ·<1><42>:·Abbrev·Number:·2·(DW_TAG_imported_unit) | 30 | ·<1><42>:·Abbrev·Number:·2·(DW_TAG_imported_unit) |
| 31 | ····<43>···DW_AT_import······:·(GNU_ref_alt)·<0x181b> | 31 | ····<43>···DW_AT_import······:·(GNU_ref_alt)·<0x181b> |
| 32 | ·<1><47>:·Abbrev·Number:·2·(DW_TAG_imported_unit) | 32 | ·<1><47>:·Abbrev·Number:·2·(DW_TAG_imported_unit) |
| 33 | ····<48>···DW_AT_import······:·(GNU_ref_alt)·<0x | 33 | ····<48>···DW_AT_import······:·(GNU_ref_alt)·<0x1891> |
| 34 | ·<1><4c>:·Abbrev·Number:·2·(DW_TAG_imported_unit) | 34 | ·<1><4c>:·Abbrev·Number:·2·(DW_TAG_imported_unit) |
| 35 | ····<4d>···DW_AT_import······:·(GNU_ref_alt)·<0x3 | 35 | ····<4d>···DW_AT_import······:·(GNU_ref_alt)·<0x313a> |
| 36 | ·<1><51>:·Abbrev·Number:·2·(DW_TAG_imported_unit) | 36 | ·<1><51>:·Abbrev·Number:·2·(DW_TAG_imported_unit) |
| 37 | ····<52>···DW_AT_import······:·(GNU_ref_alt)·<0x3 | 37 | ····<52>···DW_AT_import······:·(GNU_ref_alt)·<0x32f5> |
| 38 | ·<1><56>:·Abbrev·Number:·2·(DW_TAG_imported_unit) | 38 | ·<1><56>:·Abbrev·Number:·2·(DW_TAG_imported_unit) |
| 39 | ····<57>···DW_AT_import······:·(GNU_ref_alt)·<0x35 | 39 | ····<57>···DW_AT_import······:·(GNU_ref_alt)·<0x358c> |
| 40 | ·<1><5b>:·Abbrev·Number:·2·(DW_TAG_imported_unit) | 40 | ·<1><5b>:·Abbrev·Number:·2·(DW_TAG_imported_unit) |
| 41 | ····<5c>···DW_AT_import······:·(GNU_ref_alt)·<0x35 | 41 | ····<5c>···DW_AT_import······:·(GNU_ref_alt)·<0x35ec> |
| 42 | ·<1><60>:·Abbrev·Number:·2·(DW_TAG_imported_unit) | 42 | ·<1><60>:·Abbrev·Number:·2·(DW_TAG_imported_unit) |
| 43 | ····<61>···DW_AT_import······:·(GNU_ref_alt)·<0x3628> | ||
| 44 | ·<1><65>:·Abbrev·Number:·2·(DW_TAG_imported_unit) | ||
| 43 | ····<6 | 45 | ····<66>···DW_AT_import······:·(GNU_ref_alt)·<0xa51d3> |
| 44 | ·<1><6 | 46 | ·<1><6a>:·Abbrev·Number:·9·(DW_TAG_namespace) |
| 45 | ····<6 | 47 | ····<6b>···DW_AT_name········:·(string)·std |
| 46 | ····<6 | 48 | ····<6f>···DW_AT_sibling·····:·(ref1)·<0xa8> |
| 47 | ·<2>< | 49 | ·<2><70>:·Abbrev·Number:·14·(DW_TAG_subprogram) |
| 48 | ····< | 50 | ····<71>···DW_AT_external····:·(flag_present)·1 |
| 49 | ····< | 51 | ····<71>···DW_AT_name········:·(GNU_strp_alt)·(offset:·0xe2aef)· |
| 50 | ····<7 | 52 | ····<75>···DW_AT_decl_file···:·(data1)·95 |
| 51 | ····<7 | 53 | ····<76>···DW_AT_decl_line···:·(data1)·75 |
| 52 | ····<7 | 54 | ····<77>···DW_AT_decl_column·:·(data1)·3 |
| 53 | ····<7 | 55 | ····<78>···DW_AT_linkage_name:·(GNU_strp_alt)·(offset:·0xc0fb6)· |
| 54 | ····<7 | 56 | ····<7c>···DW_AT_noreturn····:·(flag_present)·1 |
| 55 | ····<7 | 57 | ····<7c>···DW_AT_declaration·:·(flag_present)·1 |
| 56 | ····<7 | 58 | ····<7c>···DW_AT_sibling·····:·(ref1)·<0x83> |
| 57 | ·<3><7 | 59 | ·<3><7d>:·Abbrev·Number:·5·(DW_TAG_formal_parameter) |
| 58 | ····<7 | 60 | ····<7e>···DW_AT_type········:·(GNU_ref_alt)·<0x187> |
| 59 | ·<3>< | 61 | ·<3><82>:·Abbrev·Number:·0 |
| 60 | ·<2>< | 62 | ·<2><83>:·Abbrev·Number:·14·(DW_TAG_subprogram) |
| 61 | ····< | 63 | ····<84>···DW_AT_external····:·(flag_present)·1 |
| 62 | ····< | 64 | ····<84>···DW_AT_name········:·(GNU_strp_alt)·(offset:·0xe2ac0)· |
| 63 | ····<8 | 65 | ····<88>···DW_AT_decl_file···:·(data1)·95 |
| 64 | ····<8 | 66 | ····<89>···DW_AT_decl_line···:·(data1)·66 |
| 65 | ····<8 | 67 | ····<8a>···DW_AT_decl_column·:·(data1)·3 |
| 66 | ····<8 | 68 | ····<8b>···DW_AT_linkage_name:·(GNU_strp_alt)·(offset:·0xc0f99)· |
| 67 | ····<8 | 69 | ····<8f>···DW_AT_noreturn····:·(flag_present)·1 |
| 68 | ····<8 | 70 | ····<8f>···DW_AT_declaration·:·(flag_present)·1 |
| 69 | ····<8 | 71 | ····<8f>···DW_AT_sibling·····:·(ref1)·<0x96> |
| 70 | ·<3>< | 72 | ·<3><90>:·Abbrev·Number:·5·(DW_TAG_formal_parameter) |
| 71 | ····< | 73 | ····<91>···DW_AT_type········:·(GNU_ref_alt)·<0x187> |
| 72 | ·<3><9 | 74 | ·<3><95>:·Abbrev·Number:·0 |
| 73 | ·<2><9 | 75 | ·<2><96>:·Abbrev·Number:·13·(DW_TAG_subprogram) |
| 74 | ····<9 | 76 | ····<97>···DW_AT_external····:·(flag_present)·1 |
| 75 | ····<9 | 77 | ····<97>···DW_AT_name········:·(GNU_strp_alt)·(offset:·0xc2314)· |
| 76 | ····<9 | 78 | ····<9b>···DW_AT_decl_file···:·(data1)·65 |
| 77 | ····<9 | 79 | ····<9c>···DW_AT_decl_line···:·(data2)·516 |
| 78 | ····<9 | 80 | ····<9e>···DW_AT_decl_column·:·(data1)·3 |
| 79 | ····<9 | 81 | ····<9f>···DW_AT_linkage_name:·(GNU_strp_alt)·(offset:·0x13b732)· |
| 80 | ····< | 82 | ····<a3>···DW_AT_type········:·(GNU_ref_alt)·<0xcfd> |
| 81 | ····<a | 83 | ····<a7>···DW_AT_declaration·:·(flag_present)·1 |
| 82 | ·<2><a | 84 | ·<2><a7>:·Abbrev·Number:·0 |
| 83 | ·<1><a | 85 | ·<1><a8>:·Abbrev·Number:·12·(DW_TAG_namespace) |
| 84 | ····<a | 86 | ····<a9>···DW_AT_name········:·(GNU_strp_alt)·(offset:·0x13bb03)· |
| 85 | ····<a | 87 | ····<ad>···DW_AT_sibling·····:·(ref1)·<0xaf> |
| 86 | ·<2><a | 88 | ·<2><ae>:·Abbrev·Number:·0 |
| 87 | ·<1><a | 89 | ·<1><af>:·Abbrev·Number:·8·(DW_TAG_subprogram) |
| 88 | ····< | 90 | ····<b0>···DW_AT_external····:·(flag_present)·1 |
| 89 | ····< | 91 | ····<b0>···DW_AT_declaration·:·(flag_present)·1 |
| 90 | ····< | 92 | ····<b0>···DW_AT_linkage_name:·(GNU_strp_alt)·(offset:·0xe0cc7)· |
| 91 | ····< | 93 | ····<b4>···DW_AT_name········:·(GNU_strp_alt)·(offset:·0xe0cc7)· |
| 92 | ·<1><b | 94 | ·<1><b8>:·Abbrev·Number:·8·(DW_TAG_subprogram) |
| 93 | ····<b | 95 | ····<b9>···DW_AT_external····:·(flag_present)·1 |
| 94 | ····<b | 96 | ····<b9>···DW_AT_declaration·:·(flag_present)·1 |
| 95 | ····<b | 97 | ····<b9>···DW_AT_linkage_name:·(GNU_strp_alt)·(offset:·0xc3864)· |
| 96 | ····<b | 98 | ····<bd>···DW_AT_name········:·(GNU_strp_alt)·(offset:·0xc3873)· |
| 97 | ·<1>< | 99 | ·<1><c1>:·Abbrev·Number:·8·(DW_TAG_subprogram) |
| 98 | ····< | 100 | ····<c2>···DW_AT_external····:·(flag_present)·1 |
| 99 | ····< | 101 | ····<c2>···DW_AT_declaration·:·(flag_present)·1 |
| 100 | ····< | 102 | ····<c2>···DW_AT_linkage_name:·(GNU_strp_alt)·(offset:·0x13bc70)· |
| 101 | ····<c | 103 | ····<c6>···DW_AT_name········:·(GNU_strp_alt)·(offset:·0x13bc5e)· |
| 102 | ·<1><c | 104 | ·<1><ca>:·Abbrev·Number:·0 |
| 103 | ··Compilation·Unit·@·offset·0xc | 105 | ··Compilation·Unit·@·offset·0xcb: |
| 104 | ···Length:········0x8f·(32-bit) | 106 | ···Length:········0x8f·(32-bit) |
| 105 | ···Version:·······5 | 107 | ···Version:·······5 |
| 106 | ···Unit·Type:·····DW_UT_partial·(3) | 108 | ···Unit·Type:·····DW_UT_partial·(3) |
| 107 | ···Abbrev·Offset:·0 | 109 | ···Abbrev·Offset:·0 |
| 108 | ···Pointer·Size:··4 | 110 | ···Pointer·Size:··4 |
| 109 | ·<0><d | 111 | ·<0><d7>:·Abbrev·Number:·3·(DW_TAG_partial_unit) |
| 110 | ····<d | 112 | ····<d8>···DW_AT_stmt_list···:·(sec_offset)·0 |
| 111 | ····<d | 113 | ····<dc>···DW_AT_comp_dir····:·(line_strp)·(offset:·0):·./obj-i686-linux-gnu |
| 112 | ·<1><db>:·Abbrev·Number:·2·(DW_TAG_imported_unit) | ||
| 113 | ····<dc>···DW_AT_import······:·(GNU_ref_alt)·<0x1586> | ||
| 114 | ·<1><e0>:·Abbrev·Number:·2·(DW_TAG_imported_unit) | 114 | ·<1><e0>:·Abbrev·Number:·2·(DW_TAG_imported_unit) |
| 115 | ····<e1>···DW_AT_import······:·(GNU_ref_alt)·<0x1 | 115 | ····<e1>···DW_AT_import······:·(GNU_ref_alt)·<0x1586> |
| 116 | ·<1><e5>:·Abbrev·Number:·2·(DW_TAG_imported_unit) | 116 | ·<1><e5>:·Abbrev·Number:·2·(DW_TAG_imported_unit) |
| 117 | ····<e6>···DW_AT_import······:·(GNU_ref_alt)·<0x1 | 117 | ····<e6>···DW_AT_import······:·(GNU_ref_alt)·<0x170e> |
| 118 | ·<1><ea>:·Abbrev·Number:·2·(DW_TAG_imported_unit) | 118 | ·<1><ea>:·Abbrev·Number:·2·(DW_TAG_imported_unit) |
| 119 | ····<eb>···DW_AT_import······:·(GNU_ref_alt)·<0x1b | 119 | ····<eb>···DW_AT_import······:·(GNU_ref_alt)·<0x1b01> |
| 120 | ·<1><ef>:·Abbrev·Number:·2·(DW_TAG_imported_unit) | 120 | ·<1><ef>:·Abbrev·Number:·2·(DW_TAG_imported_unit) |
| 121 | ····<f0>···DW_AT_import······:·(GNU_ref_alt)·<0x1c | 121 | ····<f0>···DW_AT_import······:·(GNU_ref_alt)·<0x1c02> |
| 122 | ·<1><f4>:·Abbrev·Number:·2·(DW_TAG_imported_unit) | 122 | ·<1><f4>:·Abbrev·Number:·2·(DW_TAG_imported_unit) |
| 123 | ····<f5>···DW_AT_import······:·(GNU_ref_alt)·<0x1d | 123 | ····<f5>···DW_AT_import······:·(GNU_ref_alt)·<0x1d1b> |
| 124 | ·<1><f9>:·Abbrev·Number:·2·(DW_TAG_imported_unit) | 124 | ·<1><f9>:·Abbrev·Number:·2·(DW_TAG_imported_unit) |
| 125 | ····<fa>···DW_AT_import······:·(GNU_ref_alt)·<0x | 125 | ····<fa>···DW_AT_import······:·(GNU_ref_alt)·<0x1d5e> |
| 126 | ·<1><fe>:·Abbrev·Number:·2·(DW_TAG_imported_unit) | 126 | ·<1><fe>:·Abbrev·Number:·2·(DW_TAG_imported_unit) |
| 127 | ····<ff>···DW_AT_import······:·(GNU_ref_alt)·<0x2 | 127 | ····<ff>···DW_AT_import······:·(GNU_ref_alt)·<0x23fe> |
| 128 | ·<1><103>:·Abbrev·Number:·2·(DW_TAG_imported_unit) | 128 | ·<1><103>:·Abbrev·Number:·2·(DW_TAG_imported_unit) |
| 129 | ····<104>···DW_AT_import······:·(GNU_ref_alt)·<0x | 129 | ····<104>···DW_AT_import······:·(GNU_ref_alt)·<0x243f> |
| Max diff block lines reached; 48470055/48480349 bytes (99.98%) of diff not shown. | |||
| Offset 106, 113 lines modified | Offset 106, 95 lines modified | ||
| 106 | ···18······DW_TAG_subprogram····[no·children] | 106 | ···18······DW_TAG_subprogram····[no·children] |
| 107 | ····DW_AT_external·····DW_FORM_flag_present | 107 | ····DW_AT_external·····DW_FORM_flag_present |
| 108 | ····DW_AT_name·········DW_FORM_GNU_strp_alt | 108 | ····DW_AT_name·········DW_FORM_GNU_strp_alt |
| 109 | ····DW_AT_artificial···DW_FORM_flag_present | 109 | ····DW_AT_artificial···DW_FORM_flag_present |
| 110 | ····DW_AT_noreturn·····DW_FORM_flag_present | 110 | ····DW_AT_noreturn·····DW_FORM_flag_present |
| 111 | ····DW_AT_declaration··DW_FORM_flag_present | 111 | ····DW_AT_declaration··DW_FORM_flag_present |
| 112 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 112 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 113 | ···19······DW_TAG_imported_unit····[no·children] | ||
| 114 | ····DW_AT_import·······DW_FORM_ref_addr | ||
| 115 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| 116 | ···20······DW_TAG_subprogram····[has·children] | ||
| 117 | ····DW_AT_external·····DW_FORM_flag_present | ||
| 118 | ····DW_AT_name·········DW_FORM_GNU_strp_alt | ||
| 119 | ····DW_AT_decl_file····DW_FORM_data1 | ||
| 120 | ····DW_AT_decl_line····DW_FORM_data2 | ||
| 121 | ····DW_AT_decl_column··DW_FORM_implicit_const:·13 | ||
| 122 | ····DW_AT_declaration··DW_FORM_flag_present | ||
| 123 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| 124 | ···21······DW_TAG_subprogram····[has·children] | ||
| 125 | ····DW_AT_external·····DW_FORM_flag_present | ||
| 126 | ····DW_AT_name·········DW_FORM_GNU_strp_alt | ||
| 127 | ····DW_AT_decl_file····DW_FORM_data1 | ||
| 128 | ····DW_AT_decl_line····DW_FORM_data1 | ||
| 129 | ····DW_AT_decl_column··DW_FORM_data1 | ||
| 130 | ····DW_AT_type·········DW_FORM_GNU_ref_alt | ||
| 131 | ····DW_AT_declaration··DW_FORM_flag_present | ||
| 132 | ····DW_AT_sibling······DW_FORM_ref_udata | ||
| 133 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| 134 | ··· | 113 | ···19······DW_TAG_variable····[no·children] |
| 135 | ····DW_AT_specification·DW_FORM_GNU_ref_alt | 114 | ····DW_AT_specification·DW_FORM_GNU_ref_alt |
| 136 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 115 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 137 | ···2 | 116 | ···20······DW_TAG_namespace····[has·children] |
| 138 | ····DW_AT_name·········DW_FORM_string | 117 | ····DW_AT_name·········DW_FORM_string |
| 139 | ····DW_AT_sibling······DW_FORM_ref_udata | 118 | ····DW_AT_sibling······DW_FORM_ref_udata |
| 140 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 119 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 141 | ···2 | 120 | ···21······DW_TAG_subprogram····[has·children] |
| 142 | ····DW_AT_external·····DW_FORM_flag_present | 121 | ····DW_AT_external·····DW_FORM_flag_present |
| 143 | ····DW_AT_name·········DW_FORM_GNU_strp_alt | 122 | ····DW_AT_name·········DW_FORM_GNU_strp_alt |
| 144 | ····DW_AT_decl_file····DW_FORM_data1 | 123 | ····DW_AT_decl_file····DW_FORM_data1 |
| 145 | ····DW_AT_decl_line····DW_FORM_data1 | 124 | ····DW_AT_decl_line····DW_FORM_data1 |
| 146 | ····DW_AT_decl_column··DW_FORM_data1 | 125 | ····DW_AT_decl_column··DW_FORM_data1 |
| 147 | ····DW_AT_linkage_name·DW_FORM_GNU_strp_alt | 126 | ····DW_AT_linkage_name·DW_FORM_GNU_strp_alt |
| 148 | ····DW_AT_type·········DW_FORM_GNU_ref_alt | 127 | ····DW_AT_type·········DW_FORM_GNU_ref_alt |
| 149 | ····DW_AT_declaration··DW_FORM_flag_present | 128 | ····DW_AT_declaration··DW_FORM_flag_present |
| 150 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 129 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 130 | ···22······DW_TAG_imported_unit····[no·children] | ||
| 131 | ····DW_AT_import·······DW_FORM_ref_addr | ||
| 132 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| 151 | ···2 | 133 | ···23······DW_TAG_subprogram····[has·children] |
| 152 | ····DW_AT_external·····DW_FORM_flag_present | 134 | ····DW_AT_external·····DW_FORM_flag_present |
| 153 | ····DW_AT_name·········DW_FORM_GNU_strp_alt | 135 | ····DW_AT_name·········DW_FORM_GNU_strp_alt |
| 154 | ····DW_AT_decl_file····DW_FORM_data1 | 136 | ····DW_AT_decl_file····DW_FORM_data1 |
| 155 | ····DW_AT_decl_line····DW_FORM_data2 | 137 | ····DW_AT_decl_line····DW_FORM_data2 |
| 156 | ····DW_AT_decl_column··DW_FORM_data1 | 138 | ····DW_AT_decl_column··DW_FORM_data1 |
| 157 | ····DW_AT_type·········DW_FORM_GNU_ref_alt | 139 | ····DW_AT_type·········DW_FORM_GNU_ref_alt |
| 158 | ····DW_AT_declaration··DW_FORM_flag_present | 140 | ····DW_AT_declaration··DW_FORM_flag_present |
| 159 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 141 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 160 | ···2 | 142 | ···24······DW_TAG_subprogram····[has·children] |
| 161 | ····DW_AT_specification·DW_FORM_GNU_ref_alt | 143 | ····DW_AT_specification·DW_FORM_GNU_ref_alt |
| 162 | ····DW_AT_inline·······DW_FORM_implicit_const:·3 | 144 | ····DW_AT_inline·······DW_FORM_implicit_const:·3 |
| 163 | ····DW_AT_sibling······DW_FORM_ref_udata | 145 | ····DW_AT_sibling······DW_FORM_ref_udata |
| 164 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 146 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 165 | ···2 | 147 | ···25······DW_TAG_subprogram····[has·children] |
| 166 | ····DW_AT_specification·DW_FORM_GNU_ref_alt | 148 | ····DW_AT_specification·DW_FORM_GNU_ref_alt |
| 167 | ····DW_AT_inline·······DW_FORM_implicit_const:·3 | 149 | ····DW_AT_inline·······DW_FORM_implicit_const:·3 |
| 168 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 150 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 169 | ···2 | 151 | ···26······DW_TAG_formal_parameter····[no·children] |
| 170 | ····DW_AT_name·········DW_FORM_string | 152 | ····DW_AT_name·········DW_FORM_string |
| 171 | ····DW_AT_decl_file····DW_FORM_data1 | 153 | ····DW_AT_decl_file····DW_FORM_data1 |
| 172 | ····DW_AT_decl_line····DW_FORM_data1 | 154 | ····DW_AT_decl_line····DW_FORM_data1 |
| 173 | ····DW_AT_decl_column··DW_FORM_data1 | 155 | ····DW_AT_decl_column··DW_FORM_data1 |
| 174 | ····DW_AT_type·········DW_FORM_GNU_ref_alt | 156 | ····DW_AT_type·········DW_FORM_GNU_ref_alt |
| 175 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 157 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 176 | ···2 | 158 | ···27······DW_TAG_subprogram····[has·children] |
| 177 | ····DW_AT_specification·DW_FORM_GNU_ref_alt | 159 | ····DW_AT_specification·DW_FORM_GNU_ref_alt |
| 178 | ····DW_AT_inline·······DW_FORM_data1 | 160 | ····DW_AT_inline·······DW_FORM_data1 |
| 179 | ····DW_AT_sibling······DW_FORM_ref_udata | 161 | ····DW_AT_sibling······DW_FORM_ref_udata |
| 180 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 162 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 181 | ··· | 163 | ···28······DW_TAG_subprogram····[no·children] |
| 182 | ····DW_AT_external·····DW_FORM_flag_present | 164 | ····DW_AT_external·····DW_FORM_flag_present |
| 183 | ····DW_AT_name·········DW_FORM_GNU_strp_alt | 165 | ····DW_AT_name·········DW_FORM_GNU_strp_alt |
| 184 | ····DW_AT_decl_file····DW_FORM_implicit_const:·95 | 166 | ····DW_AT_decl_file····DW_FORM_implicit_const:·95 |
| 185 | ····DW_AT_decl_line····DW_FORM_data1 | 167 | ····DW_AT_decl_line····DW_FORM_data1 |
| 186 | ····DW_AT_decl_column··DW_FORM_implicit_const:·3 | 168 | ····DW_AT_decl_column··DW_FORM_implicit_const:·3 |
| 187 | ····DW_AT_linkage_name·DW_FORM_GNU_strp_alt | 169 | ····DW_AT_linkage_name·DW_FORM_GNU_strp_alt |
| 188 | ····DW_AT_noreturn·····DW_FORM_flag_present | 170 | ····DW_AT_noreturn·····DW_FORM_flag_present |
| 189 | ····DW_AT_declaration··DW_FORM_flag_present | 171 | ····DW_AT_declaration··DW_FORM_flag_present |
| 190 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 172 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 191 | ··· | 173 | ···29······DW_TAG_dwarf_procedure····[no·children] |
| 192 | ····DW_AT_location·····DW_FORM_exprloc | 174 | ····DW_AT_location·····DW_FORM_exprloc |
| 193 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 175 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 194 | ···3 | 176 | ···30······DW_TAG_variable····[no·children] |
| 195 | ····DW_AT_name·········DW_FORM_GNU_strp_alt | 177 | ····DW_AT_name·········DW_FORM_GNU_strp_alt |
| 196 | ····DW_AT_decl_file····DW_FORM_data1 | 178 | ····DW_AT_decl_file····DW_FORM_data1 |
| 197 | ····DW_AT_decl_line····DW_FORM_data1 | 179 | ····DW_AT_decl_line····DW_FORM_data1 |
| 198 | ····DW_AT_decl_column··DW_FORM_data1 | 180 | ····DW_AT_decl_column··DW_FORM_data1 |
| 199 | ····DW_AT_type·········DW_FORM_GNU_ref_alt | 181 | ····DW_AT_type·········DW_FORM_GNU_ref_alt |
| 200 | ····DW_AT_external·····DW_FORM_flag_present | 182 | ····DW_AT_external·····DW_FORM_flag_present |
| 201 | ····DW_AT_declaration··DW_FORM_flag_present | 183 | ····DW_AT_declaration··DW_FORM_flag_present |
| 202 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 184 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 203 | ···3 | 185 | ···31······DW_TAG_imported_declaration····[no·children] |
| 204 | ····DW_AT_decl_file····DW_FORM_data1 | 186 | ····DW_AT_decl_file····DW_FORM_data1 |
| 205 | ····DW_AT_decl_line····DW_FORM_data1 | 187 | ····DW_AT_decl_line····DW_FORM_data1 |
| 206 | ····DW_AT_decl_column··DW_FORM_data1 | 188 | ····DW_AT_decl_column··DW_FORM_data1 |
| 207 | ····DW_AT_import·······DW_FORM_ref_addr | 189 | ····DW_AT_import·······DW_FORM_ref_addr |
| 208 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 190 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 209 | ···3 | 191 | ···32······DW_TAG_partial_unit····[has·children] |
| 210 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 192 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 211 | ··Number·TAG·(0x1 | 193 | ··Number·TAG·(0x1cb) |
| 212 | ···1······DW_TAG_base_type····[no·children] | 194 | ···1······DW_TAG_base_type····[no·children] |
| 213 | ····DW_AT_byte_size····DW_FORM_data1 | 195 | ····DW_AT_byte_size····DW_FORM_data1 |
| 214 | ····DW_AT_encoding·····DW_FORM_data1 | 196 | ····DW_AT_encoding·····DW_FORM_data1 |
| 215 | ····DW_AT_name·········DW_FORM_GNU_strp_alt | 197 | ····DW_AT_name·········DW_FORM_GNU_strp_alt |
| 216 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 198 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 217 | ···2······DW_TAG_base_type····[no·children] | 199 | ···2······DW_TAG_base_type····[no·children] |
| 218 | ····DW_AT_byte_size····DW_FORM_data1 | 200 | ····DW_AT_byte_size····DW_FORM_data1 |
| Offset 259, 27 lines modified | Offset 241, 27 lines modified | ||
| 259 | ····DW_AT_call_file····DW_FORM_data1 | 241 | ····DW_AT_call_file····DW_FORM_data1 |
| 260 | ····DW_AT_call_line····DW_FORM_data1 | 242 | ····DW_AT_call_line····DW_FORM_data1 |
| 261 | ····DW_AT_call_column··DW_FORM_data1 | 243 | ····DW_AT_call_column··DW_FORM_data1 |
| 262 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 244 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 263 | ···10······DW_TAG_formal_parameter····[no·children] | 245 | ···10······DW_TAG_formal_parameter····[no·children] |
| 264 | ····DW_AT_type·········DW_FORM_GNU_ref_alt | 246 | ····DW_AT_type·········DW_FORM_GNU_ref_alt |
| 265 | ····DW_AT·value:·0·····DW_FORM·value:·0 | 247 | ····DW_AT·value:·0·····DW_FORM·value:·0 |
| 266 | ···11······DW_TAG_formal_parameter····[no·children] | ||
| 267 | ····DW_AT_abstract_origin·DW_FORM_GNU_ref_alt | ||
| 268 | ····DW_AT·value:·0·····DW_FORM·value:·0 | ||
| Max diff block lines reached; 285515/291807 bytes (97.84%) of diff not shown. | |||
| Offset 1, 165 lines modified | Offset 1, 166 lines modified | ||
| 1 | Contents·of·the·.debug_aranges·section: | 1 | Contents·of·the·.debug_aranges·section: |
| 2 | ··Length:···················5 | 2 | ··Length:···················580 |
| 3 | ··Version:··················2 | 3 | ··Version:··················2 |
| 4 | ··Offset·into·.debug_info:··0x8 | 4 | ··Offset·into·.debug_info:··0x850 |
| 5 | ··Pointer·Size:·············4 | 5 | ··Pointer·Size:·············4 |
| 6 | ··Segment·Size:·············0 | 6 | ··Segment·Size:·············0 |
| 7 | ····Address····Length | 7 | ····Address····Length |
| 8 | ····0000a | 8 | ····0000a4c0·0000194d |
| 9 | ····00008a | 9 | ····00008a30·0000016b |
| 10 | ····0000be | 10 | ····0000be10·00000006 |
| 11 | ····0000be | 11 | ····0000be20·000000e6 |
| 12 | ····0000bf | 12 | ····0000bf10·00000086 |
| 13 | ····0000 | 13 | ····0000bfa0·000002cc |
| 14 | ····0000c2 | 14 | ····0000c270·0000016e |
| 15 | ····0000c | 15 | ····0000c3e0·000000ac |
| 16 | ····0000c | 16 | ····0000c490·000000db |
| 17 | ····0000c5 | 17 | ····0000c570·0000004b |
| 18 | ····0000c | 18 | ····0000c5c0·000003f6 |
| 19 | ····0000c | 19 | ····0000c9c0·000000f9 |
| 20 | ····0000c | 20 | ····0000cac0·00000708 |
| 21 | ····0000d | 21 | ····0000d1d0·0000013b |
| 22 | ····0000d3 | 22 | ····0000d310·0000014e |
| 23 | ····0000d4 | 23 | ····0000d460·00000030 |
| 24 | ····0000d | 24 | ····0000d490·000001f6 |
| 25 | ····0000d | 25 | ····0000d690·000000a2 |
| 26 | ····0000d7 | 26 | ····0000d740·00000216 |
| 27 | ····0000d | 27 | ····0000d960·000002c1 |
| 28 | ····0000d | 28 | ····0000dc30·00000fdc |
| 29 | ····0000e | 29 | ····0000ec10·00000379 |
| 30 | ····0000 | 30 | ····0000ef90·00000301 |
| 31 | ····0000f | 31 | ····0000f2a0·000000f9 |
| 32 | ····0000f | 32 | ····0000f3a0·00000124 |
| 33 | ····0000f4d0·00000060 | ||
| 33 | ····0000f | 34 | ····0000f530·000000f4 |
| 34 | ····0000f | 35 | ····0000f630·0000017b |
| 35 | ····0000f | 36 | ····0000f7b0·000001ee |
| 36 | ····0000f | 37 | ····0000f9a0·00000072 |
| 37 | ····0000f | 38 | ····0000fa20·000005de |
| 38 | ····00010 | 39 | ····00010000·00000303 |
| 39 | ····00010 | 40 | ····00010310·00000270 |
| 40 | ····00010 | 41 | ····00010580·00000358 |
| 41 | ····00010 | 42 | ····000108e0·000016cc |
| 42 | ····0001 | 43 | ····00011fb0·00000163 |
| 43 | ····00012 | 44 | ····00012120·00000ac4 |
| 44 | ····00012 | 45 | ····00012bf0·00000163 |
| 46 | ····00012d60·000001eb | ||
| 45 | ····00012f | 47 | ····00012f50·0000012b |
| 46 | ····000130c0·0000012b | ||
| 47 | ····00013 | 48 | ····00013080·000004ea |
| 48 | ····00013 | 49 | ····00013570·000002c7 |
| 49 | ····00013 | 50 | ····00013840·00000bfa |
| 50 | ····00014 | 51 | ····00014440·000006ed |
| 52 | ····00014b30·00000bed | ||
| 51 | ····0001 | 53 | ····00015720·00000634 |
| 52 | ····00015 | 54 | ····00015d60·000010ad |
| 53 | ····00016 | 55 | ····00016e10·000008d5 |
| 54 | ····000172b0·000008f5 | ||
| 55 | ····00017 | 56 | ····000176f0·00000201 |
| 56 | ····00017 | 57 | ····00017900·00000231 |
| 57 | ····0001 | 58 | ····00017b40·0000051d |
| 58 | ····00018 | 59 | ····00018060·000004f6 |
| 59 | ····00018 | 60 | ····00018560·0000087a |
| 60 | ····0001 | 61 | ····00018de0·000001a3 |
| 61 | ····0001 | 62 | ····00018f90·000001d5 |
| 62 | ····00019 | 63 | ····00019170·00000146 |
| 63 | ····00019 | 64 | ····000192c0·00000144 |
| 64 | ····00019 | 65 | ····00019410·0000008a |
| 65 | ····00019 | 66 | ····000194a0·00000231 |
| 66 | ····00019c80·0000022c | ||
| 67 | ····00019 | 67 | ····000196e0·0000023e |
| 68 | ····00019920·000000eb | ||
| 69 | ····00019a10·0000020c | ||
| 70 | ····00019c20·000000eb | ||
| 71 | ····00019d10·000008ed | ||
| 68 | ····0001a | 72 | ····0001a600·0000028b |
| 69 | ····0001a230·00000179 | ||
| 70 | ····0001a | 73 | ····0001a890·00000783 |
| 71 | ····0001b | 74 | ····0001b020·00000523 |
| 72 | ····0001b | 75 | ····0001b550·00000ca2 |
| 73 | ····0001bcf0·00000653 | ||
| 74 | ····0001c350·00000cf7 | ||
| 75 | ····00009d | 76 | ····00009d60·000004ec |
| 76 | ····0000a2 | 77 | ····0000a250·00000038 |
| 77 | ····00000000·00000000 | 78 | ····00000000·00000000 |
| 78 | ··Length:···················132 | 79 | ··Length:···················132 |
| 79 | ··Version:··················2 | 80 | ··Version:··················2 |
| 80 | ··Offset·into·.debug_info:··0x8 | 81 | ··Offset·into·.debug_info:··0x8c931 |
| 81 | ··Pointer·Size:·············4 | 82 | ··Pointer·Size:·············4 |
| 82 | ··Segment·Size:·············0 | 83 | ··Segment·Size:·············0 |
| 83 | ····Address····Length | 84 | ····Address····Length |
| 84 | ····0001 | 85 | ····0001c210·000032e8 |
| 85 | ····00008b | 86 | ····00008b9c·00000325 |
| 86 | ····0000be | 87 | ····0000be10·00000006 |
| 87 | ····000 | 88 | ····0001f500·00000156 |
| 88 | ····000 | 89 | ····0001f660·000000f4 |
| 89 | ····000 | 90 | ····0001f760·00000334 |
| 90 | ····000 | 91 | ····0001faa0·00000164 |
| 91 | ····000 | 92 | ····0001fc10·00000172 |
| 92 | ····000 | 93 | ····0001fd90·0000016e |
| 93 | ····000 | 94 | ····0001ff00·00000164 |
| 94 | ····00020 | 95 | ····00020070·000000d2 |
| 95 | ····00020 | 96 | ····00020150·00000140 |
| 96 | ····0002 | 97 | ····00020290·0000022e |
| 97 | ····0000a2 | 98 | ····0000a290·00000038 |
| 98 | ····00000000·00000000 | 99 | ····00000000·00000000 |
| 99 | ··Length:···················68 | 100 | ··Length:···················68 |
| 100 | ··Version:··················2 | 101 | ··Version:··················2 |
| 101 | ··Offset·into·.debug_info:··0xa | 102 | ··Offset·into·.debug_info:··0xab525 |
| 102 | ··Pointer·Size:·············4 | 103 | ··Pointer·Size:·············4 |
| 103 | ··Segment·Size:·············0 | 104 | ··Segment·Size:·············0 |
| 104 | ····Address····Length | 105 | ····Address····Length |
| 105 | ····0002 | 106 | ····000204c0·00001361 |
| 106 | ····00008e | 107 | ····00008ec2·00000070 |
| 107 | ····0000be | 108 | ····0000be10·00000006 |
| 108 | ····0002 | 109 | ····00021830·000002c4 |
| 109 | ····0001 | 110 | ····00011fb0·00000163 |
| 110 | ····0000a | 111 | ····0000a2d0·00000038 |
| 111 | ····00000000·00000000 | 112 | ····00000000·00000000 |
| 112 | ··Length:···················132 | 113 | ··Length:···················132 |
| 113 | ··Version:··················2 | 114 | ··Version:··················2 |
| 114 | ··Offset·into·.debug_info:··0xb | 115 | ··Offset·into·.debug_info:··0xb275d |
| 115 | ··Pointer·Size:·············4 | 116 | ··Pointer·Size:·············4 |
| 116 | ··Segment·Size:·············0 | 117 | ··Segment·Size:·············0 |
| Max diff block lines reached; 1692/6846 bytes (24.72%) of diff not shown. | |||
| Offset 1, 180133 lines modified | Offset 1, 177795 lines modified | ||
| 1 | Contents·of·the·.debug_loclists·section: | 1 | Contents·of·the·.debug_loclists·section: |
| 2 | ····Offset···Begin············End··············Expression | 2 | ····Offset···Begin············End··············Expression |
| 3 | ····0000000c·v0000002·v0000000·location·view·pair | 3 | ····0000000c·v0000002·v0000000·location·view·pair |
| 4 | ····0000000e·v0000002·v0000000·views·at·0000000c·for: | 4 | ····0000000e·v0000002·v0000000·views·at·0000000c·for: |
| 5 | ·············0000a2 | 5 | ·············0000a250·0000a282·(DW_OP_lit1;·DW_OP_stack_value) |
| 6 | ····00000017·<End·of·list> | 6 | ····00000017·<End·of·list> |
| 7 | ····00000018·v0000002·v0000000·location·view·pair | 7 | ····00000018·v0000002·v0000000·location·view·pair |
| 8 | ····0000001a·v0000002·v0000000·views·at·00000018·for: | 8 | ····0000001a·v0000002·v0000000·views·at·00000018·for: |
| 9 | ·············0000a2 | 9 | ·············0000a250·0000a282·(DW_OP_const2u:·65535;·DW_OP_stack_value) |
| 10 | ····00000025·<End·of·list> | 10 | ····00000025·<End·of·list> |
| 11 | ····00000026·v0000000·v0000000·location·view·pair | 11 | ····00000026·v0000000·v0000000·location·view·pair |
| 12 | ····00000028·v0000000·v0000000·location·view·pair | 12 | ····00000028·v0000000·v0000000·location·view·pair |
| 13 | ····0000002a·v0000000·v0000000·location·view·pair | 13 | ····0000002a·v0000000·v0000000·location·view·pair |
| 14 | ····0000002c·v0000000·v0000000·location·view·pair | 14 | ····0000002c·v0000000·v0000000·location·view·pair |
| 15 | ····0000002e·0001 | 15 | ····0000002e·00019a10·(base·address) |
| 16 | ····00000033·v0000000·v0000000·views·at·00000026·for: | 16 | ····00000033·v0000000·v0000000·views·at·00000026·for: |
| 17 | ·············0001 | 17 | ·············00019a10·00019a74·(DW_OP_fbreg:·4) |
| 18 | ····00000039·v0000000·v0000000·views·at·00000028·for: | 18 | ····00000039·v0000000·v0000000·views·at·00000028·for: |
| 19 | ·············0001 | 19 | ·············00019a74·00019a91·(DW_OP_reg0·(eax)) |
| 20 | ····0000003f·v0000000·v0000000·views·at·0000002a·for: | 20 | ····0000003f·v0000000·v0000000·views·at·0000002a·for: |
| 21 | ·············0001 | 21 | ·············00019a91·00019a99·(DW_OP_breg0·(eax):·-16;·DW_OP_stack_value) |
| 22 | ····00000048·v0000000·v0000000·views·at·0000002c·for: | 22 | ····00000048·v0000000·v0000000·views·at·0000002c·for: |
| 23 | ·············0001 | 23 | ·············00019b32·00019c1c·(DW_OP_fbreg:·4) |
| 24 | ····00000050·<End·of·list> | 24 | ····00000050·<End·of·list> |
| 25 | ····00000051·v0000000·v0000000·location·view·pair | 25 | ····00000051·v0000000·v0000000·location·view·pair |
| 26 | ····00000053·v0000000·v0000000·location·view·pair | ||
| 27 | ····00000055·v0000000·v0000000·location·view·pair | ||
| 28 | ····00000057·00019a36·(base·address) | ||
| 26 | ····0000005 | 29 | ····0000005c·v0000000·v0000000·views·at·00000051·for: |
| 30 | ·············00019a36·00019a3c·(DW_OP_breg0·(eax):·0;·DW_OP_consts:·-858993459;·DW_OP_mul;·DW_OP_stack_value) | ||
| 27 | ·············0001a040·0001a081·(DW_OP_fbreg:·12;·DW_OP_deref) | ||
| 28 | ····0000005d·<End·of·list> | ||
| 29 | ····0000005e·v0000000·v0000000·location·view·pair | ||
| 30 | ····00000060·v0000000·v0000000·location·view·pair | ||
| 31 | ····00000062·v0000000·v0000000·location·view·pair | ||
| 32 | ····00000064·0001a06a·(base·address) | ||
| 33 | ····0000006 | 31 | ····0000006a·v0000000·v0000000·views·at·00000053·for: |
| 34 | ·············0001a06a·0001a070·(DW_OP_breg0·(eax):·0;·DW_OP_consts:·-858993459;·DW_OP_mul;·DW_OP_stack_value) | ||
| 35 | ····00000077·v0000000·v0000000·views·at·00000060·for: | ||
| 36 | ·············0001 | 32 | ·············00019a3c·00019a4f·(DW_OP_reg1·(ecx)) |
| 37 | ····0000007c·v0000000·v0000000·views·at·00000062·for: | ||
| 38 | ·············0001a1a0·0001a1ac·(DW_OP_reg6·(esi)) | ||
| 39 | ····00000083·<End·of·list> | ||
| 40 | ····00000084·v0000000·v0000000·location·view·pair | ||
| 41 | ····00000086·v0000000·v0000000·location·view·pair | ||
| 42 | ····00000088·0001a174·(base·address) | ||
| 43 | ····0000008d·v0000000·v0000000·views·at·00000084·for: | ||
| 44 | ·············0001a174·0001a19a·(DW_OP_reg7·(edi)) | ||
| 45 | ····00000092·v0000000·v0000000·views·at·00000086·for: | ||
| 46 | ·············0001a1cb·0001a222·(DW_OP_reg7·(edi)) | ||
| 47 | ····00000098·<End·of·list> | ||
| 48 | ····00000099·v0000000·v0000000·location·view·pair | ||
| 49 | ····0000009b·v0000000·v0000000·location·view·pair | ||
| 50 | ····0000009d·v0000000·v0000000·location·view·pair | ||
| 51 | ····0000009f·v0000000·v0000000·location·view·pair | ||
| 52 | ····000000a1·0001a186·(base·address) | ||
| 53 | ····000000 | 33 | ····0000006f·v0000000·v0000000·views·at·00000055·for: |
| 54 | ·············0001a186·0001a188·(DW_OP_breg3·(ebx):·0;·DW_OP_breg0·(eax):·0;·DW_OP_plus;·DW_OP_stack_value) | ||
| 55 | ····000000b0·v0000000·v0000000·views·at·0000009b·for: | ||
| 56 | ·············0001 | 34 | ·············00019b5a·00019b66·(DW_OP_reg7·(edi)) |
| 57 | ····000000b5·v0000000·v0000000·views·at·0000009d·for: | ||
| 58 | ·············0001a1cb·0001a1f3·(DW_OP_reg3·(ebx)) | ||
| 59 | ····000000ba·v0000000·v0000000·views·at·0000009f·for: | ||
| 60 | ·············0001a20a·0001a222·(DW_OP_reg3·(ebx)) | ||
| 61 | ····000000 | 35 | ····00000076·<End·of·list> |
| 62 | ····000000 | 36 | ····00000077·v0000000·v0000000·location·view·pair |
| 37 | ····00000079·v0000000·v0000000·location·view·pair | ||
| 38 | ····0000007b·v0000000·v0000000·location·view·pair | ||
| 39 | ····0000007d·v0000000·v0000000·location·view·pair | ||
| 40 | ····0000007f·v0000000·v0000000·location·view·pair | ||
| 41 | ····00000081·00019b32·(base·address) | ||
| 42 | ····00000086·v0000000·v0000000·views·at·00000077·for: | ||
| 43 | ·············00019b32·00019b58·(DW_OP_fbreg:·12) | ||
| 63 | ····000000 | 44 | ····0000008c·v0000000·v0000000·views·at·00000079·for: |
| 64 | ·············0001 | 45 | ·············00019ba3·00019bad·(DW_OP_reg0·(eax)) |
| 46 | ····00000091·v0000000·v0000000·views·at·0000007b·for: | ||
| 47 | ·············00019bad·00019c03·(DW_OP_fbreg:·12) | ||
| 48 | ····00000098·v0000000·v0000000·views·at·0000007d·for: | ||
| 49 | ·············00019c03·00019c0f·(DW_OP_reg0·(eax)) | ||
| 50 | ····0000009f·v0000000·v0000000·views·at·0000007f·for: | ||
| 51 | ·············00019c0f·00019c1c·(DW_OP_fbreg:·12) | ||
| 65 | ····000000 | 52 | ····000000a7·<End·of·list> |
| 53 | ····000000a8·v0000000·v0000000·location·view·pair | ||
| 54 | ····000000aa·v0000000·v0000000·location·view·pair | ||
| 66 | ····000000 | 55 | ····000000ac·v0000000·v0000000·location·view·pair |
| 67 | ····000000 | 56 | ····000000ae·v0000000·v0000000·location·view·pair |
| 68 | ····000000 | 57 | ····000000b0·00019b44·(base·address) |
| 69 | ····000000d6·v0000000·v0000000·views·at·000000cd·for: | ||
| 70 | ·············0001a1e6·0001a1fc·(DW_OP_reg0·(eax)) | ||
| 71 | ····000000 | 58 | ····000000b5·v0000000·v0000000·views·at·000000a8·for: |
| 59 | ·············00019b44·00019b46·(DW_OP_breg3·(ebx):·0;·DW_OP_breg1·(ecx):·0;·DW_OP_plus;·DW_OP_stack_value) | ||
| 60 | ····000000bf·v0000000·v0000000·views·at·000000aa·for: | ||
| 61 | ·············00019b46·00019b58·(DW_OP_reg3·(ebx)) | ||
| 62 | ····000000c4·v0000000·v0000000·views·at·000000ac·for: | ||
| 72 | ·············0001 | 63 | ·············00019ba3·00019bd3·(DW_OP_reg3·(ebx)) |
| 64 | ····000000ca·v0000000·v0000000·views·at·000000ae·for: | ||
| 65 | ·············00019c03·00019c1c·(DW_OP_reg3·(ebx)) | ||
| 73 | ····000000 | 66 | ····000000d1·<End·of·list> |
| 74 | ····000000 | 67 | ····000000d2·v0000000·v0000000·location·view·pair |
| 75 | ····000000 | 68 | ····000000d4·v0000000·v0000000·views·at·000000d2·for: |
| 76 | ·············0001 | 69 | ·············00019bba·00019bc8·(DW_OP_reg5·(ebp)) |
| 77 | ····000000 | 70 | ····000000dc·<End·of·list> |
| 78 | ····000000 | 71 | ····000000dd·v0000000·v0000000·location·view·pair |
| 79 | ····000000 | 72 | ····000000df·v0000000·v0000000·views·at·000000dd·for: |
| Max diff block lines reached; 13981657/13988738 bytes (99.95%) of diff not shown. | |||
| Offset 1, 165 lines modified | Offset 1, 166 lines modified | ||
| 1 | Contents·of·the·.debug_aranges·section: | 1 | Contents·of·the·.debug_aranges·section: |
| 2 | ··Length:···················5 | 2 | ··Length:···················580 |
| 3 | ··Version:··················2 | 3 | ··Version:··················2 |
| 4 | ··Offset·into·.debug_info:··0x8 | 4 | ··Offset·into·.debug_info:··0x850 |
| 5 | ··Pointer·Size:·············4 | 5 | ··Pointer·Size:·············4 |
| 6 | ··Segment·Size:·············0 | 6 | ··Segment·Size:·············0 |
| 7 | ····Address····Length | 7 | ····Address····Length |
| 8 | ····0000a | 8 | ····0000a4c0·0000194d |
| 9 | ····00008a | 9 | ····00008a30·0000016b |
| 10 | ····0000be | 10 | ····0000be10·00000006 |
| 11 | ····0000be | 11 | ····0000be20·000000e6 |
| 12 | ····0000bf | 12 | ····0000bf10·00000086 |
| 13 | ····0000 | 13 | ····0000bfa0·000002cc |
| 14 | ····0000c2 | 14 | ····0000c270·0000016e |
| 15 | ····0000c | 15 | ····0000c3e0·000000ac |
| 16 | ····0000c | 16 | ····0000c490·000000db |
| 17 | ····0000c5 | 17 | ····0000c570·0000004b |
| 18 | ····0000c | 18 | ····0000c5c0·000003f6 |
| 19 | ····0000c | 19 | ····0000c9c0·000000f9 |
| 20 | ····0000c | 20 | ····0000cac0·00000708 |
| 21 | ····0000d | 21 | ····0000d1d0·0000013b |
| 22 | ····0000d3 | 22 | ····0000d310·0000014e |
| 23 | ····0000d4 | 23 | ····0000d460·00000030 |
| 24 | ····0000d | 24 | ····0000d490·000001f6 |
| 25 | ····0000d | 25 | ····0000d690·000000a2 |
| 26 | ····0000d7 | 26 | ····0000d740·00000216 |
| 27 | ····0000d | 27 | ····0000d960·000002c1 |
| 28 | ····0000d | 28 | ····0000dc30·00000fdc |
| 29 | ····0000e | 29 | ····0000ec10·00000379 |
| 30 | ····0000 | 30 | ····0000ef90·00000301 |
| 31 | ····0000f | 31 | ····0000f2a0·000000f9 |
| 32 | ····0000f | 32 | ····0000f3a0·00000124 |
| 33 | ····0000f4d0·00000060 | ||
| 33 | ····0000f | 34 | ····0000f530·000000f4 |
| 34 | ····0000f | 35 | ····0000f630·0000017b |
| 35 | ····0000f | 36 | ····0000f7b0·000001ee |
| 36 | ····0000f | 37 | ····0000f9a0·00000072 |
| 37 | ····0000f | 38 | ····0000fa20·000005de |
| 38 | ····00010 | 39 | ····00010000·00000303 |
| 39 | ····00010 | 40 | ····00010310·00000270 |
| 40 | ····00010 | 41 | ····00010580·00000358 |
| 41 | ····00010 | 42 | ····000108e0·000016cc |
| 42 | ····0001 | 43 | ····00011fb0·00000163 |
| 43 | ····00012 | 44 | ····00012120·00000ac4 |
| 44 | ····00012 | 45 | ····00012bf0·00000163 |
| 46 | ····00012d60·000001eb | ||
| 45 | ····00012f | 47 | ····00012f50·0000012b |
| 46 | ····000130c0·0000012b | ||
| 47 | ····00013 | 48 | ····00013080·000004ea |
| 48 | ····00013 | 49 | ····00013570·000002c7 |
| 49 | ····00013 | 50 | ····00013840·00000bfa |
| 50 | ····00014 | 51 | ····00014440·000006ed |
| 52 | ····00014b30·00000bed | ||
| 51 | ····0001 | 53 | ····00015720·00000634 |
| 52 | ····00015 | 54 | ····00015d60·000010ad |
| 53 | ····00016 | 55 | ····00016e10·000008d5 |
| 54 | ····000172b0·000008f5 | ||
| 55 | ····00017 | 56 | ····000176f0·00000201 |
| 56 | ····00017 | 57 | ····00017900·00000231 |
| 57 | ····0001 | 58 | ····00017b40·0000051d |
| 58 | ····00018 | 59 | ····00018060·000004f6 |
| 59 | ····00018 | 60 | ····00018560·0000087a |
| 60 | ····0001 | 61 | ····00018de0·000001a3 |
| 61 | ····0001 | 62 | ····00018f90·000001d5 |
| 62 | ····00019 | 63 | ····00019170·00000146 |
| 63 | ····00019 | 64 | ····000192c0·00000144 |
| 64 | ····00019 | 65 | ····00019410·0000008a |
| 65 | ····00019 | 66 | ····000194a0·00000231 |
| 66 | ····00019c80·0000022c | ||
| 67 | ····00019 | 67 | ····000196e0·0000023e |
| 68 | ····00019920·000000eb | ||
| 69 | ····00019a10·0000020c | ||
| 70 | ····00019c20·000000eb | ||
| 71 | ····00019d10·000008ed | ||
| 68 | ····0001a | 72 | ····0001a600·0000028b |
| 69 | ····0001a230·00000179 | ||
| 70 | ····0001a | 73 | ····0001a890·00000783 |
| 71 | ····0001b | 74 | ····0001b020·00000523 |
| 72 | ····0001b | 75 | ····0001b550·00000ca2 |
| 73 | ····0001bcf0·00000653 | ||
| 74 | ····0001c350·00000cf7 | ||
| 75 | ····00009d | 76 | ····00009d60·000004ec |
| 76 | ····0000a2 | 77 | ····0000a250·00000038 |
| 77 | ····00000000·00000000 | 78 | ····00000000·00000000 |
| 78 | ··Length:···················132 | 79 | ··Length:···················132 |
| 79 | ··Version:··················2 | 80 | ··Version:··················2 |
| 80 | ··Offset·into·.debug_info:··0x8 | 81 | ··Offset·into·.debug_info:··0x8c931 |
| 81 | ··Pointer·Size:·············4 | 82 | ··Pointer·Size:·············4 |
| 82 | ··Segment·Size:·············0 | 83 | ··Segment·Size:·············0 |
| 83 | ····Address····Length | 84 | ····Address····Length |
| 84 | ····0001 | 85 | ····0001c210·000032e8 |
| 85 | ····00008b | 86 | ····00008b9c·00000325 |
| 86 | ····0000be | 87 | ····0000be10·00000006 |
| 87 | ····000 | 88 | ····0001f500·00000156 |
| 88 | ····000 | 89 | ····0001f660·000000f4 |
| 89 | ····000 | 90 | ····0001f760·00000334 |
| 90 | ····000 | 91 | ····0001faa0·00000164 |
| 91 | ····000 | 92 | ····0001fc10·00000172 |
| 92 | ····000 | 93 | ····0001fd90·0000016e |
| 93 | ····000 | 94 | ····0001ff00·00000164 |
| 94 | ····00020 | 95 | ····00020070·000000d2 |
| 95 | ····00020 | 96 | ····00020150·00000140 |
| 96 | ····0002 | 97 | ····00020290·0000022e |
| 97 | ····0000a2 | 98 | ····0000a290·00000038 |
| 98 | ····00000000·00000000 | 99 | ····00000000·00000000 |
| 99 | ··Length:···················68 | 100 | ··Length:···················68 |
| 100 | ··Version:··················2 | 101 | ··Version:··················2 |
| 101 | ··Offset·into·.debug_info:··0xa | 102 | ··Offset·into·.debug_info:··0xab525 |
| 102 | ··Pointer·Size:·············4 | 103 | ··Pointer·Size:·············4 |
| 103 | ··Segment·Size:·············0 | 104 | ··Segment·Size:·············0 |
| 104 | ····Address····Length | 105 | ····Address····Length |
| 105 | ····0002 | 106 | ····000204c0·00001361 |
| 106 | ····00008e | 107 | ····00008ec2·00000070 |
| 107 | ····0000be | 108 | ····0000be10·00000006 |
| 108 | ····0002 | 109 | ····00021830·000002c4 |
| 109 | ····0001 | 110 | ····00011fb0·00000163 |
| 110 | ····0000a | 111 | ····0000a2d0·00000038 |
| 111 | ····00000000·00000000 | 112 | ····00000000·00000000 |
| 112 | ··Length:···················132 | 113 | ··Length:···················132 |
| 113 | ··Version:··················2 | 114 | ··Version:··················2 |
| 114 | ··Offset·into·.debug_info:··0xb | 115 | ··Offset·into·.debug_info:··0xb275d |
| 115 | ··Pointer·Size:·············4 | 116 | ··Pointer·Size:·············4 |
| 116 | ··Segment·Size:·············0 | 117 | ··Segment·Size:·············0 |
| Max diff block lines reached; 1692/6846 bytes (24.72%) of diff not shown. | |||
| Offset 1, 212 lines modified | Offset 1, 190 lines modified | ||
| 1 | GCC:·(Debian·12.2.0-14)·12.2.0 | 1 | GCC:·(Debian·12.2.0-14)·12.2.0 |
| 2 | :cW^BXa6 | ||
| 3 | SMv3`"N_ | ||
| 4 | O[<ML)<v- | ||
| 5 | vfwq!)!p2 | ||
| 6 | -a#T+d`u*5 | ||
| 7 | &P\>h#Gy | ||
| 8 | vi7\W0mw | ||
| 9 | <P@uw0i8f | ||
| 10 | N^93bK^) | ||
| 11 | "0pC%nQNT | ||
| 12 | S@t.Z*#p | ||
| 13 | ?2BBGx:- | ||
| 14 | 4nRh·dPh | ||
| 15 | )<ocvPgp | ||
| 16 | ·PlK]3t^ | ||
| 17 | q\;8,{/s | ||
| 18 | o/%4^w-! | ||
| 19 | wqTo7Rt] | ||
| 20 | piKSE5&ET | ||
| 21 | QT@PpGDDQ | ||
| 22 | BCY018(D | ||
| 23 | KHlD8#>H | ||
| 24 | :HW-}{1}{Y | ||
| 25 | yw@,'t$}w | ||
| 26 | 0q4X0·AoJ | ||
| 27 | bLmU·-(c·#au | ||
| 28 | Scgv'W:' | ||
| 29 | L_O!DN<m | ||
| 30 | 9[@4e\kFD | ||
| 31 | S4>k7+>; | ||
| 32 | nJt$BZMQ | ||
| 33 | AjEqO.Fv1 | ||
| 34 | Dr56'd<J | ||
| 35 | :!rr<W`e | ||
| 36 | a<5z<oA{ | ||
| 37 | 5<u0j4<; | ||
| 38 | {kkyQp.J | ||
| 39 | F=yGw`fs | ||
| 40 | 4bo(NcS?r | ||
| 41 | nl@]B5`V)k | ||
| 42 | iq.3Ue&U | ||
| 43 | VaZEtLPd_ | ||
| 44 | ruJ?,&G'0: | ||
| 45 | FTV+c2P9 | ||
| 46 | ?2x·f(5# | ||
| 47 | Vfz7bU9/ | ||
| 48 | eiLIS]Vp[t | ||
| 49 | _jk`» ek-0 | ||
| 50 | DLuk1<RL} | ||
| 51 | C6on;V·6 | ||
| 52 | mu6}AEnn | ||
| 53 | DDc|)-FOa | ||
| 54 | n?gjQM'x | ||
| 55 | UP]?)PA>j | ||
| 56 | x~#Pm;/PA> | ||
| 57 | zZ^@{\Ph» . | ||
| 58 | KKiP!8XJ | ||
| 59 | T+·/-#PmC | ||
| 60 | fQQ<(\U, | ||
| 61 | <BIzB{A{ | ||
| 62 | BdTfDF^,l | ||
| 63 | i|2,HV+HeE | ||
| 64 | ~TzyV-{.tr | ||
| 65 | W0iA{[n; | ||
| 66 | "zajc?|} | ||
| 67 | ]_·lotMb | ||
| 68 | P8~ot8g~ | ||
| 69 | )·b(B?*>< | ||
| 70 | k-(wse}u=I;9 | ||
| 71 | lp6@X{R68q | ||
| 72 | *(<0F8B_ | ||
| 73 | MG9z=Yfy` | ||
| 74 | Tami%d&1 | ||
| 75 | %|-3ShmU | ||
| 76 | T3@LCp;8 | ||
| 77 | MRGz7@\C | ||
| 78 | 1i5X+ceL | ||
| 79 | ;U&gW!\J | ||
| 80 | v1d;6d;m | ||
| 81 | |1ix5!T/& | ||
| 82 | _*X» a9]# | ||
| 83 | tR^WT%o?8 | ||
| 84 | 0~qUF\7N | ||
| 85 | )&EQooPQ | ||
| 86 | T|QrY.=7 | ||
| 87 | &hIUYRU} | ||
| 88 | c%Uu.[UW | ||
| 89 | 4`WDRz6I/ | ||
| 90 | DY-f?C7E | ||
| 91 | ?GA8xZ_?O! | ||
| 92 | q%Zo~0Rj | ||
| 93 | wknq9wRn | ||
| 94 | Hs|<^mG` | ||
| 95 | &#<"M(J( | ||
| 96 | "?wDd}i8 | ||
| 97 | >HzkwH4o | ||
| 98 | *JJWY`ep | ||
| 99 | 61Dnjdqof | ||
| 100 | _rS).avV= | ||
| 101 | 2M^/]MKq | ||
| 102 | 6mqK1+.)R[ | ||
| 103 | P-4~/kV[_k | ||
| 104 | d,XW75L;8. | ||
| 105 | /a`)tfPw | ||
| 106 | JKwU,!V) | ||
| 107 | +l7LS1.J | ||
| 108 | K+M>Z@iR | ||
| 109 | umxKq/ubua | ||
| 110 | x0=7^Yhn | ||
| 111 | OLd4Y}*k | ||
| 112 | `hpR$/XX/ | ||
| 113 | ,bG?%ilwdJO | ||
| 114 | P<#4G\3\ | ||
| 115 | H4GZ%U^c | ||
| 116 | [Gu3?_~<f8 | ||
| 117 | C(-=vvok | ||
| 118 | {uZVEZ+. | ||
| 119 | `·[T?~R= | ||
| 120 | g1_)>T<D | ||
| 2 | ~w-YRvcYL | ||
| 3 | 0-FOG=)Ty. | ||
| 4 | 9H;O4/W$ | ||
| 5 | 6» 6$» +mw | ||
| 6 | N(P@uw0v | ||
| 7 | p4SO^W8Z3 | ||
| 8 | » JZAr%>1 | ||
| Max diff block lines reached; 10935/13746 bytes (79.55%) of diff not shown. | |||
| Offset 1, 7 lines modified | Offset 1, 7 lines modified | ||
| 1 | Disassembly·of·section·.plt.got: | 1 | Disassembly·of·section·.plt.got: |
| 2 | 00008a | 2 | 00008a20·<.plt.got>: |
| 3 | » ... | 3 | » ... |
| Offset 1, 790 lines modified | Offset 1, 796 lines modified | ||
| 1 | Disassembly·of·section·.text: | 1 | Disassembly·of·section·.text: |
| 2 | 00008a | 2 | 00008a30·<RetrieveParameterInt(OptArgs&,·Json::Value&,·char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·int)·[clone·.cold]>: |
| 3 | » ... | 3 | » ... |
| 4 | 00008a | 4 | 00008a4d·<RetrieveParameterDouble(OptArgs&,·Json::Value&,·char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·double)·[clone·.cold]>: |
| 5 | » ... | 5 | » ... |
| 6 | 00008a | 6 | 00008a6a·<std::_Rb_tree_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·Spectrum::TKmer>·>·std::_Rb_tree<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·Spectrum::TKmer>,·std::_Select1st<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·Spectrum::TKmer>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·Spectrum::TKmer>·>·>::_M_emplace_hint_unique<std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>,·std::tuple<>·>(std::_Rb_tree_const_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·Spectrum::TKmer>·>,·std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>&&,·std::tuple<>&&)·[clone·.isra.0]·[clone·.cold]>: |
| 7 | » ... | 7 | » ... |
| 8 | 00008a | 8 | 00008a99·<main.cold>: |
| 9 | » ... | 9 | » ... |
| 10 | 00008b | 10 | 00008b9c·<TargetsManager::AddExtraTrim(TargetsManager::UnmergedTarget&,·char*,·int)·[clone·.cold]>: |
| 11 | » ... | 11 | » ... |
| 12 | 00008c | 12 | 00008c04·<TargetsManager::LoadRawTargets(ReferenceReader·const&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·std::__cxx11::list<TargetsManager::UnmergedTarget,·std::allocator<TargetsManager::UnmergedTarget>·>&)·[clone·.cold]>: |
| 13 | » ... | 13 | » ... |
| 14 | 00008c | 14 | 00008c4a·<TargetsManager::TrimAmpliseqPrimers(Alignment*,·int)·const·[clone·.cold]>: |
| 15 | » ... | 15 | » ... |
| 16 | 00008e | 16 | 00008e0a·<TargetsManager::Initialize(ReferenceReader·const&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·bool)·[clone·.cold]>: |
| 17 | » ... | 17 | » ... |
| 18 | 00008e | 18 | 00008ec2·<SampleManager::IdentifySample(BamTools::BamAlignment·const&,·int&,·bool&)·const·[clone·.cold]>: |
| 19 | » ... | 19 | » ... |
| 20 | 00008 | 20 | 00008ee8·<std::_Rb_tree_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·int>·>·std::_Rb_tree<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·int>,·std::_Select1st<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·int>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·int>·>·>::_M_emplace_hint_unique<std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>,·std::tuple<>·>(std::_Rb_tree_const_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·int>·>,·std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>&&,·std::tuple<>&&)·[clone·.isra.0]·[clone·.cold]>: |
| 21 | » ... | 21 | » ... |
| 22 | 00008f | 22 | 00008f1c·<SampleManager::Initialize(BamTools::SamHeader·const&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&)·[clone·.cold]>: |
| 23 | » ... | 23 | » ... |
| 24 | 00008f | 24 | 00008f32·<std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>::operator=(std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>·const&)·[clone·.isra.0]·[clone·.cold]>: |
| 25 | » ... | 25 | » ... |
| 26 | 00008f | 26 | 00008fe4·<OptArgument::OptArgument()·[clone·.cold]>: |
| 27 | » ... | 27 | » ... |
| 28 | 000090 | 28 | 00009032·<OptArgs::CheckNoLeftovers()·[clone·.cold]>: |
| 29 | » ... | 29 | » ... |
| 30 | 00009 | 30 | 000090f2·<OptArgs::StringToIntVector(std::vector<int,·std::allocator<int>·>&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·char)·[clone·.cold]>: |
| 31 | » ... | 31 | » ... |
| 32 | 000091 | 32 | 00009140·<OptArgs::StringToDoubleVector(std::vector<double,·std::allocator<double>·>&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·char)·[clone·.cold]>: |
| 33 | » ... | 33 | » ... |
| 34 | 000091 | 34 | 0000919c·<std::_Rb_tree_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·OptArgument>·>·std::_Rb_tree<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·OptArgument>,·std::_Select1st<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·OptArgument>·>,·std::less<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>,·std::allocator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·OptArgument>·>·>::_M_emplace_hint_unique<std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>,·std::tuple<>·>(std::_Rb_tree_const_iterator<std::pair<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const,·OptArgument>·>,·std::piecewise_construct_t·const&,·std::tuple<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&>&&,·std::tuple<>&&)·[clone·.isra.0]·[clone·.cold]>: |
| 35 | » ... | 35 | » ... |
| 36 | 000091 | 36 | 000091e2·<OptArgs::GetOptArgument(char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&)·[clone·.cold]>: |
| 37 | » ... | 37 | » ... |
| 38 | 000092 | 38 | 00009290·<OptArgs::GetOption(std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&)·[clone·.cold]>: |
| 39 | » ... | 39 | » ... |
| 40 | 000092 | 40 | 000092ce·<OptArgs::GetOption(bool&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&)·[clone·.cold]>: |
| 41 | » ... | 41 | » ... |
| 42 | 000093 | 42 | 00009322·<OptArgs::GetOption(double&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&)·[clone·.cold]>: |
| 43 | » ... | 43 | » ... |
| 44 | 000093 | 44 | 00009392·<OptArgs::GetOption(long&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&)·[clone·.cold]>: |
| 45 | » ... | 45 | » ... |
| 46 | 000094 | 46 | 00009406·<OptArgs::GetOption(std::vector<double,·std::allocator<double>·>&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·char)·[clone·.cold]>: |
| 47 | » ... | 47 | » ... |
| 48 | 000094 | 48 | 00009442·<OptArgs::GetOption(std::vector<int,·std::allocator<int>·>&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·char)·[clone·.cold]>: |
| 49 | » ... | 49 | » ... |
| 50 | 000094 | 50 | 0000947e·<OptArgs::GetOption(std::vector<unsigned·int,·std::allocator<unsigned·int>·>&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·char)·[clone·.cold]>: |
| 51 | » ... | 51 | » ... |
| 52 | 000095 | 52 | 00009504·<OptArgs::GetOption(std::vector<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·std::allocator<std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·>·>&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·char)·[clone·.cold]>: |
| 53 | » ... | 53 | » ... |
| 54 | 000095 | 54 | 00009542·<OptArgs::GetOption(int&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&)·[clone·.cold]>: |
| 55 | » ... | 55 | » ... |
| 56 | 000095 | 56 | 000095b6·<OptArgs::GetOption(unsigned·int&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&)·[clone·.cold]>: |
| 57 | » ... | 57 | » ... |
| 58 | 000096 | 58 | 0000962a·<OptArgs::GetFirstBoolean(char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·bool)·[clone·.cold]>: |
| 59 | » ... | 59 | » ... |
| 60 | 000096 | 60 | 00009664·<OptArgs::GetFirstBoolean(char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·char·const*)·[clone·.cold]>: |
| 61 | » ... | 61 | » ... |
| 62 | 000096 | 62 | 0000969e·<OptArgs::GetFirstString(char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&)·[clone·.cold]>: |
| 63 | » ... | 63 | » ... |
| 64 | 000096 | 64 | 000096b2·<OptArgs::GetFirstStringVector(char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·char)·[clone·.cold]>: |
| 65 | » ... | 65 | » ... |
| 66 | 00009 | 66 | 000096da·<OptArgs::GetFirstDouble(char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·double)·[clone·.cold]>: |
| 67 | » ... | 67 | » ... |
| 68 | 000097 | 68 | 00009756·<OptArgs::GetFirstDoubleVector(char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·char)·[clone·.cold]>: |
| 69 | » ... | 69 | » ... |
| 70 | 000097 | 70 | 00009790·<OptArgs::GetFirstInt(char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·int)·[clone·.cold]>: |
| 71 | » ... | 71 | » ... |
| 72 | 000098 | 72 | 0000980c·<OptArgs::GetFirstIntVector(char,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>·const&,·char)·[clone·.cold]>: |
| 73 | » ... | 73 | » ... |
| 74 | 000098 | 74 | 00009846·<OptArgs::HandleShortOption(std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>&,·int&,·int,·char·const**)·[clone·.cold]>: |
| 75 | » ... | 75 | » ... |
| 76 | 000099 | 76 | 00009932·<OptArgs::HandleLongOption(std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>&,·int&,·int,·char·const**)·[clone·.cold]>: |
| 77 | » ... | 77 | » ... |
| 78 | 00009 | 78 | 000099d8·<OptArgs::ParseCmdLine(int,·char·const**)·[clone·.cold]>: |
| 79 | » ... | 79 | » ... |
| 80 | 00009a | 80 | 00009a14·<count_char(std::__cxx11::basic_string<char,·std::char_traits<char>,·std::allocator<char>·>,·char)·[clone·.cold]>: |
| 81 | » ... | 81 | » ... |
| 82 | 00009a | 82 | 00009a2a·<isNumeric(char·const*,·int)·[clone·.cold]>: |
| 83 | » ... | 83 | » ... |
| Max diff block lines reached; 95562/118387 bytes (80.72%) of diff not shown. | |||
| Offset 1, 7 lines modified | Offset 1, 7 lines modified | ||
| 1 | Disassembly·of·section·.fini: | 1 | Disassembly·of·section·.fini: |
| 2 | 0002 | 2 | 0002ba44·<_fini>: |
| 3 | » ... | 3 | » ... |
| Offset 1, 8 lines modified | Offset 1, 8 lines modified | ||
| 1 | Hex·dump·of·section·'.gnu_debugaltlink': | 1 | Hex·dump·of·section·'.gnu_debugaltlink': |
| 2 | ··0x00000000·2f757372·2f6c6962·2f646562·75672f2e·/usr/lib/debug/. | 2 | ··0x00000000·2f757372·2f6c6962·2f646562·75672f2e·/usr/lib/debug/. |
| 3 | ··0x00000010·64777a2f·69333836·2d6c696e·75782d67·dwz/i386-linux-g | 3 | ··0x00000010·64777a2f·69333836·2d6c696e·75782d67·dwz/i386-linux-g |
| 4 | ··0x00000020·6e752f74·76632e64·65627567·00 | 4 | ··0x00000020·6e752f74·76632e64·65627567·00baab79·nu/tvc.debug...y |
| 5 | ··0x00000030· | 5 | ··0x00000030·896f6c2f·e012d0a5·f1bd009f·e4175a15·.ol/..........Z. |
| 6 | ··0x00000040· | 6 | ··0x00000040·a6··································. |
| Offset 11, 31 lines modified | Offset 11, 31 lines modified | ||
| 11 | ··0x00000080·74657261·746f7249·4e313349·6e64656c·teratorIN13Indel | 11 | ··0x00000080·74657261·746f7249·4e313349·6e64656c·teratorIN13Indel |
| 12 | ··0x00000090·41737365·6d626c79·38436f76·65726167·Assembly8Coverag | 12 | ··0x00000090·41737365·6d626c79·38436f76·65726167·Assembly8Coverag |
| 13 | ··0x000000a0·65455253·315f5053·315f4570·4c45692e·eERS1_PS1_EpLEi. | 13 | ··0x000000a0·65455253·315f5053·315f4570·4c45692e·eERS1_PS1_EpLEi. |
| 14 | ··0x000000b0·69737261·2e30005f·5a4e5374·375f5f63·isra.0._ZNSt7__c | 14 | ··0x000000b0·69737261·2e30005f·5a4e5374·375f5f63·isra.0._ZNSt7__c |
| 15 | ··0x000000c0·78783131·31326261·7369635f·73747269·xx1112basic_stri | 15 | ··0x000000c0·78783131·31326261·7369635f·73747269·xx1112basic_stri |
| 16 | ··0x000000d0·6e674963·53743131·63686172·5f747261·ngIcSt11char_tra | 16 | ··0x000000d0·6e674963·53743131·63686172·5f747261·ngIcSt11char_tra |
| 17 | ··0x000000e0·69747349·63455361·49634545·31325f4d·itsIcESaIcEE12_M | 17 | ··0x000000e0·69747349·63455361·49634545·31325f4d·itsIcESaIcEE12_M |
| 18 | ··0x000000f0·5f636f6e·73747275·63744950· | 18 | ··0x000000f0·5f636f6e·73747275·63744950·63454576·_constructIPcEEv |
| 19 | ··0x00000100· | 19 | ··0x00000100·545f5337·5f537432·30666f72·77617264·T_S7_St20forward |
| 20 | ··0x00000110· | 20 | ··0x00000110·5f697465·7261746f·725f7461·672e6973·_iterator_tag.is |
| 21 | ··0x00000120·7 | 21 | ··0x00000120·72612e30·005f5a53·7434656e·646c4963·ra.0._ZSt4endlIc |
| 22 | ··0x00000130· | 22 | ··0x00000130·53743131·63686172·5f747261·69747349·St11char_traitsI |
| 23 | ··0x00000140· | 23 | ··0x00000140·63454552·53743133·62617369·635f6f73·cEERSt13basic_os |
| 24 | ··0x00000150·7 | 24 | ··0x00000150·74726561·6d49545f·54305f45·53365f2e·treamIT_T0_ES6_. |
| 25 | ··0x00000160· | 25 | ··0x00000160·69737261·2e30005f·5a4e5374·375f5f63·isra.0._ZNSt7__c |
| 26 | ··0x00000170· | 26 | ··0x00000170·78783131·31326261·7369635f·73747269·xx1112basic_stri |
| 27 | ··0x00000180·6 | 27 | ··0x00000180·6e674963·53743131·63686172·5f747261·ngIcSt11char_tra |
| 28 | ··0x00000190·6 | 28 | ··0x00000190·69747349·63455361·49634545·6153454f·itsIcESaIcEEaSEO |
| 29 | ··0x000001a0· | 29 | ··0x000001a0·53345f2e·69737261·2e30005f·5a4e5374·S4_.isra.0._ZNSt |
| 30 | ··0x000001b0· | 30 | ··0x000001b0·375f5f63·78783131·31326261·7369635f·7__cxx1112basic_ |
| 31 | ··0x000001c0· | 31 | ··0x000001c0·73747269·6e674963·53743131·63686172·stringIcSt11char |
| 32 | ··0x000001d0· | 32 | ··0x000001d0·5f747261·69747349·63455361·49634545·_traitsIcESaIcEE |
| 33 | ··0x000001e0· | 33 | ··0x000001e0·31325f4d·5f636f6e·73747275·63744950·12_M_constructIP |
| 34 | ··0x000001f0· | 34 | ··0x000001f0·4b634545·76545f53·385f5374·3230666f·KcEEvT_S8_St20fo |
| 35 | ··0x00000200·72776172·645f6974·65726174·6f725f74·rward_iterator_t | 35 | ··0x00000200·72776172·645f6974·65726174·6f725f74·rward_iterator_t |
| 36 | ··0x00000210·61672e69·7372612e·30005f5a·4e537436·ag.isra.0._ZNSt6 | 36 | ··0x00000210·61672e69·7372612e·30005f5a·4e537436·ag.isra.0._ZNSt6 |
| 37 | ··0x00000220·76656374·6f724969·53614969·45456153·vectorIiSaIiEEaS | 37 | ··0x00000220·76656374·6f724969·53614969·45456153·vectorIiSaIiEEaS |
| 38 | ··0x00000230·45524b53·315f2e69·7372612e·30005f5a·ERKS1_.isra.0._Z | 38 | ··0x00000230·45524b53·315f2e69·7372612e·30005f5a·ERKS1_.isra.0._Z |
| 39 | ··0x00000240·53743232·5f5f756e·696e6974·69616c69·St22__uninitiali | 39 | ··0x00000240·53743232·5f5f756e·696e6974·69616c69·St22__uninitiali |
| 40 | ··0x00000250·7a65645f·6d6f7665·5f614953·7431355f·zed_move_aISt15_ | 40 | ··0x00000250·7a65645f·6d6f7665·5f614953·7431355f·zed_move_aISt15_ |
| 41 | ··0x00000260·44657175·655f6974·65726174·6f72494e·Deque_iteratorIN | 41 | ··0x00000260·44657175·655f6974·65726174·6f72494e·Deque_iteratorIN |
| Offset 254, 1577 lines modified | Offset 254, 1565 lines modified | ||
| 254 | ··0x00000fb0·74726169·74734963·45536149·63454545·traitsIcESaIcEEE | 254 | ··0x00000fb0·74726169·74734963·45536149·63454545·traitsIcESaIcEEE |
| 255 | ··0x00000fc0·524b5339·5f004f70·74417267·732e6370·RKS9_.OptArgs.cp | 255 | ··0x00000fc0·524b5339·5f004f70·74417267·732e6370·RKS9_.OptArgs.cp |
| 256 | ··0x00000fd0·70005f5a·4e374f70·74417267·73354162·p._ZN7OptArgs5Ab | 256 | ··0x00000fd0·70005f5a·4e374f70·74417267·73354162·p._ZN7OptArgs5Ab |
| 257 | ··0x00000fe0·6f727445·524b4e53·74375f5f·63787831·ortERKNSt7__cxx1 | 257 | ··0x00000fe0·6f727445·524b4e53·74375f5f·63787831·ortERKNSt7__cxx1 |
| 258 | ··0x00000ff0·31313262·61736963·5f737472·696e6749·112basic_stringI | 258 | ··0x00000ff0·31313262·61736963·5f737472·696e6749·112basic_stringI |
| 259 | ··0x00001000·63537431·31636861·725f7472·61697473·cSt11char_traits | 259 | ··0x00001000·63537431·31636861·725f7472·61697473·cSt11char_traits | Diff chunk too large, falling back to line-by-line diff (1557 lines added, 1569 lines removed) |
| 260 | ··0x00001010·49634553·61496345·45452e63·6f6e7374·IcESaIcEEE.const | 260 | ··0x00001010·49634553·61496345·45452e63·6f6e7374·IcESaIcEEE.const |
| 261 | ··0x00001020·70726f70·2e30005f·5a | 261 | ··0x00001020·70726f70·2e30005f·5a537470·6c496353·prop.0._ZStplIcS |
| 262 | ··0x00001030·74 | 262 | ··0x00001030·74313163·6861725f·74726169·74734963·t11char_traitsIc |
| 263 | ··0x00001040· | 263 | ··0x00001040·45536149·6345454e·5374375f·5f637878·ESaIcEENSt7__cxx |
| 264 | ··0x00001050· | 264 | ··0x00001050·31313132·62617369·635f7374·72696e67·1112basic_string |
| 265 | ··0x00001060·4 | 265 | ··0x00001060·49545f54·305f5431·5f45454f·53385f52·IT_T0_T1_EEOS8_R |
| 266 | ··0x00001070· | 266 | ··0x00001070·4b53385f·2e697372·612e3000·5f5a4e53·KS8_.isra.0._ZNS |
| 267 | ··0x00001080· | 267 | ··0x00001080·74367665·63746f72·494e5374·375f5f63·t6vectorINSt7__c |
| 268 | ··0x00001090· | 268 | ··0x00001090·78783131·31326261·7369635f·73747269·xx1112basic_stri |
| 269 | ··0x000010a0· | 269 | ··0x000010a0·6e674963·53743131·63686172·5f747261·ngIcSt11char_tra |
| 270 | ··0x000010b0· | 270 | ··0x000010b0·69747349·63455361·49634545·45536149·itsIcESaIcEEESaI |
| 271 | ··0x000010c0· | 271 | ··0x000010c0·53355f45·45615345·524b5337·5f2e6973·S5_EEaSERKS7_.is |
| 272 | ··0x000010d0· | 272 | ··0x000010d0·72612e30·005f5a4e·53743676·6563746f·ra.0._ZNSt6vecto |
| 273 | ··0x000010e0· | 273 | ··0x000010e0·72494e53·74375f5f·63787831·31313262·rINSt7__cxx1112b |
| 274 | ··0x000010f0· | 274 | ··0x000010f0·61736963·5f737472·696e6749·63537431·asic_stringIcSt1 |
| 275 | ··0x00001100· | 275 | ··0x00001100·31636861·725f7472·61697473·49634553·1char_traitsIcES |
| 276 | ··0x00001110·6 | 276 | ··0x00001110·61496345·45455361·4953355f·45456153·aIcEEESaIS5_EEaS |
| 277 | ··0x00001120· | 277 | ··0x00001120·45524b53·375f2e69·7372612e·302e636f·ERKS7_.isra.0.co |
| 278 | ··0x00001130· | 278 | ··0x00001130·6c64005f·5a4e3131·4f707441·7267756d·ld._ZN11OptArgum |
| 279 | ··0x00001140· | 279 | ··0x00001140·656e7443·3245762e·636f6c64·005f5a4e·entC2Ev.cold._ZN |
| 280 | ··0x00001150· | 280 | ··0x00001150·374f7074·41726773·31364368·65636b4e·7OptArgs16CheckN |
| 281 | ··0x00001160·6 | 281 | ··0x00001160·6f4c6566·746f7665·72734576·2e636f6c·oLeftoversEv.col |
| 282 | ··0x00001170·6 | 282 | ··0x00001170·64005f5a·4e374f70·74417267·73313753·d._ZN7OptArgs17S |
| 283 | ··0x00001180· | 283 | ··0x00001180·7472696e·67546f49·6e745665·63746f72·tringToIntVector |
| 284 | ··0x00001190·4 | 284 | ··0x00001190·45525374·36766563·746f7249·69536149·ERSt6vectorIiSaI |
| 285 | ··0x000011a0·6 | 285 | ··0x000011a0·69454552·4b4e5374·375f5f63·78783131·iEERKNSt7__cxx11 |
| 286 | ··0x000011b0· | 286 | ··0x000011b0·31326261·7369635f·73747269·6e674963·12basic_stringIc |
| 287 | ··0x000011c0· | 287 | ··0x000011c0·53743131·63686172·5f747261·69747349·St11char_traitsI |
| 288 | ··0x000011d0·3 | 288 | ··0x000011d0·63455361·49634545·4553425f·632e636f·cESaIcEEESB_c.co |
| 289 | ··0x000011e0· | 289 | ··0x000011e0·6c64005f·5a4e374f·70744172·67733230·ld._ZN7OptArgs20 |
| 290 | ··0x000011f0· | 290 | ··0x000011f0·53747269·6e67546f·446f7562·6c655665·StringToDoubleVe |
| 291 | ··0x00001200·6 | 291 | ··0x00001200·63746f72·45525374·36766563·746f7249·ctorERSt6vectorI |
| 292 | ··0x00001210· | 292 | ··0x00001210·64536149·64454552·4b4e5374·375f5f63·dSaIdEERKNSt7__c |
| 293 | ··0x00001220·7 | 293 | ··0x00001220·78783131·31326261·7369635f·73747269·xx1112basic_stri |
| 294 | ··0x00001230·6 | 294 | ··0x00001230·6e674963·53743131·63686172·5f747261·ngIcSt11char_tra |
| 295 | ··0x00001240· | 295 | ··0x00001240·69747349·63455361·49634545·4553425f·itsIcESaIcEEESB_ |
| 296 | ··0x00001250· | 296 | ··0x00001250·632e636f·6c64005f·5a4e5374·385f5262·c.cold._ZNSt8_Rb |
| 297 | ··0x00001260·74 | 297 | ··0x00001260·5f747265·65494e53·74375f5f·63787831·_treeINSt7__cxx1 |
| 298 | ··0x00001270· | 298 | ··0x00001270·31313262·61736963·5f737472·696e6749·112basic_stringI |
| 299 | ··0x00001280· | 299 | ··0x00001280·63537431·31636861·725f7472·61697473·cSt11char_traits |
| 300 | ··0x00001290·63 | 300 | ··0x00001290·49634553·61496345·45455374·34706169·IcESaIcEEESt4pai |
| 301 | ··0x000012a0· | 301 | ··0x000012a0·72494b53·355f3131·4f707441·7267756d·rIKS5_11OptArgum |
| 302 | ··0x000012b0·6 | 302 | ··0x000012b0·656e7445·53743130·5f53656c·65637431·entESt10_Select1 |
| 303 | ··0x000012c0·7 | 303 | ··0x000012c0·73744953·395f4553·74346c65·73734953·stIS9_ESt4lessIS |
| 304 | ··0x000012d0· | 304 | ··0x000012d0·355f4553·61495339·5f454532·325f4d5f·5_ESaIS9_EE22_M_ |
| 305 | ··0x000012e0·65 | 305 | ··0x000012e0·656d706c·6163655f·68696e74·5f756e69·emplace_hint_uni |
| 306 | ··0x000012f0·7 | 306 | ··0x000012f0·71756549·4a524b53·74323170·69656365·queIJRKSt21piece |
| 307 | ··0x00001300·7 | 307 | ··0x00001300·77697365·5f636f6e·73747275·63745f74·wise_construct_t |
| 308 | ··0x00001310· | 308 | ··0x00001310·53743574·75706c65·494a5253·375f4545·St5tupleIJRS7_EE |
| 309 | ··0x00001320· | 309 | ··0x00001320·534b5f49·4a454545·45455374·31375f52·SK_IJEEEEESt17_R |
| 310 | ··0x00001330· | 310 | ··0x00001330·625f7472·65655f69·74657261·746f7249·b_tree_iteratorI |
| 311 | ··0x00001340· | 311 | ··0x00001340·53395f45·53743233·5f52625f·74726565·S9_ESt23_Rb_tree |
| 312 | ··0x00001350· | 312 | ··0x00001350·5f636f6e·73745f69·74657261·746f7249·_const_iteratorI |
| 313 | ··0x00001360· | 313 | ··0x00001360·53395f45·44704f54·5f2e6973·72612e30·S9_EDpOT_.isra.0 |
| 314 | ··0x00001370· | 314 | ··0x00001370·005f5a4e·5374385f·52625f74·72656549·._ZNSt8_Rb_treeI |
| 315 | ··0x00001380· | 315 | ··0x00001380·4e537437·5f5f6378·78313131·32626173·NSt7__cxx1112bas |
| 316 | ··0x00001390·6 | 316 | ··0x00001390·69635f73·7472696e·67496353·74313163·ic_stringIcSt11c |
| 317 | ··0x000013a0· | 317 | ··0x000013a0·6861725f·74726169·74734963·45536149·har_traitsIcESaI |
| 318 | ··0x000013b0· | 318 | ··0x000013b0·63454545·53743470·61697249·4b53355f·cEEESt4pairIKS5_ |
| 319 | ··0x000013c0· | 319 | ··0x000013c0·31314f70·74417267·756d656e·74455374·11OptArgumentESt |
| 320 | ··0x000013d0· | 320 | ··0x000013d0·31305f53·656c6563·74317374·4953395f·10_Select1stIS9_ |
| 321 | ··0x000013e0·5 | 321 | ··0x000013e0·45537434·6c657373·4953355f·45536149·ESt4lessIS5_ESaI |
| 322 | ··0x000013f0· | 322 | ··0x000013f0·53395f45·4532325f·4d5f656d·706c6163·S9_EE22_M_emplac |
| 323 | ··0x00001400·6 | 323 | ··0x00001400·655f6869·6e745f75·6e697175·65494a52·e_hint_uniqueIJR |
| 324 | ··0x00001410·5 | 324 | ··0x00001410·4b537432·31706965·63657769·73655f63·KSt21piecewise_c |
| 325 | ··0x00001420·6 | 325 | ··0x00001420·6f6e7374·72756374·5f745374·35747570·onstruct_tSt5tup |
| 326 | ··0x00001430· | 326 | ··0x00001430·6c65494a·5253375f·4545534b·5f494a45·leIJRS7_EESK_IJE |
| 327 | ··0x00001440· | 327 | ··0x00001440·45454545·53743137·5f52625f·74726565·EEEESt17_Rb_tree |
| 328 | ··0x00001450·6 | 328 | ··0x00001450·5f697465·7261746f·72495339·5f455374·_iteratorIS9_ESt |
| 329 | ··0x00001460· | 329 | ··0x00001460·32335f52·625f7472·65655f63·6f6e7374·23_Rb_tree_const |
| 330 | ··0x00001470· | 330 | ··0x00001470·5f697465·7261746f·72495339·5f454470·_iteratorIS9_EDp |
| 331 | ··0x00001480· | 331 | ··0x00001480·4f545f2e·69737261·2e302e63·6f6c6400·OT_.isra.0.cold. |
| 332 | ··0x00001490·5f | 332 | ··0x00001490·5f5a4e37·4f707441·72677331·34476574·_ZN7OptArgs14Get |
| 333 | ··0x000014a0· | 333 | ··0x000014a0·4f707441·7267756d·656e7445·63524b4e·OptArgumentEcRKN |
| 334 | ··0x000014b0·74375f5f | 334 | ··0x000014b0·5374375f·5f637878·31313132·62617369·St7__cxx1112basi |
| 335 | ··0x000014c0·5f737472 | 335 | ··0x000014c0·635f7374·72696e67·49635374·31316368·c_stringIcSt11ch |
| 336 | ··0x000014d0·725f7472 | 336 | ··0x000014d0·61725f74·72616974·73496345·53614963·ar_traitsIcESaIc |
| 337 | ··0x000014e0·4545 | 337 | ··0x000014e0·45454553·375f2e63·6f6c6400·5f5a4e37·EEES7_.cold._ZN7 |
| 338 | ··0x000014f0· | 338 | ··0x000014f0·4f707441·72677339·4765744f·7074696f·OptArgs9GetOptio |
| 339 | ··0x00001500· | 339 | ··0x00001500·6e45524e·5374375f·5f637878·31313132·nERNSt7__cxx1112 |
| 340 | ··0x00001510· | 340 | ··0x00001510·62617369·635f7374·72696e67·49635374·basic_stringIcSt |
| 341 | ··0x00001520· | 341 | ··0x00001520·31316368·61725f74·72616974·73496345·11char_traitsIcE |
| 342 | ··0x00001530· | 342 | ··0x00001530·53614963·45454552·4b53355f·6353385f·SaIcEEERKS5_cS8_ |
| 343 | ··0x00001540· | 343 | ··0x00001540·2e636f6c·64005f5a·4e374f70·74417267·.cold._ZN7OptArg |
| 344 | ··0x00001550· | 344 | ··0x00001550·73394765·744f7074·696f6e45·5262524b·s9GetOptionERbRK |
| 345 | ··0x00001560· | 345 | ··0x00001560·4e537437·5f5f6378·78313131·32626173·NSt7__cxx1112bas |
| 346 | ··0x00001570·6 | 346 | ··0x00001570·69635f73·7472696e·67496353·74313163·ic_stringIcSt11c |
| 347 | ··0x00001580· | 347 | ··0x00001580·6861725f·74726169·74734963·45536149·har_traitsIcESaI |
| Max diff block lines reached; 0/213168 bytes (0.00%) of diff not shown. | |||