Sun Jun 2 13:26:08 UTC 2024 I: starting to build seqprep/unstable/amd64 on jenkins on '2024-06-02 13:25' Sun Jun 2 13:26:08 UTC 2024 I: The jenkins build log is/was available at https://jenkins.debian.net/userContent/reproducible/debian/build_service/amd64_28/22869/console.log Sun Jun 2 13:26:08 UTC 2024 I: Downloading source for unstable/seqprep=1.3.2-9 --2024-06-02 13:26:08-- http://deb.debian.org/debian/pool/main/s/seqprep/seqprep_1.3.2-9.dsc Connecting to 46.16.76.132:3128... connected. Proxy request sent, awaiting response... 200 OK Length: 2260 (2.2K) [text/prs.lines.tag] Saving to: ‘seqprep_1.3.2-9.dsc’ 0K .. 100% 183M=0s 2024-06-02 13:26:08 (183 MB/s) - ‘seqprep_1.3.2-9.dsc’ saved [2260/2260] Sun Jun 2 13:26:08 UTC 2024 I: seqprep_1.3.2-9.dsc -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA512 Format: 3.0 (quilt) Source: seqprep Binary: seqprep, seqprep-data Architecture: any all Version: 1.3.2-9 Maintainer: Debian Med Packaging Team Uploaders: Tim Booth , Andreas Tille , Nilesh Patra Homepage: http://seqanswers.com/wiki/SeqPrep Standards-Version: 4.6.2 Vcs-Browser: https://salsa.debian.org/med-team/seqprep Vcs-Git: https://salsa.debian.org/med-team/seqprep.git Testsuite: autopkgtest Testsuite-Triggers: python3 Build-Depends: debhelper-compat (= 13), python3 , zlib1g-dev Package-List: seqprep deb science optional arch=any seqprep-data deb science optional arch=all Checksums-Sha1: 9f533e1fd14d310ba0ccd4ef38c3abc55b8fc5fd 37177540 seqprep_1.3.2.orig.tar.gz 11f37baa93c01a1a0d426c8be5962c16456a0179 12468 seqprep_1.3.2-9.debian.tar.xz Checksums-Sha256: 2b8a462a0e0a3e51f70be7730dc77b1f2bb69e74845dd0fbd2110a921c32265a 37177540 seqprep_1.3.2.orig.tar.gz 53981b79fe38cce3023ba0ab9886195dcd2fd393c0057cd8ef43ffe06bbe32db 12468 seqprep_1.3.2-9.debian.tar.xz Files: b6a4f5491dfdb0ce38bf791454151468 37177540 seqprep_1.3.2.orig.tar.gz 597564b70492bef8006e45a6892f3b76 12468 seqprep_1.3.2-9.debian.tar.xz Dgit: 54dee1026394119b68bdc391655ecce7ce762485 debian archive/debian/1.3.2-9 https://git.dgit.debian.org/seqprep -----BEGIN PGP SIGNATURE----- iQJIBAEBCgAyFiEEj5GyJ8fW8rGUjII2eTz2fo8NEdoFAmXzUowUHGVtb2xsaWVy QGRlYmlhbi5vcmcACgkQeTz2fo8NEdrxww/8DPKZiUgRjm/L916gf0wJtQaqriYT DBNLVB4cW4VrgP2Bhe+wcINTTrnLH8zij6rbB59+AN/8JSf8JOQ6vaCaNnAdu5CQ FQriCWoDH33YcMkul2N5ygAx6idQIf0YH1ILpo9koiKsgjB+M7SN/eGw2pc2g0DS u2GEWe0jYlFN4CWdpn2Fy0ccBwbCj90hlAdAADqVRU0uBATRLP075qeWH4PaTS/Y pWGDwK5Z7Kpx8AGNpb1IvqXuZ6ngjU71blKFtu0oOTJSTqu6eTUy2OOGLlktyF2H 1TOnRp3+PVzJZHEgv2snySkdHILURfa6owQU9R+wPisotosbBcSy3lDjS0gXtRoP 00FiCu42xaLy0LC+jiSWMLZE5GUNfKjTdQgscQfke2r6c1FsQfiLagqde++QReh6 SCx9kHyUhswU0o0qdrbpZl6erAZ2yHIiiWkiNglhOJbjRqcyvlTS6+BSXsY8gdlJ 7r8ll/5717FPGiU2/syzXw8xpPmut6KneYecSxrB82/vDqRnzZif9X+0FFCicL7t 7VOnaXdVysscPBu2qEk1AHv9HM+E83B91kqPr+EaES4CBEZDl9TD+EeWOcnsJJJB 2EQR8Df8M1S1BYB9NzRb9+a2Ix/3Y+rRb5w9005O1MQ0/jU+9iGsBg7kfBVrzAJR /HQ7Z4cUVwbWMZM= =6Mqd -----END PGP SIGNATURE----- Sun Jun 2 13:26:08 UTC 2024 I: Checking whether the package is not for us Sun Jun 2 13:26:08 UTC 2024 I: Starting 1st build on remote node ionos15-amd64.debian.net. Sun Jun 2 13:26:08 UTC 2024 I: Preparing to do remote build '1' on ionos15-amd64.debian.net. Sun Jun 2 13:27:36 UTC 2024 I: Deleting $TMPDIR on ionos15-amd64.debian.net. I: pbuilder: network access will be disabled during build I: Current time: Sat Jul 5 07:49:11 -12 2025 I: pbuilder-time-stamp: 1751744951 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/unstable-reproducible-base.tgz] I: copying local configuration W: --override-config is not set; not updating apt.conf Read the manpage for details. I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: Copying source file I: copying [seqprep_1.3.2-9.dsc] I: copying [./seqprep_1.3.2.orig.tar.gz] I: copying [./seqprep_1.3.2-9.debian.tar.xz] I: Extracting source gpgv: Signature made Thu Mar 14 19:39:56 2024 gpgv: using RSA key 8F91B227C7D6F2B1948C8236793CF67E8F0D11DA gpgv: issuer "emollier@debian.org" gpgv: Can't check signature: No public key dpkg-source: warning: cannot verify inline signature for ./seqprep_1.3.2-9.dsc: no acceptable signature found dpkg-source: info: extracting seqprep in seqprep-1.3.2 dpkg-source: info: unpacking seqprep_1.3.2.orig.tar.gz dpkg-source: info: unpacking seqprep_1.3.2-9.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying fix_unused_variable_errors.patch dpkg-source: info: applying hardening.patch dpkg-source: info: applying replace-float-with-double.patch dpkg-source: info: applying 2to3.patch dpkg-source: info: applying fix-declarations.patch I: Not using root during the build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/4165449/tmp/hooks/D02_print_environment starting I: set BUILDDIR='/build/reproducible-path' BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' BUILDUSERNAME='pbuilder1' BUILD_ARCH='amd64' DEBIAN_FRONTEND='noninteractive' DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=42 ' DISTRIBUTION='unstable' HOME='/root' HOST_ARCH='amd64' IFS=' ' INVOCATION_ID='fcd08f750d124f4e83644a1a652857e6' LANG='C' LANGUAGE='en_US:en' LC_ALL='C' MAIL='/var/mail/root' OPTIND='1' PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' PBCURRENTCOMMANDLINEOPERATION='build' PBUILDER_OPERATION='build' PBUILDER_PKGDATADIR='/usr/share/pbuilder' PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' PBUILDER_SYSCONFDIR='/etc' PPID='4165449' PS1='# ' PS2='> ' PS4='+ ' PWD='/' SHELL='/bin/bash' SHLVL='2' SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.xauTc67N/pbuilderrc_DvO0 --distribution unstable --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/unstable-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.xauTc67N/b1 --logfile b1/build.log seqprep_1.3.2-9.dsc' SUDO_GID='111' SUDO_UID='106' SUDO_USER='jenkins' TERM='unknown' TZ='/usr/share/zoneinfo/Etc/GMT+12' USER='root' _='/usr/bin/systemd-run' http_proxy='http://213.165.73.152:3128' I: uname -a Linux ionos15-amd64 6.7.12+bpo-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.7.12-1~bpo12+1 (2024-05-06) x86_64 GNU/Linux I: ls -l /bin lrwxrwxrwx 1 root root 7 Jul 5 14:05 /bin -> usr/bin I: user script /srv/workspace/pbuilder/4165449/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: amd64 Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 13), python3, zlib1g-dev dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19719 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 13); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on python3; however: Package python3 is not installed. pbuilder-satisfydepends-dummy depends on zlib1g-dev; however: Package zlib1g-dev is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} automake{a} autopoint{a} autotools-dev{a} bsdextrautils{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} gettext{a} gettext-base{a} groff-base{a} intltool-debian{a} libarchive-zip-perl{a} libdebhelper-perl{a} libelf1t64{a} libexpat1{a} libfile-stripnondeterminism-perl{a} libicu72{a} libmagic-mgc{a} libmagic1t64{a} libpipeline1{a} libpython3-stdlib{a} libpython3.11-minimal{a} libpython3.11-stdlib{a} libreadline8t64{a} libtool{a} libuchardet0{a} libxml2{a} m4{a} man-db{a} media-types{a} netbase{a} po-debconf{a} python3{a} python3-minimal{a} python3.11{a} python3.11-minimal{a} readline-common{a} sensible-utils{a} tzdata{a} zlib1g-dev{a} The following packages are RECOMMENDED but will NOT be installed: ca-certificates curl libarchive-cpio-perl libltdl-dev libmail-sendmail-perl lynx wget 0 packages upgraded, 43 newly installed, 0 to remove and 0 not upgraded. Need to get 25.7 MB of archives. After unpacking 99.2 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian unstable/main amd64 libpython3.11-minimal amd64 3.11.9-1 [817 kB] Get: 2 http://deb.debian.org/debian unstable/main amd64 libexpat1 amd64 2.6.2-1 [103 kB] Get: 3 http://deb.debian.org/debian unstable/main amd64 python3.11-minimal amd64 3.11.9-1 [1879 kB] Get: 4 http://deb.debian.org/debian unstable/main amd64 python3-minimal amd64 3.11.8-1 [26.3 kB] Get: 5 http://deb.debian.org/debian unstable/main amd64 media-types all 10.1.0 [26.9 kB] Get: 6 http://deb.debian.org/debian unstable/main amd64 netbase all 6.4 [12.8 kB] Get: 7 http://deb.debian.org/debian unstable/main amd64 tzdata all 2024a-4 [255 kB] Get: 8 http://deb.debian.org/debian unstable/main amd64 readline-common all 8.2-4 [69.3 kB] Get: 9 http://deb.debian.org/debian unstable/main amd64 libreadline8t64 amd64 8.2-4 [167 kB] Get: 10 http://deb.debian.org/debian unstable/main amd64 libpython3.11-stdlib amd64 3.11.9-1 [1792 kB] Get: 11 http://deb.debian.org/debian unstable/main amd64 python3.11 amd64 3.11.9-1 [602 kB] Get: 12 http://deb.debian.org/debian unstable/main amd64 libpython3-stdlib amd64 3.11.8-1 [9332 B] Get: 13 http://deb.debian.org/debian unstable/main amd64 python3 amd64 3.11.8-1 [27.4 kB] Get: 14 http://deb.debian.org/debian unstable/main amd64 sensible-utils all 0.0.22 [22.4 kB] Get: 15 http://deb.debian.org/debian unstable/main amd64 libmagic-mgc amd64 1:5.45-3 [314 kB] Get: 16 http://deb.debian.org/debian unstable/main amd64 libmagic1t64 amd64 1:5.45-3 [105 kB] Get: 17 http://deb.debian.org/debian unstable/main amd64 file amd64 1:5.45-3 [42.9 kB] Get: 18 http://deb.debian.org/debian unstable/main amd64 gettext-base amd64 0.21-14+b1 [161 kB] Get: 19 http://deb.debian.org/debian unstable/main amd64 libuchardet0 amd64 0.0.8-1+b1 [68.8 kB] Get: 20 http://deb.debian.org/debian unstable/main amd64 groff-base amd64 1.23.0-4 [1180 kB] Get: 21 http://deb.debian.org/debian unstable/main amd64 bsdextrautils amd64 2.40.1-4 [95.7 kB] Get: 22 http://deb.debian.org/debian unstable/main amd64 libpipeline1 amd64 1.5.7-2 [38.0 kB] Get: 23 http://deb.debian.org/debian unstable/main amd64 man-db amd64 2.12.1-1 [1411 kB] Get: 24 http://deb.debian.org/debian unstable/main amd64 m4 amd64 1.4.19-4 [287 kB] Get: 25 http://deb.debian.org/debian unstable/main amd64 autoconf all 2.71-3 [332 kB] Get: 26 http://deb.debian.org/debian unstable/main amd64 autotools-dev all 20220109.1 [51.6 kB] Get: 27 http://deb.debian.org/debian unstable/main amd64 automake all 1:1.16.5-1.3 [823 kB] Get: 28 http://deb.debian.org/debian unstable/main amd64 autopoint all 0.21-14 [496 kB] Get: 29 http://deb.debian.org/debian unstable/main amd64 libdebhelper-perl all 13.15.3 [88.0 kB] Get: 30 http://deb.debian.org/debian unstable/main amd64 libtool all 2.4.7-7 [517 kB] Get: 31 http://deb.debian.org/debian unstable/main amd64 dh-autoreconf all 20 [17.1 kB] Get: 32 http://deb.debian.org/debian unstable/main amd64 libarchive-zip-perl all 1.68-1 [104 kB] Get: 33 http://deb.debian.org/debian unstable/main amd64 libfile-stripnondeterminism-perl all 1.14.0-1 [19.5 kB] Get: 34 http://deb.debian.org/debian unstable/main amd64 dh-strip-nondeterminism all 1.14.0-1 [8448 B] Get: 35 http://deb.debian.org/debian unstable/main amd64 libelf1t64 amd64 0.191-1+b1 [189 kB] Get: 36 http://deb.debian.org/debian unstable/main amd64 dwz amd64 0.15-1+b1 [110 kB] Get: 37 http://deb.debian.org/debian unstable/main amd64 libicu72 amd64 72.1-4+b1 [9395 kB] Get: 38 http://deb.debian.org/debian unstable/main amd64 libxml2 amd64 2.12.7+dfsg-2 [670 kB] Get: 39 http://deb.debian.org/debian unstable/main amd64 gettext amd64 0.21-14+b1 [1301 kB] Get: 40 http://deb.debian.org/debian unstable/main amd64 intltool-debian all 0.35.0+20060710.6 [22.9 kB] Get: 41 http://deb.debian.org/debian unstable/main amd64 po-debconf all 1.0.21+nmu1 [248 kB] Get: 42 http://deb.debian.org/debian unstable/main amd64 debhelper all 13.15.3 [901 kB] Get: 43 http://deb.debian.org/debian unstable/main amd64 zlib1g-dev amd64 1:1.3.dfsg+really1.3.1-1 [919 kB] Fetched 25.7 MB in 0s (119 MB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package libpython3.11-minimal:amd64. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19719 files and directories currently installed.) Preparing to unpack .../libpython3.11-minimal_3.11.9-1_amd64.deb ... Unpacking libpython3.11-minimal:amd64 (3.11.9-1) ... Selecting previously unselected package libexpat1:amd64. Preparing to unpack .../libexpat1_2.6.2-1_amd64.deb ... Unpacking libexpat1:amd64 (2.6.2-1) ... Selecting previously unselected package python3.11-minimal. Preparing to unpack .../python3.11-minimal_3.11.9-1_amd64.deb ... Unpacking python3.11-minimal (3.11.9-1) ... Setting up libpython3.11-minimal:amd64 (3.11.9-1) ... Setting up libexpat1:amd64 (2.6.2-1) ... Setting up python3.11-minimal (3.11.9-1) ... Selecting previously unselected package python3-minimal. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20035 files and directories currently installed.) Preparing to unpack .../0-python3-minimal_3.11.8-1_amd64.deb ... Unpacking python3-minimal (3.11.8-1) ... Selecting previously unselected package media-types. Preparing to unpack .../1-media-types_10.1.0_all.deb ... Unpacking media-types (10.1.0) ... Selecting previously unselected package netbase. Preparing to unpack .../2-netbase_6.4_all.deb ... Unpacking netbase (6.4) ... Selecting previously unselected package tzdata. Preparing to unpack .../3-tzdata_2024a-4_all.deb ... Unpacking tzdata (2024a-4) ... Selecting previously unselected package readline-common. Preparing to unpack .../4-readline-common_8.2-4_all.deb ... Unpacking readline-common (8.2-4) ... Selecting previously unselected package libreadline8t64:amd64. Preparing to unpack .../5-libreadline8t64_8.2-4_amd64.deb ... Adding 'diversion of /lib/x86_64-linux-gnu/libhistory.so.8 to /lib/x86_64-linux-gnu/libhistory.so.8.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/x86_64-linux-gnu/libhistory.so.8.2 to /lib/x86_64-linux-gnu/libhistory.so.8.2.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/x86_64-linux-gnu/libreadline.so.8 to /lib/x86_64-linux-gnu/libreadline.so.8.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/x86_64-linux-gnu/libreadline.so.8.2 to /lib/x86_64-linux-gnu/libreadline.so.8.2.usr-is-merged by libreadline8t64' Unpacking libreadline8t64:amd64 (8.2-4) ... Selecting previously unselected package libpython3.11-stdlib:amd64. Preparing to unpack .../6-libpython3.11-stdlib_3.11.9-1_amd64.deb ... Unpacking libpython3.11-stdlib:amd64 (3.11.9-1) ... Selecting previously unselected package python3.11. Preparing to unpack .../7-python3.11_3.11.9-1_amd64.deb ... Unpacking python3.11 (3.11.9-1) ... Selecting previously unselected package libpython3-stdlib:amd64. Preparing to unpack .../8-libpython3-stdlib_3.11.8-1_amd64.deb ... Unpacking libpython3-stdlib:amd64 (3.11.8-1) ... Setting up python3-minimal (3.11.8-1) ... Selecting previously unselected package python3. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 21027 files and directories currently installed.) Preparing to unpack .../00-python3_3.11.8-1_amd64.deb ... Unpacking python3 (3.11.8-1) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../01-sensible-utils_0.0.22_all.deb ... Unpacking sensible-utils (0.0.22) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../02-libmagic-mgc_1%3a5.45-3_amd64.deb ... Unpacking libmagic-mgc (1:5.45-3) ... Selecting previously unselected package libmagic1t64:amd64. Preparing to unpack .../03-libmagic1t64_1%3a5.45-3_amd64.deb ... Unpacking libmagic1t64:amd64 (1:5.45-3) ... Selecting previously unselected package file. Preparing to unpack .../04-file_1%3a5.45-3_amd64.deb ... Unpacking file (1:5.45-3) ... Selecting previously unselected package gettext-base. Preparing to unpack .../05-gettext-base_0.21-14+b1_amd64.deb ... Unpacking gettext-base (0.21-14+b1) ... Selecting previously unselected package libuchardet0:amd64. Preparing to unpack .../06-libuchardet0_0.0.8-1+b1_amd64.deb ... Unpacking libuchardet0:amd64 (0.0.8-1+b1) ... Selecting previously unselected package groff-base. Preparing to unpack .../07-groff-base_1.23.0-4_amd64.deb ... Unpacking groff-base (1.23.0-4) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../08-bsdextrautils_2.40.1-4_amd64.deb ... Unpacking bsdextrautils (2.40.1-4) ... Selecting previously unselected package libpipeline1:amd64. Preparing to unpack .../09-libpipeline1_1.5.7-2_amd64.deb ... Unpacking libpipeline1:amd64 (1.5.7-2) ... Selecting previously unselected package man-db. Preparing to unpack .../10-man-db_2.12.1-1_amd64.deb ... Unpacking man-db (2.12.1-1) ... Selecting previously unselected package m4. Preparing to unpack .../11-m4_1.4.19-4_amd64.deb ... Unpacking m4 (1.4.19-4) ... Selecting previously unselected package autoconf. Preparing to unpack .../12-autoconf_2.71-3_all.deb ... Unpacking autoconf (2.71-3) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../13-autotools-dev_20220109.1_all.deb ... Unpacking autotools-dev (20220109.1) ... Selecting previously unselected package automake. Preparing to unpack .../14-automake_1%3a1.16.5-1.3_all.deb ... Unpacking automake (1:1.16.5-1.3) ... Selecting previously unselected package autopoint. Preparing to unpack .../15-autopoint_0.21-14_all.deb ... Unpacking autopoint (0.21-14) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../16-libdebhelper-perl_13.15.3_all.deb ... Unpacking libdebhelper-perl (13.15.3) ... Selecting previously unselected package libtool. Preparing to unpack .../17-libtool_2.4.7-7_all.deb ... Unpacking libtool (2.4.7-7) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../18-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../19-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../20-libfile-stripnondeterminism-perl_1.14.0-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.14.0-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../21-dh-strip-nondeterminism_1.14.0-1_all.deb ... Unpacking dh-strip-nondeterminism (1.14.0-1) ... Selecting previously unselected package libelf1t64:amd64. Preparing to unpack .../22-libelf1t64_0.191-1+b1_amd64.deb ... Unpacking libelf1t64:amd64 (0.191-1+b1) ... Selecting previously unselected package dwz. Preparing to unpack .../23-dwz_0.15-1+b1_amd64.deb ... Unpacking dwz (0.15-1+b1) ... Selecting previously unselected package libicu72:amd64. Preparing to unpack .../24-libicu72_72.1-4+b1_amd64.deb ... Unpacking libicu72:amd64 (72.1-4+b1) ... Selecting previously unselected package libxml2:amd64. Preparing to unpack .../25-libxml2_2.12.7+dfsg-2_amd64.deb ... Unpacking libxml2:amd64 (2.12.7+dfsg-2) ... Selecting previously unselected package gettext. Preparing to unpack .../26-gettext_0.21-14+b1_amd64.deb ... Unpacking gettext (0.21-14+b1) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../27-intltool-debian_0.35.0+20060710.6_all.deb ... Unpacking intltool-debian (0.35.0+20060710.6) ... Selecting previously unselected package po-debconf. Preparing to unpack .../28-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../29-debhelper_13.15.3_all.deb ... Unpacking debhelper (13.15.3) ... Selecting previously unselected package zlib1g-dev:amd64. Preparing to unpack .../30-zlib1g-dev_1%3a1.3.dfsg+really1.3.1-1_amd64.deb ... Unpacking zlib1g-dev:amd64 (1:1.3.dfsg+really1.3.1-1) ... Setting up media-types (10.1.0) ... Setting up libpipeline1:amd64 (1.5.7-2) ... Setting up libicu72:amd64 (72.1-4+b1) ... Setting up bsdextrautils (2.40.1-4) ... Setting up libmagic-mgc (1:5.45-3) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libdebhelper-perl (13.15.3) ... Setting up libmagic1t64:amd64 (1:5.45-3) ... Setting up gettext-base (0.21-14+b1) ... Setting up m4 (1.4.19-4) ... Setting up file (1:5.45-3) ... Setting up libelf1t64:amd64 (0.191-1+b1) ... Setting up tzdata (2024a-4) ... Current default time zone: 'Etc/UTC' Local time is now: Sat Jul 5 19:49:43 UTC 2025. Universal Time is now: Sat Jul 5 19:49:43 UTC 2025. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up autotools-dev (20220109.1) ... Setting up autopoint (0.21-14) ... Setting up autoconf (2.71-3) ... Setting up zlib1g-dev:amd64 (1:1.3.dfsg+really1.3.1-1) ... Setting up dwz (0.15-1+b1) ... Setting up sensible-utils (0.0.22) ... Setting up libuchardet0:amd64 (0.0.8-1+b1) ... Setting up netbase (6.4) ... Setting up readline-common (8.2-4) ... Setting up libxml2:amd64 (2.12.7+dfsg-2) ... Setting up automake (1:1.16.5-1.3) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up libfile-stripnondeterminism-perl (1.14.0-1) ... Setting up gettext (0.21-14+b1) ... Setting up libtool (2.4.7-7) ... Setting up intltool-debian (0.35.0+20060710.6) ... Setting up dh-autoreconf (20) ... Setting up libreadline8t64:amd64 (8.2-4) ... Setting up dh-strip-nondeterminism (1.14.0-1) ... Setting up groff-base (1.23.0-4) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up libpython3.11-stdlib:amd64 (3.11.9-1) ... Setting up man-db (2.12.1-1) ... Not building database; man-db/auto-update is not 'true'. Setting up libpython3-stdlib:amd64 (3.11.8-1) ... Setting up python3.11 (3.11.9-1) ... Setting up debhelper (13.15.3) ... Setting up python3 (3.11.8-1) ... Processing triggers for libc-bin (2.38-12) ... Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps I: Building the package I: Running cd /build/reproducible-path/seqprep-1.3.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../seqprep_1.3.2-9_source.changes dpkg-buildpackage: info: source package seqprep dpkg-buildpackage: info: source version 1.3.2-9 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Étienne Mollier dpkg-source --before-build . dpkg-buildpackage: info: host architecture amd64 debian/rules clean dh clean dh_auto_clean make -j42 clean make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' rm -f SeqPrep.o utils.o stdaln.o SeqPrep make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' debian/rules override_dh_clean make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' dh_clean rm -f seqprep rm -f README.html make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' debian/rules binary dh binary dh_update_autotools_config dh_autoreconf dh_auto_configure debian/rules override_dh_auto_build make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' dh_auto_build make -j42 "INSTALL=install --strip-program=true" make[2]: Entering directory '/build/reproducible-path/seqprep-1.3.2' cc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/seqprep-1.3.2=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=gnu90 -c -Wall -O0 -g -std=c99 SeqPrep.c -o SeqPrep.o cc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/seqprep-1.3.2=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=gnu90 -c -Wall -O0 -g -std=c99 utils.c -o utils.o cc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/seqprep-1.3.2=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=gnu90 -c -Wall -O0 -g -std=c99 stdaln.c -o stdaln.o cc SeqPrep.o utils.o stdaln.o -Wl,-z,relro -Wl,-z,now -lz -lm -o SeqPrep make[2]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' cp SeqPrep seqprep mv /build/reproducible-path/seqprep-1.3.2/debian/README.html /build/reproducible-path/seqprep-1.3.2 make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' debian/rules override_dh_auto_test make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' # This checks that the tests run and produce byte-identical results. cd Test && mkdir -p out info && \ bash -xc 'gzcat(){ zcat "$@" ; } ; . RUNTEST.sh' + . RUNTEST.sh ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_merged_1.fastq.gz -2 ./out/pe_bad_contam_merged_2.fastq.gz -s ./out/pe_bad_contam_merged_s.fastq.gz -E ./info/alignments_merged.txt.gz Pairs Processed: 0 Pairs Merged: 14314 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.209235 ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_trimmed_1.fastq.gz -2 ./out/pe_bad_contam_trimmed_2.fastq.gz -E ./info/alignments_trimmed.txt.gz Pairs Processed: 0 Pairs Merged: 0 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.197262 ++ prog=gzcat ++ gzcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ zcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ zcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_1.fastq.gz ++ zcat ./out/pe_bad_contam_merged_1.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_2.fastq.gz ++ zcat ./out/pe_bad_contam_merged_2.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_s.fastq.gz ++ zcat ./out/pe_bad_contam_merged_s.fastq.gz ++ python3 seqlens.py [ `cat Test/info/pe_*.txt | md5sum | cut -b -10` = 8bc8e0787e ] # remove output dirs right after testing to make sure the files # will not be included in the data package rm -rf Test/info Test/out make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' create-stamp debian/debhelper-build-stamp dh_prep dh_auto_install make -j42 install DESTDIR=/build/reproducible-path/seqprep-1.3.2/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' cp SeqPrep /build/reproducible-path/seqprep-1.3.2/debian/.debhelper/generated/_source/home/bin make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' debian/rules override_dh_install-indep make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' dh_install sed -i 's#../SeqPrep#/usr/bin/seqprep#' /build/reproducible-path/seqprep-1.3.2/debian/seqprep-data/usr/share/doc/seqprep/examples/RUNTEST.sh make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' dh_install -Nseqprep-data dh_installdocs dh_installchangelogs dh_installman dh_perl dh_link dh_strip_nondeterminism dh_compress dh_fixperms dh_missing dh_dwz -a dh_strip -a dh_makeshlibs -a dh_shlibdeps -a dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'seqprep' in '../seqprep_1.3.2-9_amd64.deb'. dpkg-deb: building package 'seqprep-dbgsym' in '../seqprep-dbgsym_1.3.2-9_amd64.deb'. dpkg-deb: building package 'seqprep-data' in '../seqprep-data_1.3.2-9_all.deb'. dpkg-genbuildinfo --build=binary -O../seqprep_1.3.2-9_amd64.buildinfo dpkg-genchanges --build=binary -O../seqprep_1.3.2-9_amd64.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/4165449 and its subdirectories I: Current time: Sat Jul 5 07:50:35 -12 2025 I: pbuilder-time-stamp: 1751745035 Sun Jun 2 13:27:37 UTC 2024 I: 1st build successful. Starting 2nd build on remote node ionos11-amd64.debian.net. Sun Jun 2 13:27:37 UTC 2024 I: Preparing to do remote build '2' on ionos11-amd64.debian.net. Sun Jun 2 13:32:10 UTC 2024 I: Deleting $TMPDIR on ionos11-amd64.debian.net. Sun Jun 2 13:32:10 UTC 2024 I: seqprep_1.3.2-9_amd64.changes: Format: 1.8 Date: Thu, 14 Mar 2024 20:32:47 +0100 Source: seqprep Binary: seqprep seqprep-data seqprep-dbgsym Architecture: all amd64 Version: 1.3.2-9 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team Changed-By: Étienne Mollier Description: seqprep - stripping adaptors and/or merging paired reads of DNA sequences w seqprep-data - example data set for seqprep - only used for testing Closes: 1066363 Changes: seqprep (1.3.2-9) unstable; urgency=medium . * Team upload. * fix-declarations.patch: new: fix ftbfs. (Closes: #1066363) * Add ITP bug in seqprep version 1.1-0biolinux1. * Update standards version to 4.6.2, no changes needed. Checksums-Sha1: 1f319e8808fc74a8cfed97c4b97e56e613adfe1c 35859764 seqprep-data_1.3.2-9_all.deb 662e3fb7a70f84d7bd03ce08b77cd44e107e033c 18888 seqprep-dbgsym_1.3.2-9_amd64.deb 1a4f714ea5d39ff2efe6db5d24b6778e9abe340e 5695 seqprep_1.3.2-9_amd64.buildinfo 2e734c6783938272838fa25b37a246c9d2b0d4d4 28160 seqprep_1.3.2-9_amd64.deb Checksums-Sha256: c5a6aa05a249fce176d25a4440f2776a80000898228690af4411a04b42811a0f 35859764 seqprep-data_1.3.2-9_all.deb 729c3ed3a4200d7e726c6e40cff3f77c05b80b516f4be862d45911196435ab0b 18888 seqprep-dbgsym_1.3.2-9_amd64.deb 3b15814922a2da40b053e5e78e1265764faeb82676ced63c12cb7206cd131223 5695 seqprep_1.3.2-9_amd64.buildinfo 5dfd7b81a26a0c79874f50b5f16505c2061b70d85deda804da75c369eeff3668 28160 seqprep_1.3.2-9_amd64.deb Files: 16758c6a3e66a4da223e5e7120b8b308 35859764 science optional seqprep-data_1.3.2-9_all.deb c28d67d29b30874700a57aea5d329246 18888 debug optional seqprep-dbgsym_1.3.2-9_amd64.deb f460332ed24aa334a562c7aa18623830 5695 science optional seqprep_1.3.2-9_amd64.buildinfo 274bbc4dac25a7ba26939b1684cf337a 28160 science optional seqprep_1.3.2-9_amd64.deb Sun Jun 2 13:32:11 UTC 2024 I: diffoscope 269 will be used to compare the two builds: Running as unit: rb-diffoscope-amd64_28-22869.service # Profiling output for: /usr/bin/diffoscope --timeout 7200 --html /srv/reproducible-results/rbuild-debian/r-b-build.xauTc67N/seqprep_1.3.2-9.diffoscope.html --text /srv/reproducible-results/rbuild-debian/r-b-build.xauTc67N/seqprep_1.3.2-9.diffoscope.txt --json /srv/reproducible-results/rbuild-debian/r-b-build.xauTc67N/seqprep_1.3.2-9.diffoscope.json --profile=- /srv/reproducible-results/rbuild-debian/r-b-build.xauTc67N/b1/seqprep_1.3.2-9_amd64.changes /srv/reproducible-results/rbuild-debian/r-b-build.xauTc67N/b2/seqprep_1.3.2-9_amd64.changes ## command (total time: 0.000s) 0.000s 1 call cmp (internal) ## has_same_content_as (total time: 0.000s) 0.000s 1 call abc.DotChangesFile ## main (total time: 0.756s) 0.756s 2 calls outputs 0.000s 1 call cleanup ## recognizes (total time: 0.394s) 0.394s 12 calls diffoscope.comparators.binary.FilesystemFile ## specialize (total time: 0.000s) 0.000s 1 call specialize Finished with result: success Main processes terminated with: code=exited/status=0 Service runtime: 1.125s CPU time consumed: 1.113s Sun Jun 2 13:32:13 UTC 2024 I: diffoscope 269 found no differences in the changes files, and a .buildinfo file also exists. Sun Jun 2 13:32:13 UTC 2024 I: seqprep from unstable built successfully and reproducibly on amd64. Sun Jun 2 13:32:15 UTC 2024 I: Submitting .buildinfo files to external archives: Sun Jun 2 13:32:15 UTC 2024 I: Submitting 8.0K b1/seqprep_1.3.2-9_amd64.buildinfo.asc Sun Jun 2 13:32:16 UTC 2024 I: Submitting 8.0K b2/seqprep_1.3.2-9_amd64.buildinfo.asc Sun Jun 2 13:32:17 UTC 2024 I: Done submitting .buildinfo files to http://buildinfo.debian.net/api/submit. Sun Jun 2 13:32:17 UTC 2024 I: Done submitting .buildinfo files. Sun Jun 2 13:32:17 UTC 2024 I: Removing signed seqprep_1.3.2-9_amd64.buildinfo.asc files: removed './b1/seqprep_1.3.2-9_amd64.buildinfo.asc' removed './b2/seqprep_1.3.2-9_amd64.buildinfo.asc'