Thu Jul 8 23:18:25 UTC 2021 I: starting to build bowtie/bullseye/arm64 on jenkins on '2021-07-08 23:18' Thu Jul 8 23:18:25 UTC 2021 I: The jenkins build log is/was available at https://jenkins.debian.net/userContent/reproducible/debian/build_service/arm64_9/7763/console.log Thu Jul 8 23:18:26 UTC 2021 I: Downloading source for bullseye/bowtie=1.3.0+dfsg1-1 --2021-07-08 23:18:26-- http://cdn-fastly.deb.debian.org/debian/pool/main/b/bowtie/bowtie_1.3.0+dfsg1-1.dsc Connecting to 78.137.99.97:3128... connected. Proxy request sent, awaiting response... 200 OK Length: 2438 (2.4K) Saving to: ‘bowtie_1.3.0+dfsg1-1.dsc’ 0K .. 100% 2.30M=0.001s 2021-07-08 23:18:26 (2.30 MB/s) - ‘bowtie_1.3.0+dfsg1-1.dsc’ saved [2438/2438] Thu Jul 8 23:18:26 UTC 2021 I: bowtie_1.3.0+dfsg1-1.dsc -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA256 Format: 3.0 (quilt) Source: bowtie Binary: bowtie, bowtie-examples Architecture: any-amd64 alpha arm64 mips64el ppc64 ppc64el s390x sparc64 riscv64 all Version: 1.3.0+dfsg1-1 Maintainer: Debian Med Packaging Team Uploaders: Steffen Moeller , Andreas Tille , Ognyan Kulev , Stephan Struckmann , Alexandre Mestiashvili Homepage: http://bowtie-bio.sourceforge.net/ Standards-Version: 4.5.0 Vcs-Browser: https://salsa.debian.org/med-team/bowtie Vcs-Git: https://salsa.debian.org/med-team/bowtie.git Testsuite: autopkgtest Build-Depends: debhelper-compat (= 13), help2man, libtbb-dev, python3, zlib1g-dev, libclone-perl, libtest-deep-perl, libsys-info-perl Package-List: bowtie deb science optional arch=alpha,any-amd64,arm64,mips64el,ppc64,ppc64el,s390x,sparc64,riscv64 bowtie-examples deb science optional arch=all Checksums-Sha1: ebc64a418d12853acb2bfc2770a2a2ec492b96bf 6774940 bowtie_1.3.0+dfsg1.orig.tar.xz b96e7641755328a818a867175cb661d6c9561e8c 18712 bowtie_1.3.0+dfsg1-1.debian.tar.xz Checksums-Sha256: b7871ac3eb0d2cfcd504c641313afe580ebc416fafcf8ecfbf84ca05ec6df195 6774940 bowtie_1.3.0+dfsg1.orig.tar.xz 3f5445dbc8d2785b975ff63500f69924b72a2c24d63ed9777930859b2b0ada05 18712 bowtie_1.3.0+dfsg1-1.debian.tar.xz Files: 7e51ceba6ad59c4d8440b085c4345199 6774940 bowtie_1.3.0+dfsg1.orig.tar.xz 1a27c81ba0470de63d6b74e5d9ffa9ec 18712 bowtie_1.3.0+dfsg1-1.debian.tar.xz -----BEGIN PGP SIGNATURE----- iQJFBAEBCAAvFiEE8fAHMgoDVUHwpmPKV4oElNHGRtEFAl+FlzgRHHRpbGxlQGRl Ymlhbi5vcmcACgkQV4oElNHGRtGHjQ//b87iXVrRheIgkSsDQMCZjB0Rt37EQFi3 IJqAF4REv4iKSDH23uTUIqdsBEUrRRRmd4oRQPSRXppfRF36f2UWYuHUWOp9phrU e6bnLP2wzv4H/cTbzXom1ZYLqnu1z6UGZhjgn9t26+hJFbVrj2qrF34TPgTwJD+D S7FDFdrQIzNsRhBkmXI+wNA186oHD2HHgf+0PWH5VmGC7EU2KqmQfvIlCekA7k71 IQnL+goQLhBs3xOMuW1WwIvId6km060Ev/NGda/40dwZiQjfX+GeQZYq6cI4iRVU o34ePTmrh2znXQ/SYuvl9Bl1FMHWBJCTlplg7o04bxX1IiHhZbo1HMfiocBEoPB8 8nD8koUdGSPKXpExcbVlXy9FOqg4fjJoR5pfT9nNQZQNZB9KAxeCnhuc7W+uWyhY H5mJGT8QODDV/v0MI91t8uGLlligcGS35Ebh5xRtVa4UM1ZScTBPSSiK1xXDgfc3 CyqDtS2MBvFL7QJVQnfppvz+/zc5Cp88w0EHRBjwtfWrWUc6srB/8rvhhOQIazPu MItP29Vbj66r/pJ+Ya/yR5ZSq7zWvIysjj5TpETg+xiqMlT/kX4Wex8SWLGCthw3 MxdHwVBaNg4jYy4bfDeHNjxBSdHNk6hsnNuPRtdacBBdlomtJjZ2IfFZZZpxHw/M m8hOPsRw5z0= =Yjs2 -----END PGP SIGNATURE----- Thu Jul 8 23:18:26 UTC 2021 I: Checking whether the package is not for us Thu Jul 8 23:18:26 UTC 2021 I: Starting 1st build on remote node codethink11-arm64.debian.net. Thu Jul 8 23:18:26 UTC 2021 I: Preparing to do remote build '1' on codethink11-arm64.debian.net. Thu Jul 8 23:39:17 UTC 2021 I: Deleting $TMPDIR on codethink11-arm64.debian.net. I: pbuilder: network access will be disabled during build I: Current time: Wed Aug 10 17:41:29 -12 2022 I: pbuilder-time-stamp: 1660196489 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/bullseye-reproducible-base.tgz] I: copying local configuration I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: Copying source file I: copying [bowtie_1.3.0+dfsg1-1.dsc] I: copying [./bowtie_1.3.0+dfsg1.orig.tar.xz] I: copying [./bowtie_1.3.0+dfsg1-1.debian.tar.xz] I: Extracting source gpgv: unknown type of key resource 'trustedkeys.kbx' gpgv: keyblock resource '/tmp/dpkg-verify-sig.Bgr9IO9J/trustedkeys.kbx': General error gpgv: Signature made Tue Oct 13 00:02:00 2020 -12 gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 gpgv: issuer "tille@debian.org" gpgv: Can't check signature: No public key dpkg-source: warning: failed to verify signature on ./bowtie_1.3.0+dfsg1-1.dsc dpkg-source: info: extracting bowtie in bowtie-1.3.0+dfsg1 dpkg-source: info: unpacking bowtie_1.3.0+dfsg1.orig.tar.xz dpkg-source: info: unpacking bowtie_1.3.0+dfsg1-1.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying strip_html5shiv.patch dpkg-source: info: applying spelling.patch dpkg-source: info: applying no_hash_style_both_for_mips.patch dpkg-source: info: applying use-dpkg-buildflags.patch dpkg-source: info: applying reproducible.patch dpkg-source: info: applying build-as-Cpp03.patch dpkg-source: info: applying simple-test dpkg-source: info: applying popcnt_capability.patch I: Not using root during the build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/14012/tmp/hooks/D02_print_environment starting I: set BUILDDIR='/build' BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' BUILDUSERNAME='pbuilder1' BUILD_ARCH='arm64' DEBIAN_FRONTEND='noninteractive' DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all,-fixfilepath parallel=8' DISTRIBUTION='' HOME='/var/lib/jenkins' HOST_ARCH='arm64' IFS=' ' LANG='C' LANGUAGE='en_US:en' LC_ALL='C' MAIL='/var/mail/root' OPTIND='1' PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' PBCURRENTCOMMANDLINEOPERATION='build' PBUILDER_OPERATION='build' PBUILDER_PKGDATADIR='/usr/share/pbuilder' PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' PBUILDER_SYSCONFDIR='/etc' PPID='14012' PS1='# ' PS2='> ' PS4='+ ' PWD='/' SHELL='/bin/bash' SHLVL='2' SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/tmp.iIpQeQg7Dr/pbuilderrc_hKKL --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/bullseye-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/tmp.iIpQeQg7Dr/b1 --logfile b1/build.log bowtie_1.3.0+dfsg1-1.dsc' SUDO_GID='117' SUDO_UID='110' SUDO_USER='jenkins' TERM='unknown' TZ='/usr/share/zoneinfo/Etc/GMT+12' USER='root' USERNAME='root' _='/usr/bin/systemd-run' http_proxy='http://192.168.101.16:3128' I: uname -a Linux codethink11-arm64 4.15.0-147-generic #151-Ubuntu SMP Fri Jun 18 19:18:37 UTC 2021 aarch64 GNU/Linux I: ls -l /bin total 5252 -rwxr-xr-x 1 root root 1282512 Jun 21 2021 bash -rwxr-xr-x 3 root root 34808 Jul 20 2020 bunzip2 -rwxr-xr-x 3 root root 34808 Jul 20 2020 bzcat lrwxrwxrwx 1 root root 6 Jul 20 2020 bzcmp -> bzdiff -rwxr-xr-x 1 root root 2225 Jul 20 2020 bzdiff lrwxrwxrwx 1 root root 6 Jul 20 2020 bzegrep -> bzgrep -rwxr-xr-x 1 root root 4877 Sep 4 2019 bzexe lrwxrwxrwx 1 root root 6 Jul 20 2020 bzfgrep -> bzgrep -rwxr-xr-x 1 root root 3775 Jul 20 2020 bzgrep -rwxr-xr-x 3 root root 34808 Jul 20 2020 bzip2 -rwxr-xr-x 1 root root 14264 Jul 20 2020 bzip2recover lrwxrwxrwx 1 root root 6 Jul 20 2020 bzless -> bzmore -rwxr-xr-x 1 root root 1297 Jul 20 2020 bzmore -rwxr-xr-x 1 root root 39832 Sep 22 2020 cat -rwxr-xr-x 1 root root 64512 Sep 22 2020 chgrp -rwxr-xr-x 1 root root 60368 Sep 22 2020 chmod -rwxr-xr-x 1 root root 64528 Sep 22 2020 chown -rwxr-xr-x 1 root root 138896 Sep 22 2020 cp -rwxr-xr-x 1 root root 129544 Dec 10 2020 dash -rwxr-xr-x 1 root root 101384 Sep 22 2020 date -rwxr-xr-x 1 root root 80984 Sep 22 2020 dd -rwxr-xr-x 1 root root 89824 Sep 22 2020 df -rwxr-xr-x 1 root root 143088 Sep 22 2020 dir -rwxr-xr-x 1 root root 76152 Feb 7 2021 dmesg lrwxrwxrwx 1 root root 8 Nov 6 2019 dnsdomainname -> hostname lrwxrwxrwx 1 root root 8 Nov 6 2019 domainname -> hostname -rwxr-xr-x 1 root root 35632 Sep 22 2020 echo -rwxr-xr-x 1 root root 28 Nov 9 2020 egrep -rwxr-xr-x 1 root root 31512 Sep 22 2020 false -rwxr-xr-x 1 root root 28 Nov 9 2020 fgrep -rwxr-xr-x 1 root root 64856 Feb 7 2021 findmnt -rwsr-xr-x 1 root root 34824 Feb 26 2021 fusermount -rwxr-xr-x 1 root root 178400 Nov 9 2020 grep -rwxr-xr-x 2 root root 2346 Mar 2 2021 gunzip -rwxr-xr-x 1 root root 6376 Mar 2 2021 gzexe -rwxr-xr-x 1 root root 93744 Mar 2 2021 gzip -rwxr-xr-x 1 root root 18440 Nov 6 2019 hostname -rwxr-xr-x 1 root root 68720 Sep 22 2020 ln -rwxr-xr-x 1 root root 52720 Feb 7 2020 login -rwxr-xr-x 1 root root 143088 Sep 22 2020 ls -rwxr-xr-x 1 root root 161960 Feb 7 2021 lsblk -rwxr-xr-x 1 root root 85200 Sep 22 2020 mkdir -rwxr-xr-x 1 root root 68744 Sep 22 2020 mknod -rwxr-xr-x 1 root root 43976 Sep 22 2020 mktemp -rwxr-xr-x 1 root root 51368 Feb 7 2021 more -rwsr-xr-x 1 root root 51360 Feb 7 2021 mount -rwxr-xr-x 1 root root 14496 Feb 7 2021 mountpoint -rwxr-xr-x 1 root root 134808 Sep 22 2020 mv lrwxrwxrwx 1 root root 8 Nov 6 2019 nisdomainname -> hostname lrwxrwxrwx 1 root root 14 Apr 18 2021 pidof -> /sbin/killall5 -rwxr-xr-x 1 root root 35720 Sep 22 2020 pwd lrwxrwxrwx 1 root root 4 Jun 21 2021 rbash -> bash -rwxr-xr-x 1 root root 43872 Sep 22 2020 readlink -rwxr-xr-x 1 root root 68592 Sep 22 2020 rm -rwxr-xr-x 1 root root 43880 Sep 22 2020 rmdir -rwxr-xr-x 1 root root 19208 Sep 27 2020 run-parts -rwxr-xr-x 1 root root 114016 Dec 22 2018 sed lrwxrwxrwx 1 root root 4 Aug 10 03:47 sh -> dash -rwxr-xr-x 1 root root 35656 Sep 22 2020 sleep -rwxr-xr-x 1 root root 72640 Sep 22 2020 stty -rwsr-xr-x 1 root root 67776 Feb 7 2021 su -rwxr-xr-x 1 root root 35672 Sep 22 2020 sync -rwxr-xr-x 1 root root 535768 Feb 16 2021 tar -rwxr-xr-x 1 root root 10568 Sep 27 2020 tempfile -rwxr-xr-x 1 root root 89120 Sep 22 2020 touch -rwxr-xr-x 1 root root 31512 Sep 22 2020 true -rwxr-xr-x 1 root root 14264 Feb 26 2021 ulockmgr_server -rwsr-xr-x 1 root root 30880 Feb 7 2021 umount -rwxr-xr-x 1 root root 35640 Sep 22 2020 uname -rwxr-xr-x 2 root root 2346 Mar 2 2021 uncompress -rwxr-xr-x 1 root root 143088 Sep 22 2020 vdir -rwxr-xr-x 1 root root 59584 Feb 7 2021 wdctl lrwxrwxrwx 1 root root 8 Nov 6 2019 ypdomainname -> hostname -rwxr-xr-x 1 root root 1984 Mar 2 2021 zcat -rwxr-xr-x 1 root root 1678 Mar 2 2021 zcmp -rwxr-xr-x 1 root root 5880 Mar 2 2021 zdiff -rwxr-xr-x 1 root root 29 Mar 2 2021 zegrep -rwxr-xr-x 1 root root 29 Mar 2 2021 zfgrep -rwxr-xr-x 1 root root 2081 Mar 2 2021 zforce -rwxr-xr-x 1 root root 7585 Mar 2 2021 zgrep -rwxr-xr-x 1 root root 2206 Mar 2 2021 zless -rwxr-xr-x 1 root root 1842 Mar 2 2021 zmore -rwxr-xr-x 1 root root 4553 Mar 2 2021 znew I: user script /srv/workspace/pbuilder/14012/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: arm64 Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 13), help2man, libtbb-dev, python3, zlib1g-dev, libclone-perl, libtest-deep-perl, libsys-info-perl dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19646 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 13); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on help2man; however: Package help2man is not installed. pbuilder-satisfydepends-dummy depends on libtbb-dev; however: Package libtbb-dev is not installed. pbuilder-satisfydepends-dummy depends on python3; however: Package python3 is not installed. pbuilder-satisfydepends-dummy depends on zlib1g-dev; however: Package zlib1g-dev is not installed. pbuilder-satisfydepends-dummy depends on libclone-perl; however: Package libclone-perl is not installed. pbuilder-satisfydepends-dummy depends on libtest-deep-perl; however: Package libtest-deep-perl is not installed. pbuilder-satisfydepends-dummy depends on libsys-info-perl; however: Package libsys-info-perl is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} automake{a} autopoint{a} autotools-dev{a} bsdextrautils{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} gettext{a} gettext-base{a} groff-base{a} help2man{a} intltool-debian{a} libarchive-zip-perl{a} libclone-perl{a} libconfig-general-perl{a} libdebhelper-perl{a} libelf1{a} libexpat1{a} libfile-stripnondeterminism-perl{a} libicu67{a} liblocale-gettext-perl{a} libmagic-mgc{a} libmagic1{a} libmpdec3{a} libpipeline1{a} libpython3-stdlib{a} libpython3.9-minimal{a} libpython3.9-stdlib{a} libreadline8{a} libsigsegv2{a} libsub-override-perl{a} libsys-info-base-perl{a} libsys-info-driver-linux-perl{a} libsys-info-perl{a} libtbb-dev{a} libtbb2{a} libtest-deep-perl{a} libtool{a} libuchardet0{a} libunix-processors-perl{a} libxml2{a} m4{a} man-db{a} media-types{a} po-debconf{a} python3{a} python3-minimal{a} python3.9{a} python3.9-minimal{a} readline-common{a} sensible-utils{a} zlib1g-dev{a} The following packages are RECOMMENDED but will NOT be installed: ca-certificates curl libarchive-cpio-perl libltdl-dev libmail-sendmail-perl lynx wget 0 packages upgraded, 55 newly installed, 0 to remove and 0 not upgraded. Need to get 24.3 MB of archives. After unpacking 92.0 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian bullseye/main arm64 bsdextrautils arm64 2.36.1-7 [141 kB] Get: 2 http://deb.debian.org/debian bullseye/main arm64 libuchardet0 arm64 0.0.7-1 [67.9 kB] Get: 3 http://deb.debian.org/debian bullseye/main arm64 groff-base arm64 1.22.4-6 [883 kB] Get: 4 http://deb.debian.org/debian bullseye/main arm64 libpipeline1 arm64 1.5.3-1 [33.0 kB] Get: 5 http://deb.debian.org/debian bullseye/main arm64 man-db arm64 2.9.4-2 [1336 kB] Get: 6 http://deb.debian.org/debian bullseye/main arm64 liblocale-gettext-perl arm64 1.07-4+b1 [18.9 kB] Get: 7 http://deb.debian.org/debian bullseye/main arm64 libpython3.9-minimal arm64 3.9.2-1 [797 kB] Get: 8 http://deb.debian.org/debian bullseye/main arm64 libexpat1 arm64 2.2.10-2 [83.1 kB] Get: 9 http://deb.debian.org/debian bullseye/main arm64 python3.9-minimal arm64 3.9.2-1 [1884 kB] Get: 10 http://deb.debian.org/debian bullseye/main arm64 python3-minimal arm64 3.9.2-3 [38.2 kB] Get: 11 http://deb.debian.org/debian bullseye/main arm64 media-types all 4.0.0 [30.3 kB] Get: 12 http://deb.debian.org/debian bullseye/main arm64 libmpdec3 arm64 2.5.1-1 [84.4 kB] Get: 13 http://deb.debian.org/debian bullseye/main arm64 readline-common all 8.1-1 [73.7 kB] Get: 14 http://deb.debian.org/debian bullseye/main arm64 libreadline8 arm64 8.1-1 [160 kB] Get: 15 http://deb.debian.org/debian bullseye/main arm64 libpython3.9-stdlib arm64 3.9.2-1 [1658 kB] Get: 16 http://deb.debian.org/debian bullseye/main arm64 python3.9 arm64 3.9.2-1 [466 kB] Get: 17 http://deb.debian.org/debian bullseye/main arm64 libpython3-stdlib arm64 3.9.2-3 [21.4 kB] Get: 18 http://deb.debian.org/debian bullseye/main arm64 python3 arm64 3.9.2-3 [37.9 kB] Get: 19 http://deb.debian.org/debian bullseye/main arm64 sensible-utils all 0.0.14 [14.8 kB] Get: 20 http://deb.debian.org/debian bullseye/main arm64 libmagic-mgc arm64 1:5.39-3 [273 kB] Get: 21 http://deb.debian.org/debian bullseye/main arm64 libmagic1 arm64 1:5.39-3 [121 kB] Get: 22 http://deb.debian.org/debian bullseye/main arm64 file arm64 1:5.39-3 [69.1 kB] Get: 23 http://deb.debian.org/debian bullseye/main arm64 gettext-base arm64 0.21-4 [173 kB] Get: 24 http://deb.debian.org/debian bullseye/main arm64 libsigsegv2 arm64 2.13-1 [34.7 kB] Get: 25 http://deb.debian.org/debian bullseye/main arm64 m4 arm64 1.4.18-5 [199 kB] Get: 26 http://deb.debian.org/debian bullseye/main arm64 autoconf all 2.69-14 [313 kB] Get: 27 http://deb.debian.org/debian bullseye/main arm64 autotools-dev all 20180224.1+nmu1 [77.1 kB] Get: 28 http://deb.debian.org/debian bullseye/main arm64 automake all 1:1.16.3-2 [814 kB] Get: 29 http://deb.debian.org/debian bullseye/main arm64 autopoint all 0.21-4 [510 kB] Get: 30 http://deb.debian.org/debian bullseye/main arm64 libdebhelper-perl all 13.3.4 [189 kB] Get: 31 http://deb.debian.org/debian bullseye/main arm64 libtool all 2.4.6-15 [513 kB] Get: 32 http://deb.debian.org/debian bullseye/main arm64 dh-autoreconf all 20 [17.1 kB] Get: 33 http://deb.debian.org/debian bullseye/main arm64 libarchive-zip-perl all 1.68-1 [104 kB] Get: 34 http://deb.debian.org/debian bullseye/main arm64 libsub-override-perl all 0.09-2 [10.2 kB] Get: 35 http://deb.debian.org/debian bullseye/main arm64 libfile-stripnondeterminism-perl all 1.11.0-1 [25.6 kB] Get: 36 http://deb.debian.org/debian bullseye/main arm64 dh-strip-nondeterminism all 1.11.0-1 [15.3 kB] Get: 37 http://deb.debian.org/debian bullseye/main arm64 libelf1 arm64 0.183-1 [164 kB] Get: 38 http://deb.debian.org/debian bullseye/main arm64 dwz arm64 0.13+20210201-1 [155 kB] Get: 39 http://deb.debian.org/debian bullseye/main arm64 libicu67 arm64 67.1-7 [8467 kB] Get: 40 http://deb.debian.org/debian bullseye/main arm64 libxml2 arm64 2.9.10+dfsg-6.7 [629 kB] Get: 41 http://deb.debian.org/debian bullseye/main arm64 gettext arm64 0.21-4 [1261 kB] Get: 42 http://deb.debian.org/debian bullseye/main arm64 intltool-debian all 0.35.0+20060710.5 [26.8 kB] Get: 43 http://deb.debian.org/debian bullseye/main arm64 po-debconf all 1.0.21+nmu1 [248 kB] Get: 44 http://deb.debian.org/debian bullseye/main arm64 debhelper all 13.3.4 [1049 kB] Get: 45 http://deb.debian.org/debian bullseye/main arm64 help2man arm64 1.48.1 [190 kB] Get: 46 http://deb.debian.org/debian bullseye/main arm64 libclone-perl arm64 0.45-1+b1 [15.3 kB] Get: 47 http://deb.debian.org/debian bullseye/main arm64 libconfig-general-perl all 2.63-1 [70.5 kB] Get: 48 http://deb.debian.org/debian bullseye/main arm64 libsys-info-base-perl all 0.7807-3 [28.3 kB] Get: 49 http://deb.debian.org/debian bullseye/main arm64 libunix-processors-perl arm64 2.046-2+b1 [16.7 kB] Get: 50 http://deb.debian.org/debian bullseye/main arm64 libsys-info-driver-linux-perl all 0.7905-2 [24.4 kB] Get: 51 http://deb.debian.org/debian bullseye/main arm64 libsys-info-perl all 0.7811-2 [8532 B] Get: 52 http://deb.debian.org/debian bullseye/main arm64 libtbb2 arm64 2020.3-1 [131 kB] Get: 53 http://deb.debian.org/debian bullseye/main arm64 libtbb-dev arm64 2020.3-1 [313 kB] Get: 54 http://deb.debian.org/debian bullseye/main arm64 libtest-deep-perl all 1.130-1 [49.3 kB] Get: 55 http://deb.debian.org/debian bullseye/main arm64 zlib1g-dev arm64 1:1.2.11.dfsg-2 [189 kB] Fetched 24.3 MB in 1s (47.7 MB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package bsdextrautils. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19646 files and directories currently installed.) Preparing to unpack .../0-bsdextrautils_2.36.1-7_arm64.deb ... Unpacking bsdextrautils (2.36.1-7) ... Selecting previously unselected package libuchardet0:arm64. Preparing to unpack .../1-libuchardet0_0.0.7-1_arm64.deb ... Unpacking libuchardet0:arm64 (0.0.7-1) ... Selecting previously unselected package groff-base. Preparing to unpack .../2-groff-base_1.22.4-6_arm64.deb ... Unpacking groff-base (1.22.4-6) ... Selecting previously unselected package libpipeline1:arm64. Preparing to unpack .../3-libpipeline1_1.5.3-1_arm64.deb ... Unpacking libpipeline1:arm64 (1.5.3-1) ... Selecting previously unselected package man-db. Preparing to unpack .../4-man-db_2.9.4-2_arm64.deb ... Unpacking man-db (2.9.4-2) ... Selecting previously unselected package liblocale-gettext-perl. Preparing to unpack .../5-liblocale-gettext-perl_1.07-4+b1_arm64.deb ... Unpacking liblocale-gettext-perl (1.07-4+b1) ... Selecting previously unselected package libpython3.9-minimal:arm64. Preparing to unpack .../6-libpython3.9-minimal_3.9.2-1_arm64.deb ... Unpacking libpython3.9-minimal:arm64 (3.9.2-1) ... Selecting previously unselected package libexpat1:arm64. Preparing to unpack .../7-libexpat1_2.2.10-2_arm64.deb ... Unpacking libexpat1:arm64 (2.2.10-2) ... Selecting previously unselected package python3.9-minimal. Preparing to unpack .../8-python3.9-minimal_3.9.2-1_arm64.deb ... Unpacking python3.9-minimal (3.9.2-1) ... Setting up libpython3.9-minimal:arm64 (3.9.2-1) ... Setting up libexpat1:arm64 (2.2.10-2) ... Setting up python3.9-minimal (3.9.2-1) ... Selecting previously unselected package python3-minimal. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20528 files and directories currently installed.) Preparing to unpack .../0-python3-minimal_3.9.2-3_arm64.deb ... Unpacking python3-minimal (3.9.2-3) ... Selecting previously unselected package media-types. Preparing to unpack .../1-media-types_4.0.0_all.deb ... Unpacking media-types (4.0.0) ... Selecting previously unselected package libmpdec3:arm64. Preparing to unpack .../2-libmpdec3_2.5.1-1_arm64.deb ... Unpacking libmpdec3:arm64 (2.5.1-1) ... Selecting previously unselected package readline-common. Preparing to unpack .../3-readline-common_8.1-1_all.deb ... Unpacking readline-common (8.1-1) ... Selecting previously unselected package libreadline8:arm64. Preparing to unpack .../4-libreadline8_8.1-1_arm64.deb ... Unpacking libreadline8:arm64 (8.1-1) ... Selecting previously unselected package libpython3.9-stdlib:arm64. Preparing to unpack .../5-libpython3.9-stdlib_3.9.2-1_arm64.deb ... Unpacking libpython3.9-stdlib:arm64 (3.9.2-1) ... Selecting previously unselected package python3.9. Preparing to unpack .../6-python3.9_3.9.2-1_arm64.deb ... Unpacking python3.9 (3.9.2-1) ... Selecting previously unselected package libpython3-stdlib:arm64. Preparing to unpack .../7-libpython3-stdlib_3.9.2-3_arm64.deb ... Unpacking libpython3-stdlib:arm64 (3.9.2-3) ... Setting up python3-minimal (3.9.2-3) ... Selecting previously unselected package python3. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20949 files and directories currently installed.) Preparing to unpack .../00-python3_3.9.2-3_arm64.deb ... Unpacking python3 (3.9.2-3) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../01-sensible-utils_0.0.14_all.deb ... Unpacking sensible-utils (0.0.14) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../02-libmagic-mgc_1%3a5.39-3_arm64.deb ... Unpacking libmagic-mgc (1:5.39-3) ... Selecting previously unselected package libmagic1:arm64. Preparing to unpack .../03-libmagic1_1%3a5.39-3_arm64.deb ... Unpacking libmagic1:arm64 (1:5.39-3) ... Selecting previously unselected package file. Preparing to unpack .../04-file_1%3a5.39-3_arm64.deb ... Unpacking file (1:5.39-3) ... Selecting previously unselected package gettext-base. Preparing to unpack .../05-gettext-base_0.21-4_arm64.deb ... Unpacking gettext-base (0.21-4) ... Selecting previously unselected package libsigsegv2:arm64. Preparing to unpack .../06-libsigsegv2_2.13-1_arm64.deb ... Unpacking libsigsegv2:arm64 (2.13-1) ... Selecting previously unselected package m4. Preparing to unpack .../07-m4_1.4.18-5_arm64.deb ... Unpacking m4 (1.4.18-5) ... Selecting previously unselected package autoconf. Preparing to unpack .../08-autoconf_2.69-14_all.deb ... Unpacking autoconf (2.69-14) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../09-autotools-dev_20180224.1+nmu1_all.deb ... Unpacking autotools-dev (20180224.1+nmu1) ... Selecting previously unselected package automake. Preparing to unpack .../10-automake_1%3a1.16.3-2_all.deb ... Unpacking automake (1:1.16.3-2) ... Selecting previously unselected package autopoint. Preparing to unpack .../11-autopoint_0.21-4_all.deb ... Unpacking autopoint (0.21-4) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../12-libdebhelper-perl_13.3.4_all.deb ... Unpacking libdebhelper-perl (13.3.4) ... Selecting previously unselected package libtool. Preparing to unpack .../13-libtool_2.4.6-15_all.deb ... Unpacking libtool (2.4.6-15) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../14-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../15-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libsub-override-perl. Preparing to unpack .../16-libsub-override-perl_0.09-2_all.deb ... Unpacking libsub-override-perl (0.09-2) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../17-libfile-stripnondeterminism-perl_1.11.0-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.11.0-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../18-dh-strip-nondeterminism_1.11.0-1_all.deb ... Unpacking dh-strip-nondeterminism (1.11.0-1) ... Selecting previously unselected package libelf1:arm64. Preparing to unpack .../19-libelf1_0.183-1_arm64.deb ... Unpacking libelf1:arm64 (0.183-1) ... Selecting previously unselected package dwz. Preparing to unpack .../20-dwz_0.13+20210201-1_arm64.deb ... Unpacking dwz (0.13+20210201-1) ... Selecting previously unselected package libicu67:arm64. Preparing to unpack .../21-libicu67_67.1-7_arm64.deb ... Unpacking libicu67:arm64 (67.1-7) ... Selecting previously unselected package libxml2:arm64. Preparing to unpack .../22-libxml2_2.9.10+dfsg-6.7_arm64.deb ... Unpacking libxml2:arm64 (2.9.10+dfsg-6.7) ... Selecting previously unselected package gettext. Preparing to unpack .../23-gettext_0.21-4_arm64.deb ... Unpacking gettext (0.21-4) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../24-intltool-debian_0.35.0+20060710.5_all.deb ... Unpacking intltool-debian (0.35.0+20060710.5) ... Selecting previously unselected package po-debconf. Preparing to unpack .../25-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../26-debhelper_13.3.4_all.deb ... Unpacking debhelper (13.3.4) ... Selecting previously unselected package help2man. Preparing to unpack .../27-help2man_1.48.1_arm64.deb ... Unpacking help2man (1.48.1) ... Selecting previously unselected package libclone-perl. Preparing to unpack .../28-libclone-perl_0.45-1+b1_arm64.deb ... Unpacking libclone-perl (0.45-1+b1) ... Selecting previously unselected package libconfig-general-perl. Preparing to unpack .../29-libconfig-general-perl_2.63-1_all.deb ... Unpacking libconfig-general-perl (2.63-1) ... Selecting previously unselected package libsys-info-base-perl. Preparing to unpack .../30-libsys-info-base-perl_0.7807-3_all.deb ... Unpacking libsys-info-base-perl (0.7807-3) ... Selecting previously unselected package libunix-processors-perl. Preparing to unpack .../31-libunix-processors-perl_2.046-2+b1_arm64.deb ... Unpacking libunix-processors-perl (2.046-2+b1) ... Selecting previously unselected package libsys-info-driver-linux-perl. Preparing to unpack .../32-libsys-info-driver-linux-perl_0.7905-2_all.deb ... Unpacking libsys-info-driver-linux-perl (0.7905-2) ... Selecting previously unselected package libsys-info-perl. Preparing to unpack .../33-libsys-info-perl_0.7811-2_all.deb ... Unpacking libsys-info-perl (0.7811-2) ... Selecting previously unselected package libtbb2:arm64. Preparing to unpack .../34-libtbb2_2020.3-1_arm64.deb ... Unpacking libtbb2:arm64 (2020.3-1) ... Selecting previously unselected package libtbb-dev:arm64. Preparing to unpack .../35-libtbb-dev_2020.3-1_arm64.deb ... Unpacking libtbb-dev:arm64 (2020.3-1) ... Selecting previously unselected package libtest-deep-perl. Preparing to unpack .../36-libtest-deep-perl_1.130-1_all.deb ... Unpacking libtest-deep-perl (1.130-1) ... Selecting previously unselected package zlib1g-dev:arm64. Preparing to unpack .../37-zlib1g-dev_1%3a1.2.11.dfsg-2_arm64.deb ... Unpacking zlib1g-dev:arm64 (1:1.2.11.dfsg-2) ... Setting up media-types (4.0.0) ... Setting up libpipeline1:arm64 (1.5.3-1) ... Setting up libconfig-general-perl (2.63-1) ... Setting up bsdextrautils (2.36.1-7) ... update-alternatives: using /usr/bin/write.ul to provide /usr/bin/write (write) in auto mode Setting up libicu67:arm64 (67.1-7) ... Setting up libtest-deep-perl (1.130-1) ... Setting up libmagic-mgc (1:5.39-3) ... Setting up libclone-perl (0.45-1+b1) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libdebhelper-perl (13.3.4) ... Setting up libtbb2:arm64 (2020.3-1) ... Setting up libmagic1:arm64 (1:5.39-3) ... Setting up gettext-base (0.21-4) ... Setting up file (1:5.39-3) ... Setting up autotools-dev (20180224.1+nmu1) ... Setting up libsigsegv2:arm64 (2.13-1) ... Setting up libunix-processors-perl (2.046-2+b1) ... Setting up autopoint (0.21-4) ... Setting up zlib1g-dev:arm64 (1:1.2.11.dfsg-2) ... Setting up sensible-utils (0.0.14) ... Setting up libuchardet0:arm64 (0.0.7-1) ... Setting up libmpdec3:arm64 (2.5.1-1) ... Setting up libsub-override-perl (0.09-2) ... Setting up libtbb-dev:arm64 (2020.3-1) ... Setting up libsys-info-base-perl (0.7807-3) ... Setting up libelf1:arm64 (0.183-1) ... Setting up readline-common (8.1-1) ... Setting up libxml2:arm64 (2.9.10+dfsg-6.7) ... Setting up liblocale-gettext-perl (1.07-4+b1) ... Setting up libfile-stripnondeterminism-perl (1.11.0-1) ... Setting up gettext (0.21-4) ... Setting up libsys-info-driver-linux-perl (0.7905-2) ... Setting up libtool (2.4.6-15) ... Setting up libreadline8:arm64 (8.1-1) ... Setting up m4 (1.4.18-5) ... Setting up intltool-debian (0.35.0+20060710.5) ... Setting up help2man (1.48.1) ... Setting up autoconf (2.69-14) ... Setting up dh-strip-nondeterminism (1.11.0-1) ... Setting up dwz (0.13+20210201-1) ... Setting up groff-base (1.22.4-6) ... Setting up libpython3.9-stdlib:arm64 (3.9.2-1) ... Setting up libpython3-stdlib:arm64 (3.9.2-3) ... Setting up automake (1:1.16.3-2) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up libsys-info-perl (0.7811-2) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up man-db (2.9.4-2) ... Not building database; man-db/auto-update is not 'true'. Setting up dh-autoreconf (20) ... Setting up python3.9 (3.9.2-1) ... Setting up debhelper (13.3.4) ... Setting up python3 (3.9.2-3) ... Processing triggers for libc-bin (2.31-12) ... Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps I: Building the package I: Running cd /build/bowtie-1.3.0+dfsg1/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../bowtie_1.3.0+dfsg1-1_source.changes dpkg-buildpackage: info: source package bowtie dpkg-buildpackage: info: source version 1.3.0+dfsg1-1 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Andreas Tille dpkg-source --before-build . dpkg-buildpackage: info: host architecture arm64 debian/rules clean dh clean debian/rules override_dh_auto_clean make[1]: Entering directory '/build/bowtie-1.3.0+dfsg1' rm -f .bowtie* dh_auto_clean make -j8 clean make[2]: Entering directory '/build/bowtie-1.3.0+dfsg1' rm -f bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-build-s-debug bowtie-build-l-debug bowtie-align-s-debug bowtie-align-l-debug bowtie-inspect-s-debug bowtie-inspect-l-debug \ bowtie_prof \ bowtie-build-s.exe bowtie-build-l.exe bowtie-align-s.exe bowtie-align-l.exe bowtie-inspect-s.exe bowtie-inspect-l.exe bowtie-build-s-debug.exe bowtie-build-l-debug.exe bowtie-align-s-debug.exe bowtie-align-l-debug.exe bowtie-inspect-s-debug.exe bowtie-inspect-l-debug.exe bowtie_prof.exe \ bowtie-src.zip bowtie-bin.zip rm -f *.core rm -f bowtie-align-s-master* bowtie-align-s-no-io* rm -rf .lib .include make[2]: Leaving directory '/build/bowtie-1.3.0+dfsg1' make[1]: Leaving directory '/build/bowtie-1.3.0+dfsg1' dh_clean debian/rules binary dh binary dh_update_autotools_config dh_autoreconf dh_auto_configure debian/rules override_dh_auto_build make[1]: Entering directory '/build/bowtie-1.3.0+dfsg1' /usr/bin/make allall make[2]: Entering directory '/build/bowtie-1.3.0+dfsg1' g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,-z,now -lz -lpthread In file included from ebwt_build.cpp:8: ds.h: In function 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList*) [with T = S2bDnaString]': ds.h:497:3: warning: 'tmp2' may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: 'tmp3' may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: 'tmp4' may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h: In function 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList*) [with T = SString]': ds.h:497:3: warning: 'tmp2' may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: 'tmp3' may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: 'tmp4' may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,-z,now -lz -lpthread In file included from ebwt_build.cpp:8: ds.h: In function 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList*) [with T = S2bDnaString]': ds.h:497:3: warning: 'tmp2' may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: 'tmp3' may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: 'tmp4' may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h: In function 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList*) [with T = SString]': ds.h:497:3: warning: 'tmp2' may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: 'tmp3' may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: 'tmp4' may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,-z,now -lz -lpthread In file included from ebwt_build.cpp:8: ds.h: In function 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList*) [with T = S2bDnaString]': ds.h:497:3: warning: 'tmp2' may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: 'tmp3' may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: 'tmp4' may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h: In function 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList*) [with T = SString]': ds.h:497:3: warning: 'tmp2' may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: 'tmp3' may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: 'tmp4' may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,-z,now -lz -lpthread In file included from ebwt_build.cpp:8: ds.h: In function 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList*) [with T = S2bDnaString]': ds.h:497:3: warning: 'tmp2' may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: 'tmp3' may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: 'tmp4' may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h: In function 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList*) [with T = SString]': ds.h:497:3: warning: 'tmp2' may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: 'tmp3' may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ ds.h:497:3: warning: 'tmp4' may be used uninitialized in this function [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,-z,now -lz -lpthread g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=.=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -g -O2 -fdebug-prefix-map=/build/bowtie-1.3.0+dfsg1=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++03 -Wl,-z,relro -Wl,-z,now \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,-z,now -lz -lpthread make[2]: Leaving directory '/build/bowtie-1.3.0+dfsg1' make[1]: Leaving directory '/build/bowtie-1.3.0+dfsg1' debian/rules override_dh_auto_test make[1]: Entering directory '/build/bowtie-1.3.0+dfsg1' unset LD_PRELOAD && make simple-test make[2]: Entering directory '/build/bowtie-1.3.0+dfsg1' ./scripts/test/simple_tests.pl --bowtie=./bowtie --bowtie-build=./bowtie-build FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00@SQ SN:0 LN:19 %) Reported 3 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%)@SQ SN:0 LN:19 Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00@SQ SN:0 LN:12 %) Reported 3 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 100.00%) # reads that failed to align: 0 (@PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0.00%) Reported 1 alignments 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00@SQ SN:0 LN:19 %) Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted 100.00@SQ SN:0 LN:19 %) # reads that failed to align: 0 (0.00%) Reported 2 alignments@PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00@SQ SN:0 LN:19 %) # reads that failed to align: 0 (0.00%) @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" Reported 1 paired-end alignments 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) @SQ SN:0 LN:19 No alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00@SQ SN:0 LN:19 %) # reads that failed to align: 0 (0.00%)@PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0@SQ SN:0 LN:19 (0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1@SQ SN:0 LN:19 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (@HD VN:1.0 SO:unsorted 100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%)@SQ SN:0 LN:19 No alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%)@SQ SN:0 LN:19 # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%)@SQ SN:0 LN:19 Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00@SQ SN:0 LN:19 %) Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) @SQ SN:0 LN:19 No alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00@SQ SN:0 LN:19 %) # reads that failed to align: 0 (0.00%) @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" Reported 1 alignments 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00@SQ SN:0 LN:19 %) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%)@SQ SN:0 LN:19 No alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported @SQ SN:0 LN:19 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 0 (0.00%)@SQ SN:0 LN:19 No alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1@SQ SN:0 LN:19 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (@SQ SN:0 LN:19 0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) @SQ SN:0 LN:19 # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (@SQ SN:0 LN:19 100.00%) No alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00@SQ SN:0 LN:25 %) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (@SQ SN:0 LN:25 0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported @SQ SN:0 LN:25 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: @SQ SN:0 LN:25 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (@SQ SN:0 LN:25 0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) @SQ SN:0 LN:25 Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) @SQ SN:0 LN:25 Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%)@SQ SN:0 LN:25 # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments@PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) @SQ SN:0 LN:25 Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: @SQ SN:0 LN:16 0 (0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00@SQ SN:0 LN:16 %) # reads that failed to align: 0 (0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (@SQ SN:0 LN:24 100.00%) No alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00@SQ SN:0 LN:24 %) No alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00@SQ SN:0 LN:24 %) No alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: @SQ SN:0 LN:8 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments@SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0@SQ SN:0 LN:8 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0@SQ SN:0 LN:8 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported @SQ SN:0 LN:8 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:8 (@PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted 100.00@SQ SN:0 LN:19 %) # reads that failed to align: 0 (0.00%) Reported 3 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: @SQ SN:0 LN:19 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 0 (0.00%) No alignments@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00@SQ SN:0 LN:19 %) Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) @SQ SN:0 LN:19 Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 0 (0.00@SQ SN:0 LN:19 %) No alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00@SQ SN:0 LN:19 %) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 0 (0.00%)@SQ SN:0 LN:19 No alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (@SQ SN:0 LN:19 0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2@SQ SN:0 LN:19 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported @SQ SN:0 LN:19 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (@SQ SN:0 LN:19 100.00%) No alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00@SQ SN:0 LN:19 %) Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (@SQ SN:0 LN:19 0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:2 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 0 # reads with at least one alignment: 0 (@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:2 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:2 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) @SQ SN:0 LN:19 Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:2 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:2 Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00@SQ SN:0 LN:25 %) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported @SQ SN:0 LN:25 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (@SQ SN:0 LN:25 100.00%) No alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (@SQ SN:0 LN:25 100.00%) No alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00@SQ SN:0 LN:25 %) No alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%)@HD VN:1.0 SO:unsorted # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: @HD VN:1.0 SO:unsorted 1 (100.00@SQ SN:0 LN:25 %) # reads that failed to align: 0 (0.00%) Reported 1@PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" paired-end alignments r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1@SQ SN:0 LN:25 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported @SQ SN:0 LN:25 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (@SQ SN:0 LN:25 0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00@SQ SN:0 LN:25 %) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0@SQ SN:0 LN:25 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (@SQ SN:0 LN:25 0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:2 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2@SQ SN:0 LN:16 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:3 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00@SQ SN:0 LN:24 %) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (@SQ SN:0 LN:24 100.00%) No alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00@SQ SN:0 LN:24 %) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (@PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00@SQ SN:0 LN:8 %) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: @SQ SN:0 LN:8 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00@SQ SN:0 LN:8 %) Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:2 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (@SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" 0.00%) Reported 1 alignmentsr0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: @SQ SN:0 LN:8 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:2 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 100.00%) # reads that failed to align: 0 (0.00%)@PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" Reported 1 alignments r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) @SQ SN:0 LN:8 Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00@SQ SN:0 LN:8 %) Reported 1 alignments @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.0 CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:2 PASSED make[2]: Leaving directory '/build/bowtie-1.3.0+dfsg1' ln -s debian/tests unset LD_PRELOAD && sh debian/tests/run-unit-test test_at_build_time Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 5 alignments example1 OK Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments example2 OK Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 5 alignments example3 OK Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments example4 OK Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 5 alignments example5 OK example7 OK Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 5 alignments example8 OK Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments rm -f tests examples[0-9].out make[1]: Leaving directory '/build/bowtie-1.3.0+dfsg1' create-stamp debian/debhelper-build-stamp dh_prep dh_installdirs debian/rules override_dh_auto_install-arch make[1]: Entering directory '/build/bowtie-1.3.0+dfsg1' # remove strange byte-compyled Python code bowtie-buildc (no idea how and why it was created) find . -name bowtie-buildc -delete find . -name .cvsignore -delete make[1]: Leaving directory '/build/bowtie-1.3.0+dfsg1' dh_auto_install -Nbowtie make -j8 install DESTDIR=/build/bowtie-1.3.0\+dfsg1/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[1]: Entering directory '/build/bowtie-1.3.0+dfsg1' mkdir -p /build/bowtie-1.3.0+dfsg1/debian/tmp/usr/local/bin for file in bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-inspect bowtie-build bowtie ; do \ cp -f $file /build/bowtie-1.3.0+dfsg1/debian/tmp/usr/local/bin ; \ done make[1]: Leaving directory '/build/bowtie-1.3.0+dfsg1' debian/rules override_dh_install make[1]: Entering directory '/build/bowtie-1.3.0+dfsg1' dh_install if [ -d debian/tmp/usr/local/bin ] ; then \ dh_install -a usr/local/bin usr ; \ fi make[1]: Leaving directory '/build/bowtie-1.3.0+dfsg1' dh_installdocs dh_installchangelogs debian/rules override_dh_installman-arch make[1]: Entering directory '/build/bowtie-1.3.0+dfsg1' help2man --name="ultrafast memory-efficient short read aligner" --no-info \ /build/bowtie-1.3.0+dfsg1/bowtie > /build/bowtie-1.3.0+dfsg1/debian/bowtie/usr/share/man/man1/bowtie.1 help2man --name="building a colorspace index for bowtie" --no-info \ /build/bowtie-1.3.0+dfsg1/bowtie-build > /build/bowtie-1.3.0+dfsg1/debian/bowtie/usr/share/man/man1/bowtie-build.1 help2man --name="extracts information from a bowtie index" --no-info \ /build/bowtie-1.3.0+dfsg1/bowtie-inspect > /build/bowtie-1.3.0+dfsg1/debian/bowtie/usr/share/man/man1/bowtie-inspect.1 make[1]: Leaving directory '/build/bowtie-1.3.0+dfsg1' dh_lintian dh_perl dh_link dh_strip_nondeterminism debian/rules override_dh_compress make[1]: Entering directory '/build/bowtie-1.3.0+dfsg1' dh_compress -X.ebwt make[1]: Leaving directory '/build/bowtie-1.3.0+dfsg1' debian/rules override_dh_fixperms-indep make[1]: Entering directory '/build/bowtie-1.3.0+dfsg1' dh_fixperms chmod 644 debian/bowtie-examples/usr/share/doc/bowtie/examples/indexes/* make[1]: Leaving directory '/build/bowtie-1.3.0+dfsg1' dh_fixperms -Nbowtie-examples debian/rules override_dh_missing-indep make[1]: Entering directory '/build/bowtie-1.3.0+dfsg1' dh_missing -i --list-missing make[1]: Leaving directory '/build/bowtie-1.3.0+dfsg1' dh_missing -Nbowtie-examples dh_dwz -a dh_strip -a dh_makeshlibs -a dh_shlibdeps -a dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'bowtie-dbgsym' in '../bowtie-dbgsym_1.3.0+dfsg1-1_arm64.deb'. dpkg-deb: building package 'bowtie' in '../bowtie_1.3.0+dfsg1-1_arm64.deb'. dpkg-deb: building package 'bowtie-examples' in '../bowtie-examples_1.3.0+dfsg1-1_all.deb'. dpkg-genbuildinfo --build=binary dpkg-genchanges --build=binary >../bowtie_1.3.0+dfsg1-1_arm64.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: including full source code in upload I: copying local configuration I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/14012 and its subdirectories I: Current time: Wed Aug 10 18:02:13 -12 2022 I: pbuilder-time-stamp: 1660197733 Thu Jul 8 23:39:18 UTC 2021 I: 1st build successful. Starting 2nd build on remote node codethink10-arm64.debian.net. Thu Jul 8 23:39:18 UTC 2021 I: Preparing to do remote build '2' on codethink10-arm64.debian.net. Thu Jul 8 23:57:39 UTC 2021 I: Deleting $TMPDIR on codethink10-arm64.debian.net. Thu Jul 8 23:57:40 UTC 2021 I: bowtie_1.3.0+dfsg1-1_arm64.changes: Format: 1.8 Date: Tue, 13 Oct 2020 13:16:39 +0200 Source: bowtie Binary: bowtie bowtie-dbgsym bowtie-examples Architecture: arm64 all Version: 1.3.0+dfsg1-1 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team Changed-By: Andreas Tille Description: bowtie - Ultrafast memory-efficient short read aligner bowtie-examples - Examples for bowtie, the ultrafast memory-efficient short read al Closes: 972004 Changes: bowtie (1.3.0+dfsg1-1) unstable; urgency=medium . [ Andreas Tille ] * Really fix arch all build . [ Étienne Mollier ] * Excluded third_party/ Closes: #972004 * Reviewed debian/patches/popcnt_capability.patch Checksums-Sha1: cf66da29cbb8a3b7dc0873da94007b439ee37a76 13402612 bowtie-dbgsym_1.3.0+dfsg1-1_arm64.deb eeaf8b1978060ca06b691805813fa6e7bb7beaff 6307740 bowtie-examples_1.3.0+dfsg1-1_all.deb 6447fec88b4e4226cf33d42bc8ea8314e377d9af 6005 bowtie_1.3.0+dfsg1-1_arm64.buildinfo 3cd0d5d295ffc0f1f6dcca33fd59522bc9688738 1260568 bowtie_1.3.0+dfsg1-1_arm64.deb Checksums-Sha256: 48c5064ff6e24184c0f706fcdb0b899678cef2000751ab50ac1c557de72f02de 13402612 bowtie-dbgsym_1.3.0+dfsg1-1_arm64.deb 4934d855e709b53363e41ecc6195a3b19bfb34f8ddaaf3791de18cf2c61b1e53 6307740 bowtie-examples_1.3.0+dfsg1-1_all.deb 7f987c431cae1c20cc198a2e4d267836d8397a5d2b6fefb1f6afafeaf75f6830 6005 bowtie_1.3.0+dfsg1-1_arm64.buildinfo 40d81cf277f18d767b3e04026a2de2b8548872cb5d179db4c6c7a0d291e1fc37 1260568 bowtie_1.3.0+dfsg1-1_arm64.deb Files: 4546453184c070988a83d588cf59cf7b 13402612 debug optional bowtie-dbgsym_1.3.0+dfsg1-1_arm64.deb 996fbd7abd9f5b6c56dbabed676a14a9 6307740 science optional bowtie-examples_1.3.0+dfsg1-1_all.deb 228353d678a8eb924387a87b612e3a48 6005 science optional bowtie_1.3.0+dfsg1-1_arm64.buildinfo ae1d156043e86dc002b1f095a7df0d41 1260568 science optional bowtie_1.3.0+dfsg1-1_arm64.deb Thu Jul 8 23:57:41 UTC 2021 I: diffoscope 177 will be used to compare the two builds: # Profiling output for: /usr/bin/diffoscope --html /srv/reproducible-results/rbuild-debian/tmp.iIpQeQg7Dr/bowtie_1.3.0+dfsg1-1.diffoscope.html --text /srv/reproducible-results/rbuild-debian/tmp.iIpQeQg7Dr/bowtie_1.3.0+dfsg1-1.diffoscope.txt --json /srv/reproducible-results/rbuild-debian/tmp.iIpQeQg7Dr/bowtie_1.3.0+dfsg1-1.diffoscope.json --profile=- /srv/reproducible-results/rbuild-debian/tmp.iIpQeQg7Dr/b1/bowtie_1.3.0+dfsg1-1_arm64.changes /srv/reproducible-results/rbuild-debian/tmp.iIpQeQg7Dr/b2/bowtie_1.3.0+dfsg1-1_arm64.changes ## command (total time: 0.000s) 0.000s 1 call cmp (internal) ## has_same_content_as (total time: 0.000s) 0.000s 1 call abc.DotChangesFile ## main (total time: 0.416s) 0.416s 2 calls outputs 0.000s 1 call cleanup ## recognizes (total time: 0.198s) 0.198s 10 calls diffoscope.comparators.binary.FilesystemFile 0.000s 8 calls abc.DotChangesFile Thu Jul 8 23:57:43 UTC 2021 I: diffoscope 177 found no differences in the changes files, and a .buildinfo file also exists. Thu Jul 8 23:57:43 UTC 2021 I: bowtie from bullseye built successfully and reproducibly on arm64. Thu Jul 8 23:57:44 UTC 2021 I: Submitting .buildinfo files to external archives: Thu Jul 8 23:57:44 UTC 2021 I: Submitting 8.0K b1/bowtie_1.3.0+dfsg1-1_arm64.buildinfo.asc Thu Jul 8 23:57:45 UTC 2021 I: Submitting 8.0K b2/bowtie_1.3.0+dfsg1-1_arm64.buildinfo.asc Thu Jul 8 23:57:47 UTC 2021 I: Done submitting .buildinfo files to http://buildinfo.debian.net/api/submit. Thu Jul 8 23:57:47 UTC 2021 I: Done submitting .buildinfo files. Thu Jul 8 23:57:47 UTC 2021 I: Removing signed bowtie_1.3.0+dfsg1-1_arm64.buildinfo.asc files: removed './b1/bowtie_1.3.0+dfsg1-1_arm64.buildinfo.asc' removed './b2/bowtie_1.3.0+dfsg1-1_arm64.buildinfo.asc'